|
|
||||||||
Surgery Branch, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892
| Abstract |
|---|
|
|
|---|
. It recognizes the autologous RCC and most allogeneic RCC lines by IFN-
release (10 of 11 lines) and lysis (9 of 10 lines), but does not recognize multiple EBV B cells or fibroblasts. It shows little or no recognition of a panel of melanomas, breast cancers and non-small–cell lung cancers. Phenotypically, HC/2G-1 is CD3+CD4+ TCR
β+, but CD161–CD16–NKG2D–. Tumor recognition by clone HC/2G-1 was not blocked by Abs to HLA class I or class II, but was significantly reduced by anti-TCR
β Ab. Furthermore, tumor recognition was β2-microglobulin-independent. HC/2G-1 does not use a V
or Vβ described for classical NKT cells, but rather V
14 and Vβ2.1. Allogeneic T cells cotransfected with mRNAs encoding the
and β chains of the HC/2G-1 TCR recognized renal tumor lines, demonstrating that tumor recognition is TCR-mediated. Interestingly, TRAIL appears to play a role in tumor recognition by HC/2G-1 in that reactivity was blocked by anti-TRAIL Ab, and soluble TRAIL could enhance IFN-
secretion by HC/2G-1 in response to renal tumors. Our findings suggest that clone HC/2G-1 represents a novel type of CD4+ cell that has broad TCR-mediated recognition of a determinant widely expressed by RCC. | Introduction |
|---|
|
|
|---|
, and TNF-
, which can also affect CTL, APC, and tumor cells (2, 3, 4). Other types of cells with tumor reactivity, such as nonclassical CD8 and CD4 T cells, NK cells, and NKT cells, have also been reported and characterized (5, 6, 7, 8, 9). Among them, type I NKT cells, typically expressing an invariant TCR
-chain (V
24 in human; V
14 in mice) and β-chain (Vβ11 in human; varying in mice) and recognizing CD1d-restricted glycolipid Ags, such as
-galactosylceramide, iGb3 and diacylglycerol, have been shown to inhibit tumor growth in vivo (10, 11).
Clear cell renal cell carcinoma (RCC)3 has been shown to respond to immunotherapy with a 15–20% response rate to IL-2 and a 5–7% cure rate seen in selected patients with metastatic disease (12). However, there has been little further progress in treating metastatic RCC patients with immunotherapy in contrast with another immunoresponsive cancer, melanoma. This is mainly due to a disparity in identifying tumor-reactive T cells recognizing these two cancers. Previously, we developed a method to generate RCC-reactive T cells by stimulating patient PBL with dendritic cells (DCs) engulfing and presenting apoptotic tumor cells in a completely autologous setting (13). Because DCs express both MHC class I and class II molecules on their surface, we were able to generate both MHC class I- and class II-restricted RCC-specific CD8 and CD4 T cells. The ability to generate such T cells might be exploited by identifying tumor-associated Ags, developing vaccines, and administering cultured T cells for therapy in patients with RCC. However, there are no constraints on the nature of the tumor reactivity generated by this in vitro autologous tumor stimulation and there is also the potential for generating nonclassical immune cells that recognize tumor. In this study, we report the generation of such an RCC-reactive CD4 T cell clone (HC/2G-1) that recognizes multiple renal tumors in an MHC-independent fashion with IFN-
secretion and tumor lysis. This appears to be a novel immune reactivity by function and phenotype, which is largely specific for renal cancer. Tumor recognition is TCR
β-mediated, but MHC-independent and β2-microglobulin (β2m)-independent. Introducing the cloned TCR
and β chains of this clone into allogeneic lymphocytes stimulated with anti-CD3 confers a pattern of tumor reactivity similar to the parental clone. Furthermore, TNF-related apoptosis-inducing ligand (TRAIL) plays a role in tumor recognition by HC/2G-1 reactivity, as shown by blocking with anti-TRAIL Ab, and enhanced recognition when renal tumors were pretreated with soluble TRAIL. It is not clear what role this type of T cell plays in the immune response to human RCC, but it may be the source of novel immunotherapeutic strategies for treating this malignancy.
| Materials and Methods |
|---|
|
|
|---|
Tumor lines from RCC patients and EBV-transformed B cells (EBV-B cells) were established as previously described. RCC lines were maintained in DMEM (Invitrogen) including 10% FBS (Invitrogen), and EBV-B cells were maintained in RPMI 1640 (Invitrogen) including 10% FBS. Tumor lines used as controls in experiments were obtained from Surgery Branch Laboratories (National Cancer Institute, Bethesda, MD), and maintained in RPMI 1640 including 10% FBS. Human primary renal epithelial cells were a gift from Drs. S. Garrett and D. Sens (University of North Dakota, Grand Forks, ND), or purchased from Cambrex.
