The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

The Journal of Immunology, 2008, 181, 3259 -3267
Copyright © 2008 by The American Association of Immunologists, Inc.
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Weinstein, J. S.
Right arrow Articles by Reeves, W. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Weinstein, J. S.
Right arrow Articles by Reeves, W. H.

Colocalization of Antigen-Specific B and T Cells within Ectopic Lymphoid Tissue following Immunization with Exogenous Antigen1

Jason S. Weinstein*, Dina C. Nacionales*, Pui Y. Lee*, Kindra M. Kelly-Scumpia*, Xiao-Jie Yan§, Philip O. Scumpia{dagger}, Dustin S. Vale-Cruz{ddagger}, Eric Sobel*, Minoru Satoh*, Nicholas Chiorazzi§ and Westley H. Reeves2,*

* Division of Rheumatology and Clinical Immunology and Center for Autoimmune Disease, {dagger} Department of Surgery, and {ddagger} Department of Anatomy and Cell Biology, University of Florida, Gainesville, FL 32610; and § Feinstein Institute for Medical Research, North Shore-Long Island Jewish Health System, Manhasset, NY 11030


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Chronic inflammation promotes the formation of ectopic lymphoid tissue morphologically resembling secondary lymphoid tissues, though it is unclear whether this is a location where Ag-specific immune responses develop or merely a site of lymphocyte accumulation. Ectopic lymphoid tissue formation is associated with many humoral autoimmune diseases, including lupus induced by tetramethylpecadentane in mice. We examined whether an immune response to 4-hydroxy-3-nitrophenyl acetyl-keyhole limpet hemocyanin (NP-KLH) and NP-OVA develops within ectopic lymphoid tissue ("lipogranulomas") induced by tetramethylpecadentane in C57BL/6 mice. Following primary immunization, NP-specific B cells bearing V186.2 and related heavy chains as well as {lambda}-light chains accumulated within ectopic lymphoid tissue. The number of anti-NP-secreting B cells in the ectopic lymphoid tissue was greatly enhanced by immunization with NP-KLH. Remarkably, the H chain sequences isolated from individual lipogranulomas from these mice were diverse before immunization, whereas individual lipogranulomas from single immunized mice had unique oligo- or monoclonal populations of presumptive NP-specific B cells. H chain CDR sequences bore numerous replacement mutations, consistent with an Ag-driven and T cell-mediated response. In mice adoptively transferred with OT-II or DO11 T cells, there was a striking accumulation of OVA-specific T cells in lipogranulomas after s.c. immunization with NP-OVA. The selective colocalization of proliferating, Ag-specific T and B lymphocytes in lipogranulomas from tetramethylpecadentane-treated mice undergoing primary immunization implicates ectopic lymphoid tissue as a site where Ag-specific humoral immune responses can develop. This has implications for understanding the strong association of humoral autoimmunity with lymphoid neogenesis, which may be associated with deficient censoring of autoreactive cells.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Lymphoid neogenesis, the formation of ectopic (tertiary) lymphoid tissue in response to inflammation (1, 2), is associated with the production of autoantibodies in several diseases including Sjögren’s syndrome, rheumatoid arthritis, and myasthenia gravis (3). Whether ectopic lymphoid tissue participates directly in generating autoreactive B cells (e.g., by allowing the autoreactive cells to escape self-tolerance) or indirectly as a site where mature Ab-secreting cells can persist (4) is unknown. Intraperitoneal injection of non-autoimmune-prone mice such as BALB/c with the hydrocarbon oil 2,6,10,14-tetramethylpentadecane (TMPD)3 triggers the formation of ectopic lymphoid tissue ("lipogranulomas") and the development of lupus-like autoimmune disease with autoantibodies against small nuclear ribonucleoproteins and dsDNA, immune complex-mediated glomerulonephritis, arthritis, and vasculitis (5, 6, 7, 8). Within the ectopic lymphoid tissue induced by TMPD are CD11c+ dendritic cells (DCs) expressing the costimulatory molecule CD86. Expression of the lymphoid chemokines CXCL13 (BLC), CCL19 (ELC), and CCL21 (SLC) is likely to play a role in the accumulation of B cells, T cells, and DCs in TMPD-induced tertiary lymphoid tissue (9). Although individual TMPD-induced lipogranulomas bear some resemblance histologically to germinal centers, there are differences, including the absence of peanut agglutinin+ B cells and FDC-M1+ follicular DCs (7). Nevertheless, proliferating (Ki-67+) lymphocytes can be demonstrated in these structures. Moreover, the B cells bear somatically mutated and isotype-switched Ig heavy chains (D. C. Nacionales, J. S. Weinstein, X. J. Yan, E. Albesiano, P. Y. Lee, K. M. Kelly-Scumpia, R. Lyons, M. Satoh, N. Chiorazzi, and W. H. Reeves, submitted), suggesting that lipogranulomas may support Ag-specific immune responses and may be a location where tolerance to autoantigens can be overcome.