Reagents
For immunophenotyping, mAbs including FITC-labeled anti-human IgG isotypes, CD3, CD4, CD8, CD16, CD57, CD94, CD244, and TCR 
, PE-labeled anti-human IgG isotypes, CD3, CD4, CD8, TCR
β, CD56, CD161, NKG2D, and TRAIL, and allophycocyanin-labeled anti-human IgG isotypes, CD3, CD4, and CD8 were purchased from BD Pharmingen. PE-labeled anti-Vβ2 Ab was purchased from Beckman Coulter.
For blocking experiments, W6/32 (pan-anti-MHC class I) and IVA12 (pan-anti-MHC class II) were gifts of Dr. P. Robbins (National Cancer Institute, Bethesda, MD). Purified anti-human TCR
β (clone T10B9.1A-31), anti-human CD4, and anti-human TRAIL Abs were purchased from BD Pharmingen.
Granzyme B ELISA kit was purchased from Abcam. Soluble TRAIL (Apo2 ligand; aa 114–281) was purchased from Biomol.
In vitro stimulation, cloning, and expansion of RCC-specific T cells
To establish RCC-specific T cells, CD8- or CD4-enriched T cells (Miltenyi Biotec) were stimulated with day 6 DCs cocultured with UV-irradiated autologous tumor cells, as previously described with some modifications (13, 14). Briefly, CD14+ were isolated from patient PBMC using CD14 microbeads according to the manufacturers instructions (Miltenyi Biotec), and cultured in RPMI 1640, supplemented with 10% human serum (Valley Biomedical), GM-CSF (1000 U/ml; PeproTech), and IL-4 (1000 U/ml; PeproTech) for 6 days to generate monocyte-derived DCs. To stimulate T cells, day 6 DC were cocultured with UV-irradiated tumor cells (312 mm; Spectroline) at 1:1 ratio in RPMI 1640 plus 10% human serum in the presence of GM-CSF, IL-4, and IFN-
(1000 U/ml; Pierce) overnight in 96-well round-bottom plates. The next day, the DC-tumor coculture plates were replenished with fresh RPMI 1640 plus 10% human serum in the presence of GM-CSF or IL-4. CD8-enriched T cells (Miltenyi CD8+ cell isolation kit II) and CD4-enriched, CD25-depleted T cells (Miltenyi CD4+ cell isolation kit II and CD25 microbeads) were isolated and added to DC-tumor coculture in RPMI 1640 plus 10% human serum in the presence of IL-2 (120 IU/ml) or CD40L (500 ng/ml; Immunex). Seven days later, T cells were restimulated once by transferring them to a second identically prepared DC-tumor culture. Testing for IFN-
production in response to autologous EBV-B or RCC occurred 7 days after restimulation. Criteria for a positive microwell were an IFN-
concentration that was at least 100 pg/ml and twice that of a coculture with autologous EBV-B cells. T cell clones were derived from positive microwell cultures by diluting T cells to 1, 3, or 10 cells per well and coculturing with 5 x 104 irradiated PBMCs (3000–4000 cGy) from three allogeneic donors in RPMI 1640 medium containing 10% human serum, 300 IU/ml IL-2, and 30 ng/ml OKT-3 (Ortho-McNeil Pharmaceuticals). Further expansion of T cell clones was performed when they show reactivity against autologous tumor as measured by IFN-
secretion.
Cell lysis assay
A standard 4-h 51Cr release assay was performed to test the cytotoxicity of T cells against tumors. Briefly, target cells were labeled for 1 h at 37°C with 51Cr (200 µCi; GE Healthcare Life Sciences). Labeled target cells were then washed three times and plated in triplicate at a concentration of 1 x 104 per well in 96-well round-bottom plates. Effector cells were prepared and added to target cells at various E:T ratio. After 4-h incubation, supernatants were harvested and counted on a Wallac 1470 Wizard automatic gamma counter (PerkinElmer). Maximum or spontaneous release was determined by adding 2% SDS or medium to target cells, respectively. The percentage of specific lysis was calculated with the following: (experimental cpm – spontaneous cpm)/(maximum cpm – spontaneous cpm) x 100.
Blocking assay
RCC cells (5 x 104 cells in 100 µl of culture medium) were incubated with each blocking mAb at a concentration of 10 µg/ml for 30 min at 37°C in a 96-well flat-bottom plate. T cells (1–5 x 104 cells/well) were then added and incubated with target cells overnight at 37°C. The supernatants were harvested and assayed for IFN-
concentration by ELISA.
Isolation of TCR
and β chains and vector construction
Total RNA from T cell clone HC/2G-1 was purified from T cells using an RNeasy mini kit (Qiagen). Primers that are complimentary to the 3' end of the coding sequences were synthesized (Operon Technologies) to make full-length cDNAs of TCR
and β chains. These primers were C
(TCAGCTGGACCACAGCCGCAGC), Cβ1 (TCAGAAATCCTTTCTCTTGACCATG), and Cβ2 (CTAGCCTCTGGAATCCTTTCTCTTG). A 5' RACE reaction was performed by SMART RACE cDNA amplification kit (Clontech Laboratories) following the manufacturers instructions. The RACE cDNAs (
1 kb) were obtained with C
and Cβ1 primers and then inserted into the pCR2.1 vector by TA cloning (Invitrogen). The sequences of HC/2G-1 TCR
and β chains (GenBank accession numbers EF101779 and EF101778, respectively) can be reviewed (http://www.ncbi.nlm.nih.gov/GenBank/).
In vitro transcription and electroporation
In vitro transcription of TCR
and β chains was performed using mMESSAGE mMACHINE ULTRA according to the manufacturers recommendations (Applied Biosystem). The RNA was purified using the RNAeasy mini kit (Qiagen). Electroporation of mRNAs encoding the TCR
and β chains was performed as previously described (15). In summary, PBMC from allogeneic donors were stimulated with 50 ng/ml soluble OKT-3 for 3 days, washed, and resuspended in OPTI-MEM medium (Invitrogen) at 2.5 x 107/ml. The suspended PBMC (50–200 µl) were mixed with mRNAs in varying amounts and transferred to prechilled 2-mm cuvettes (Harvard Apparatus). Electroporation was performed at 400 V/500 µs using an ECM830 Electro Square Wave Porator (Harvard Apparatus). Following electroporation, the cells were transferred to fresh RPMI 1640 plus 10% human serum and incubated at 37°C. Two hours after incubation, TCR-transfected cells were used for coculture assay. Expression of Vβ2 was used to determine transfection efficiency.
CD107a mobilization assay
CD107a expression by HC/2G-1 was performed as previously described (16). Briefly, HC/2G-1 (1 x 105 cells) was cocultured with renal tumors (4 x 105) in a 96-well round-bottom plate for 2 h at 37°C, 5% CO2 in the presence of FITC-labeled CD107a or isotype controls. After incubation, cells were stained with PE-labeled anti-CD3 Ab, and then washed and analyzed by flow cytometry.
Cell viability assay
To determine sensitivity to soluble TRAIL, cells were plated in triplicate in 96-well plates at 5000 per well in 100 µl of RPMI plus 10% FBS, incubated for 24 h, and then treated with soluble TRAIL in various concentrations (10, 30, 100, 300, and 1000 ng/ml). At 72 h later, MTT assay (American Type Culture Collection) was performed following the manufacturers protocol.