The germinal center reaction regulates Ag-specific clonal evolution during the development of B cell memory (10). B cells in newly formed germinal centers may be oligoclonal (11), whereas those in TMPD-induced lipogranulomas are usually more diverse (D. C. Nacionales et al., submitted). The existence in TMPD-treated mice of occasional lipogranulomas containing oligoclonal B cells is currently unexplained.

Previous studies have shown that following immunization with 4-hydroxy-3-nitrophenyl acetyl-keyhole limpet hemocyanin (NP-KLH), two anatomically and phenotypically distinct populations of Ab-forming cells arise in the spleen. As early as 2 days after immunization, primary foci consisting of Ag-binding B cells are seen along the periphery of the periarteriolar lymphoid sheaths (12). Initially these foci expand, but by day 14, they disappear, giving rise to a second responding population in the follicle, germinal center B cells, which appear on day 8–10 and persist at least until day 30 postimmunization. The primary foci are sites of interclonal competition for Ag among unmutated B cells, whereas germinal centers are sites of intraclonal competition between mutated sister lymphocytes (12), as well as interclonal competition between pre-existing germinal center B cells and follicular "visitors" that can join the germinal center reaction if they have a sufficiently high Ag-binding affinity (13).

In the present study, we analyzed Ag-specific B and T cells in TMPD-induced ectopic lymphoid tissue at 12 days after primary s.c. immunization with a test Ag, NP-KLH. We show that oligoclonal populations of NP-specific B cells develop in TMPD-induced ectopic lymphoid tissue and may displace or overgrow more diverse populations of non-NP specific B cells present before immunization. Along with the hapten-specific B cells, the TMPD-induced lipogranulomas contain carrier-specific T cells, strongly suggesting that ectopic lymphoid tissue can participate directly in the generation of Ag-specific B cell responses.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Mice

Six-week-old female C57BL/6, BALB/cJ, T cell transgenic C.Cg-Tg(DO11.10)10Dlo/J (DO11.10), and C57BL/6-Tg(TcraTcrb)425Cbn/J (OT-II) mice were purchased from The Jackson Laboratory and housed in barrier cages. At 2 mo of age, C57BL/6 and DO11.10 mice received 0.5 ml of 2, 6, 10, 14 TMPD (Sigma-Aldrich) i.p. or were left untreated. The mice were injected 3 mo later s.c. in the lower abdomen with 100 µg of NP17–19- conjugated KLH (NP-KLH; Biosearch Technologies) precipitated in alum (Pierce). Lipogranulomas, spleen, and blood were harvested 4 to 12 days later. These studies were approved by the Institutional Animal Care and Use Committee.

Anti-NP IgM and IgG ELISA

Preimmune sera and sera obtained at the time of euthanasia were tested for IgM and IgG anti-NP Abs (ELISA). Microtiter plates were coated with NP19-, NP30-, or NP3-conjugated BSA (Biosearch Technologies). Serially diluted serum samples were added for 1 h at room temperature. Anti-NP IgM and IgG Abs were detected using alkaline phosphatase conjugated goat anti-mouse IgM or IgG Abs (1/1000 dilution; BD Biosciences) followed by phosphatase substrate (Sigma-Aldrich). OD was converted to concentration based on standard curves with sera from C57BL/6 mice immunized with NP-KLH using a four-parameter logistic equation (Softmax Pro 3.1 software; Molecular Devices).

BrdU labeling of B and T cells

BrdU was administered to BALB/cJ mice (0.2 mg BrdU i.p. every 4 h for 3 doses) and again one day before euthanasia. Single-cell suspensions of lipogranuloma or spleen tissue were made by collagenase treatment (7). The isolated cells were incubated with APC-conjugated anti-BrdU Abs plus anti-CD3-FITC and anti-CD19-PE Abs (BD Biosciences) and analyzed by flow cytometry. Isotype controls were used to evaluate background fluorescence. Isolated lipogranuloma cells were washed in staining buffer (PBS supplemented with 0.1% NaN3 and 1% BSA) and preincubated for 20 min with 1 µg of anti-CD16 (BD Biosciences) and 0.5 µl rat serum (Sigma-Aldrich) at 4°C in 20 µl of staining buffer to block Fc binding. Primary Abs were then added at pretitrated amounts and incubated for 20 min at 4°C, followed by washing in staining buffer. Intracellular BrdU labeling was performed using the APC BrdU flow kit following the manufacturer’s instructions (BD Biosciences). Data were acquired on a CyAn ADP flow cytometer (DakoCytomation) and analyzed with FCS Express Version 3 (DeNovo Software). At least 50,000 events per sample were acquired and analyzed using size gating to exclude dead cells.

{kappa}/{lambda} L chain staining

Lipogranulomas and spleen were fixed and embedded as previously described (7). Sections (4 µm) were stained with HRP-conjugated goat anti-mouse {kappa}- or -{lambda} L chain Abs (Southern Biotechnology Associates), developed with diaminobenzidine (Vector Laboratories), and viewed under a light microscope.

Anti-NP ELISPOT assay

Lipogranulomas and spleen (104 cells/well) from NP-KLH/TMPD treated mice were collagenase treated as described (7) and single-cell suspensions were plated on Multiscreen HTS plates (Millipore) coated with NP19-BSA. Lipogranuloma and spleen cells from non-immunized TMPD treated mice were used as the negative control. The cells were incubated overnight before adding alkaline phosphatase-conjugated goat anti-mouse IgM Abs. Spots were developed with 5-bromo-4-chloro-3-indolyl phosphate/NBT (Pierce) and incubated overnight before counting using a dissecting microscope.

VH gene sequences

Lipogranulomas and spleen were harvested at day 12 and mRNA was isolated using TRIzol reagent (Invitrogen). The pellets were washed with cold 75% (v/v) ethanol and resuspended in diethyl pyrocarbonate-treated water. One µg of RNA was treated with DNase I (Invitrogen) to remove genomic DNA and reverse transcribed to cDNA using Superscript First-Strand Synthesis System for RT-PCR (Invitrogen). PCR amplification of Ig H chain cDNA was performed using a mixture of 8 forward primers (VHF1–8) and a consensus reverse primer (VHR2) as described (14) (D. C. Nacionales et al., submitted). The PCR products were cloned into a TOPO vector (pCR4; Invitrogen), and the VDJ H chain sequences were determined by dideoxy sequencing and analyzed using the MacVector V 7.2.3 program (Accelrys Inc.).

Transfer of Ag-specific T cells

A total of 5 x 106 CD4+ T cells from OT-II or DO11.10 mice were transferred i.v. to C57BL/6J or BALB/cJ TMPD-treated recipients. The mice were immunized s.c. 3 days after T cell transfer with 200 µg NP17-OVA precipitated in alum. Single-cell suspensions of the draining lymph nodes, spleen, and lipogranulomas were prepared as above 7 days after immunization. Lipogranuloma cell suspensions from C57BL/6J recipients of OT-II T cells were analyzed by FACS using anti-CD3-FITC, anti-CD4-APC, anti-V{alpha}2-PE, and anti-Vβ5-Biotin-Av/Pac Blue Abs (BD Biosciences). BALB/cJ recipients of DO11.10 T cells were analyzed using anti-DO11.10 (KJI-26)-APC Abs (Invitrogen/Caltag).

T cell proliferation assay

DO11.10 mice were immunized 3 mo after TMPD or saline treatment with 50 µg of specific peptide corresponding to amino acids 323–339 of OVA (OVA323–339; Genscript Corporation) in alum. CD4+ T cells were sorted 5 days later using MACS anti-CD4 beads (Miltenyi Biotec). CD4+ T cells totaling 2.5 x 104 were cultured with irradiated (3000 R), CD4-depleted APCs (2.5 x 105 cells/well) in quadruplicate. A total of 2.5 µg/ml soluble anti-CD3 or 10 µg/ml of OVA323–339 was added for 48–72 h in a total volume of 200 µl of complete RPMI medium. One µCi [3H]thymidine (Amersham Biosciences) was added for the final 16 h of culture, and proliferation was determined using a liquid scintillation counter.