| Results |
|---|
|
|
|---|
To generate RCC-specific T cells, CD3-enriched T cells from an RCC patient were stimulated with autologous DCs that had been cocultured with autologous UV-irradiated tumor cells in the presence of IFN-
. One microwell, HC/2G, showing reactivity to autologous RCC (Fig. 1A, RCC 1), was cloned and expanded for further characterization. Clone HC/2G-1, derived from HC/2G, was tested against a panel of allogeneic renal tumor lines, EBV-B cell lines, melanoma lines, and other cell lines including breast cancer and non-small–cell lung cancer, fibroblasts, and normal renal epithelium. This test showed that clone HC/2G-1 was highly reactive to the autologous RCC (RCC 1) and 9 of 10 HLA-mismatched renal tumors by IFN-
secretion (Fig. 1B). Only one renal tumor was not recognized by HC/2G-1 (Fig. 1B, RCC 11). One of nine melanoma lines (888 mel) was strongly recognized and there was also weak recognition of another melanoma line (526 mel), a breast cancer line (MDA386), a non-small–cell lung cancer line (H2228), and an esophageal adenocarcinoma line (BE-3). EBV-B cell lines generated from the PBL of each of the RCC patients who were the source of the recognized tumor lines were not significantly recognized. Six allogeneic fibroblast lines were not recognized. Although there was weak reactivity against two purchased (but uncharacterized) human renal epithelial (HRE) cells (HRE1 and HRE2) by HC/2G-1, no reactivity was seen against three renal epithelial cells raised from primary NCI nephrectomy specimens using published methodology (17). HC/2G-1 lytic function was also tested in chromium release assay, and only one RCC line among nine was not lysed (Fig. 1C, RCC 11). In the same assay, autologous EBV-B cells, Daudi, K562, and four allogeneic normal renal epithelial lines were not lysed. Lysis was highly correlated (R2 = 0.7982; p = 0.000003) by regression analysis with IFN-
secretion in the same experiment (data not shown).
|
Phenotypically, clone HC/2G-1 expressed CD3 and CD4, but did not express CD16, CD161, CD94, NKG2D, or CD244 on its surface (Fig. 2A). Clone HC/2G-1 did not express CD8. Approximately 5% and 9% of HC/2G-1 expressed some degree of CD56 and CD57, respectively, compared with isotype controls. The reactivity of HC/2G-1 was not due to a CD56+ contaminant because HC/2G-1 cells depleted of CD56+ cells with microbeads showed the same reactivity against renal tumor cells as unseparated HC/2G-1 (data not shown).
|
β but not TCR 
(Fig. 2A). Blocking mAb against HLA class I, HLA class II, TCR
β, and CD4 were evaluated in the recognition of autologous tumor by HC/2G-1. Anti-TCR
β mAb blocked reactivity, and a small effect compared with positive controls was seen with anti-HLA class I mAb, but no effect was seen with anti-HLA class II and anti-CD4 mAbs (Fig. 2B). This result suggests that HC/2G-1 recognition of renal tumor is mediated by the
β TCR, but is not classically MHC class I- or class II-restricted (as supported by its broad alloreactivity vs RCCs). The minor effect of the anti-HLA class I mAb suggested that a related presenting molecule may have a role, as is seen for some NKT cells. Therefore, we investigated whether HC/2G-1 recognition was dependent on β2m by testing HC/2G-1 against a renal tumor cell line that is naturally β2m-deficient and does not express HLA class I on its surface unless β2m is retrovirally introduced (Fig. 2C, RCC 12). The β2m-deficient RCC line was well recognized by HC/2G-1, and induction of HLA class I or class II expression by retroviral transduction of β2m or CIITA, respectively, did not affect this recognition (Fig. 2C). This observation was also confirmed by testing HC/2G-1 reactivity against two well-recognized renal tumors after silencing β2m gene expression by introducing two β2m-specific short-hairpin RNAs. There were no differences in recognition between the two native RCC lines and their β2m-suppressed variants (data not shown). Furthermore, no recognized RCC tumor expressed CD1d or other CD1 molecules on their surface by flow analysis (Fig. 2D and data not shown), which excludes the possible involvement of CD1 molecules in tumor recognition by HC/2G-1. Tumor recognition of HC/2G-1 is mediated by TCR
To further delineate the role of TCR
β in tumor recognition by HC/2G-1, we isolated total RNA from HC/2G-1, amplified cDNAs encoding the TCR
and β chains by 5' RACE, and cloned these cDNAs into the pCR2.1 vector. Only one pair of TCR
and β chains were identified, and these were V
14 and Vβ2.1 (GenBank accession numbers EF101778, EF101779). This finding supports the clonal nature of the HC/2G-1 population. To confirm that tumor recognition by HC/2G-1 is mediated by its
β TCR, we synthesized mRNAs from the TCR