PCR analysis of T cell cytokines

Lipogranulomas and spleen were harvested 10 days after immunization with NP-KLH followed by isolation of mRNA and cDNA synthesis as described above. PCR amplification of β-actin, IL-4, IFN-{gamma}, and IL-21 was performed using the following primers: β-actin forward: (TGGAATCCTGTGGCATCCATGAAAC); β-actin reverse (TAAAACGCAGCTCAGTAACAGTCCG); (IL-4 forward: (CGAAGAACACCACAGAGAGTGAGCT); IL-4 reverse: (GACTCATTCATGGTGCAGCTTATCG); IFN-{gamma} forward: (AGCGGCTGACTGAACTCAGATTGTAG); IFN-{gamma} reverse: (GTCACAGTTTTCAGCTGTATAGGG); IL-21 forward: (ATGGAGAGGACCCTTGTCTG); IL-21 reverse: (GCTTGAGTTTGGCCTTCTGA). One µl of cDNA was added to a mixture containing 1X PCR buffer, 2.5 mM MgCl2, 400 µM dNTPs, 0.025 U of TaqDNA polymerase (Invitrogen), 1 µM each of forward and reverse primers, and diethyl pyrocarbonate-water in a 20 µl volume. Amplification was conducted for 5 min at 94°C, followed by 35 cycles of denaturation at 94°C for 2 min, annealing at 55°C for 30 s, extension at 72°C for 45 s, and a final extension of 72°C for 10 min in a PTC-100 Programmable Thermal Controller (MJ Research). PCR products were visualized on 1% agarose gel.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
Ag-specific B cell responses in ectopic lymphoid tissue

Intraperitoneal injection of TMPD leads to the formation of ectopic lymphoid tissue containing B and T lymphocytes as well as activated DCs (7). We asked whether lipogranulomas are a site where specific T cell-dependent Ab responses develop. TMPD-treated B6 mice were immunized s.c. with NP-KLH, which induces a highly restricted Ab response dominated by B cells bearing V186.2 H chains and {lambda}1 L chain specific for the NP hapten (11, 15). Compared with controls, NP-KLH immunized mice displayed significantly higher levels of serum anti-NP IgM and IgG 12 days postimmunization (Fig. 1, A and B). Both TMPD-treated and untreated mice developed a typical IgG1-dominated response following immunization with NP-KLH in alum (Fig. 1C). NP-specific IgG1, IgG2a, and total IgG levels were unaffected by TMPD treatment (Fig. 1C).


Figure 1
View larger version (22K):
[in this window]
[in a new window]

  		FIGURE 1. Serum anti-NP response after immunization with NP-KLH. B6 mice injected with TMPD 3 mo earlier were immunized with NP-KLH. At day 12, sera were tested for IgM (A) and IgG (B) anti-NP Abs by ELISA using NP-BSA. There was a significant increase in both IgM and IgG anti-NP from preimmune sera to day 12 immune sera. C, Isotypes of anti-NP Abs (ELISA) from mice either pretreated or not pretreated with TMPD before immunization with NP-KLH. D, Affinity of anti-NP Abs developing in TMPD-treated mice vs controls (no Rx) immunized with NP-KLH. Serum binding activity (measured in arbitrary units using a standard curve) was measured using NP30-BSA (low and high avidity/affinity Abs) and NP3-BSA (high avidity/affinity Abs). E, In vivo BrdU labeling of T and B cells in the lipogranulomas and spleens of TMPD-treated and NP-KLH immunized mice (n = 3). Single-cell suspensions were stained with anti-CD45R (B220) and anti-CD3 Abs and with an anti-BrdU Ab. Data are expressed as the percentage of BrdU+ B cells or T cells, respectively, at 4, 8, 10, or 14 days after immunization with NP-KLH.

 
To evaluate the affinity of the Ab responses, reactivity with NP30-BSA and NP3-BSA was determined by ELISA. Interestingly, although the total serum levels of Abs reactive with NP30-BSA in mice pretreated with TMPD were similar to those in untreated mice, reactivity of sera from the TMPD-pretreated mice with NP3-BSA was significantly less than the reactivity of sera from untreated mice (Fig. 1D). Thus, the affinity of the anti-NP Abs induced by immunization with NP-KLH was lower in mice with TMPD-induced ectopic lymphoid tissue than in controls.

Because one of the characteristics of secondary lymphoid tissue is the proliferation of Ag-specific B and T lymphocytes, it was of interest to examine T and B cell proliferation in the ectopic lymphoid tissue induced by TMPD. Mice were fed BrdU in the drinking water and immunized with NP-KLH. Following immunization, there was a progressive increase in the number of B220+ cells and CD3+ cells labeled with anti-BrdU Abs both in the spleen and in the lipogranulomas, which was apparent as early as day 4–8 after immunization and peaked around day 10 (Fig. 1E). These data indicate that primary immunization with an exogenous Ag stimulated lymphocyte proliferation within ectopic lymphoid tissue and that the magnitude of this proliferative response was comparable to that in a secondary lymphoid organ, the spleen.

OVA-specific T cells localize and expand in ectopic lymphoid tissue

To further address whether ectopic tissue facilitates the development of de novo immune responses, we analyzed Ag-specific CD4+ T cell responses within the lipogranulomas following immunization. CD4+ OVA 323–339 peptide-specific T cells were transferred from either OT-II or DO11.10 mice into TMPD treated recipients. Either PBS or CD4+ OVA-specific T cells from OT-II mice were injected into TMPD-treated B6 mice, followed by immunization with NP-OVA 3 days later. We identified the OVA transgenic T cells (V{alpha}2+Vβ5+CD4+ cells) 7 days after immunization (16) in various lymphoid tissues using flow cytometry. There was a significant increase of V{alpha}2+Vβ5+CD4+ T cells in the draining lymph nodes and lipogranulomas from mice injected with OT-II T cells compared with the control PBS injection (Fig. 2A). As expected, the DO11.10 Ag-specific T cells also were present at increased frequency in the lipogranulomas of BALB/c mice after immunization (Fig. 2B). Transfer of DO11.10 T cells to non-immunized mice verified that the increased numbers of Ag-specific T cells in the lipogranulomas were not merely related to the transfer of CD4+ T cells (Fig. 2B). We also treated DO11.10 mice with TMPD and 3 mo later immunized with OVA323–339. The lipogranulomas contained almost exclusively Ag-specific KJI-26+ CD4+ T cells 7 days after immunization, whereas both spleen and draining lymph nodes contained a population of KJI-26– CD4+ T cells (Fig. 2C). In contrast, lipogranulomas from non-immunized mice contained a population of non-transgenic (KJI-26–) T cells. We further assessed the presence of OVA-specific T cells in the lipogranulomas by isolating CD4+ T cells from TMPD-treated DO11.0 mice and stimulating in vitro with OVA323–339. Ag-specific CD4+ T cells from lipogranulomas, spleen, and draining lymph nodes all proliferated similarly (Fig. 2D). The expansion of Ag-specific CD4+ T cells in the lipogranulomas upon immunization coupled with their ability to proliferate when stimulated in vitro provides evidence that ectopic lymphoid tissue is a site of Ag-specific T cell activation and proliferation.


Figure 2
View larger version (29K):
[in this window]
[in a new window]

  		FIGURE 2. OVA-specific T cells in lipogranulomas. A, Single-cell suspensions from spleen, lymph nodes, or lipogranulomas of mice injected i.v. with 5 x 106 OT-II T cells (n = 6) or PBS (n = 5) were analyzed by flow cytometry 7 days after immunization with NP-OVA. The V{alpha}2+Vβ5+ values represent the total percentage of CD3+CD4+ T cells. *, Lymph nodes, p = 0.009; Lipogranuloma, p = 0.02, Mann-Whitney U test. B, Mice were injected i.v. with DO11.10 T cells (n = 12) or PBS (n = 5) were analyzed by flow cytometry. Some mice that received DO11.10 T cells were immunized with NP-OVA (n = 7) and others were not (n = 5. *, Spleen, p = 0.0006; Lymph node, p = 0.01, Lipogranuloma, p = 0.02, Mann-Whitney U test. C, Single-cell suspensions of lipogranulomas, spleen, and draining lymph nodes from immunized or non-immunized mice were gated on live CD3+CD4+ cells (cytox blue) and then the percentage of KJI-26+ (DO11.10 T cells) was determined from CD3+ CD4+ cells (representative of three independent experiments). D, Isolated CD4+ T cells were cultured with or without OVA323–339 for 72 h. T cell proliferation was measured by [3H] incorporation (representative of three independent experiments). E, cDNA was synthesized from two lipogranulomas (Lipo) or spleen from a TMPD treated mice immunized with NP-KLH. IL-4, IFN-{gamma}, and IL-21 expression was determined by RT-PCR and normalized to β-actin expression (representative of four different mice).