and β chains by in vitro transcription and electroporated them into allogeneic PBL stimulated with anti-CD3 and IL-2. The expression of the HC/2G-1 TCR after transfection was determined by Vβ2 staining when varying amounts of mRNAs were used for electroporation (Fig. 3A). Vβ2 expression increased in T cells transfected with increasing amounts of mRNAs encoding both
and β chains. As shown in Fig. 3B, introduction of only the
or β chains alone into stimulated allogeneic T cells did not result in recognition of RCC 6. Reactivity after transfection with both TCR chains was seen against RCC 6 but not RCC 11 as was also seen with HC/2G-1. We further measured the reactivity of T cells transfected with different amounts of HC/2G-1 TCR
and β mRNAs (Fig. 3C). Using 8 µg of mRNA of each TCR chain per 106 cells resulted in the highest percentage of Vβ2 expression (Fig. 3A), and those TCR-transfected T cells recognized multiple renal tumors including RCC 1, 5, 6, 7, 8, and 10. Again, RCC 11, a negative target for HC/2G-1, was not recognized by TCR-transfected T cells. Furthermore, we tested CD8- and CD4-enriched T cell populations independently after transfection with HC/2G-1 TCR mRNAs (Fig. 3D). Although TCR-transfected CD8 T cells showed slightly less overall reactivity against renal tumors than TCR-transfected PBL and CD4 T cells, the pattern of induced recognition was similar. The fact that both CD8 and CD4 T cells recognize renal tumors when transfected with HC/2G-1 TCR is in accord with anti-CD4 blocking experiments that showed HC/2G-1 reactivity is CD4 independent.
|
To delineate the effector molecules involved in tumor recognition, we first assessed CD107a mobilization by HC/2G-1. As shown in Fig. 4A, CD107a mobilization occurred when HC/2G-1 was stimulated with autologous tumor RCC 1 and allogeneic tumor RCC 6, but not without stimulation or with negative control renal tumor RCC 11. We further tested granzyme B secretion by HC/2G-1 when stimulated with multiple renal tumors, melanomas, or EBV-B cells. Granzyme B was produced by HC/2G-1 with all renal tumors except for RCC 11, which significantly correlated with IFN-
secretion that was done in the same experiment (Fig. 4B, inset).
|
secretion by HC/2G-1 against all renal tumors including RCC 11 (Fig. 4D, right), whereas minimal effect was seen in melanomas. Enhancement of immune recognition by HC/2G-1 did not correlate with TRAIL-induced cytotoxicity, as demonstrated in Fig. 4D (right, inset). | Discussion |
|---|
|
|
|---|
β, does not express any NK cell markers such as CD16, CD94, CD244, and NKG2D (22, 23), and does not lyse NK-sensitive target cells, such as K562 (21). It also differs from type I NKT cells because it does not express CD161, and its TCR usage is V
14 and Vβ2.1, whereas type I NKT cells use an invariant TCR V
24 and Vβ11 in humans (21). Furthermore, no sensitive RCC target line expresses CD1d on its surface (Fig. 2D). Perhaps its most striking characteristic is the strong bias of HC/2G-1 toward recognition of RCC as opposed to other tumors. In addition, HC/2G-1 appears to discriminate well between RCC and normal tissues. Although two unvalidated commercial renal epithelial lines showed weak recognition, four other lines procured from NCI nephrectomy specimens and generated by well-documented methods (17), were not recognized.
Our data prove that tumor recognition by HC/2G-1 is TCR
β-mediated. First, anti-TCR
β mAb blocking reduced HC/2G-1 reactivity against autologous tumor. Second, when allogeneic T cells were transfected with TCR mRNAs encoding the TCR
and β chains from HC/2G-1, these T cells acquired the RCC recognition pattern of parental HC/2G-1. This response was true for CD4+ or CD8+ recipient populations. Neither MHC class II on tumor nor CD4 on T cells seems to participate in tumor recognition by HC/2G-1. Another interesting observation is that HC/2G-1 reactivity is β2m-independent. It recognizes RCC 12 despite β2m deficiency, and β2m gene expression silencing with short-hairpin RNA in other RCC lines did not affect tumor recognition (data not shown). This finding argues against the possibility of MHC class Ib molecules such as HLA-E, HLA-F, HLA-G, or HLA-H participating as potential restriction elements because β2m is required for stability of these molecules on the cell surface (24). Other β2m-dependent molecules, such as CD1d are also not seen on recognized RCC lines and cannot be restriction elements for HC/2G-1. Broad recognition of RCC lines via an
β TCR suggests an Ag or epitope presented by a relatively nonpolymorphic MHC-like presenting entity, but so far, the basis of HC/2G-1 recognition remains unidentified. We are currently making modifications in the CDR2 and CDR3 regions of the HC/2G-1 TCR to determine whether these structures are involved in TCR-Ag interaction.