 
To further demonstrate that the T cells in the lipogranuloma are active participants in an Ag-specific immune response, we looked at the production of T cell inflammatory cytokines in lipogranulomas and spleen after immunization with the test Ag NP-KLH. Compared with the spleen, lipogranulomas from the same mouse expressed higher levels of IFN-{gamma} mRNA but lower levels of IL-4 and IL-21 (Fig. 2E). Thus, following immunization, T cells in the lipogranulomas were proliferating (Fig. 1E), there was an increased number of Ag-specific CD4+ cells (Fig. 2, B and C), and there was production of T cell cytokines, particularly IFN-{gamma} (Fig. 2E), consistent with the presence of effector T cells.

NP-specific B cells and anti-NP Ab production in ectopic lymphoid tissue

In view of the preferential pairing of {lambda}1 L-chains with V186.2 H chains, paraffin-embedded tissue was stained for {kappa} and {lambda} light chains (Fig. 3A). Lipogranulomas from both immunized and non-immunized mice contained large numbers {kappa} L chain bearing B cells, showing that immunization does not substantially affect the total number of B cells in the lipogranulomas. The lipogranulomas from mice immunized with NP-KLH had discrete areas of strong {lambda} L chain staining, whereas non-immunized mice had very weak {lambda} staining (Fig. 3A). Immunized mice had significantly more {lambda} L chain bearing cells in the lipogranulomas than controls, an expected response to NP-KLH (Fig. 3B). To determine whether these B cells secreted anti-NP Abs, ELISPOT assays were performed using NP-BSA as Ag. The lipogranuloma cells from NP-KLH immunized, TMPD-treated mice displayed more spots than those from TMPD-treated, non-immunized mice (Fig. 3C). Interestingly the spots from the spleen, although less numerous than those from lipogranulomas, were larger (Fig. 3D), suggesting that the Ag-specific cells in the spleen secreted more Ig per cell than those from lipogranulomas and/or that the Ab affinity was lower in the lipogranulomas, as suggested earlier (Fig. 1D).


Figure 3
View larger version (94K):
[in this window]
[in a new window]

  		FIGURE 3. Anti-NP B cells in ectopic lymphoid tissue. A, L chain staining of B cells in lipogranulomas from B6 mice treated with TMPD alone or treated with TMPD and then immunized with NP-KLH. Paraformaldehyde-fixed tissue was analyzed 12 days after NP-KLH immunization. Paraffin sections were stained with anti-{kappa} and anti-{lambda} L chain Abs. B, Number of {kappa} and {lambda} positive cells per high power field in mice treated with TMPD plus NP-KLH immunization or with TMPD alone (*, p = 0.02, Mann-Whitney U test; representative of five independent experiments). C, ELISPOT assay for anti-NP B cells. MultiScreen HTS IP plates containing a 0.45-µm Immobilon-P membrane were coated with 1 µg/ml NP-BSA. Lipogranuloma and spleen cells from TMPD treated mice (n = 2) or TMPD-treated and NP-KLH immunized mice (n = 2) were added to triplicate wells for 24 h before adding biotinylated goat anti-mouse IgM Abs, streptavidin-peroxidase, and 5-bromo-4-chloro-3-indolyl phosphate-NBT substrate. Number of spots per well was determined (*, p = 0.03 for both mouse A and mouse B, Mann-Whitney U test; representative of three independent experiments). D, Relative sizes of individual spots in ELISPOT assays using lipogranuloma (Lipo) or spleen (Spl) cells from TMPD treated mice either with or without NP-KLH immunization.

 
H chain sequences from spleen and ectopic lymphoid tissue of NP-KLH immunized mice

To further verify that the lipogranulomas contained NP-specific B cells, we amplified and sequenced VH genes from lipogranulomas and spleens. A preponderance of V186.2 and other VH genes (CH10, V303, V102) implicated in the formation of anti-NP Abs (15