Our data also suggest that HC/2G-1 recognition is modulated by TRAIL. It constitutively expresses surface TRAIL, and blocking Ab to TRAIL resulted in reduced tumor recognition. Previous studies have demonstrated that CD4+ T cells can express TRAIL (18, 19, 25). These studies also suggest that CD4+ T cells can exhibit cytotoxicity to renal tumors through both TRAIL and granzyme/perforin pathways. Yet for HC/2G-1, TRAIL augments both target lysis and cytokine release. Target cell apoptosis and destruction might be expected to reduce cytokine release by removing antigenic stimulation. Furthermore, we see no positive or negative relationship between RCC susceptibility to soluble TRAIL and the ability to stimulate HC/2G-1. These findings imply that TRAIL on HC/2G-1 may not simply be an effector molecule in addition to granzyme/perforin. One possible explanation is that TRAIL is a costimulatory molecule, as demonstrated by Chou et al. (26), wherein cross-linking TRAIL on CD4+ T cells with immobilized death receptor DR4 enhanced proliferation and IFN-
production by CD4 T cells. However, in their study, soluble TRAIL reduced T cell stimulation by competing for DR4, whereas we found the opposite. Another possibility is that TRAIL may induce changes in renal tumors such as up-regulating the unidentified restriction element or its presenting molecule, but knowing its restriction element and Ag is needed to study these possibilities. Nonetheless, the involvement of TRAIL may give us a tool to identify populations similar to HC/2G-1 by examining CD3+ TRAIL-positive cells from different RCC patients. This study is currently underway.
Recently, the concept of creating tumor-reactive T cells by genetic introduction of a tumor-reactive TCR into PBL and using those in adoptive therapy was validated in a small clinical study (27). Two of 17 metastatic melanoma patients treated with T cells retrovirally engineered to express a TCR, which recognized the MART-1 melanoma-associated Ag, had clinical responses that have persisted for more than a year. Their responses were associated with survival of receptor-expressing transferred T cells in their blood for weeks to months after transfer. Therefore, finding new TCRs that confer immune recognition of nonmelanoma tumors may allow expanded application of adoptive T cell transfer. The HC/2G-1 TCR is an attractive candidate and has several advantages. It is not constrained by MHC haplotype, and its Ag is expressed by nearly all RCCs tested. Its MHC-independent nature should circumvent immune-escape mechanisms in which tumors lose MHC or β2m (28). Current laboratory studies are underway to identify the Ag recognized by HC/2G-1. Because RCC 11 is the only RCC line not recognized by HC/2G-1, using RCC 11 as target cells for cDNA library screening may help in understanding the molecular mechanism of HC/2G-1 reactivity. Unfortunately the patient from whom HC/2G-1 was obtained succumbed before any systemic therapy, so its antitumor efficacy cannot be evaluated directly. Yet new approaches using its cloned TCR may allow us to ascertain whether this novel antitumor reactivity can benefit other patients with RCC.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This research was supported by the Intramural Research Program of the National Institutes of Health, National Cancer Institute, Center for Cancer Research. ![]()
2 Address correspondence and reprint requests Dr. James C. Yang, Surgery Branch, Center for Cancer Research, National Cancer Institute, Building 10 Clinical Research Center, National Institutes of Health, 9000 Rockville Pike, Room 3W-3840, Bethesda, MD 20892. E-mail address: James_Yang{at}nih.gov ![]()
3 Abbreviations used in this paper: RCC, renal cell carcinoma; HRE, human renal epithelial; DC, dendritic cell; β2m, β2-microglobulin; TRAIL, TNF-related apoptosis-inducing ligand. ![]()
Received for publication April 4, 2008. Accepted for publication June 18, 2008.
| References |
|---|
|
|
|---|
β cytolytic T cells of Hfe, a MHC class Ib molecule without antigen-presenting function. Proc. Natl. Acad. Sci. USA 102: 12855-12860.
production in T cells by signal transduced through TNF-related apoptosis-inducing ligand. J. Immunol. 167: 1347-1352.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |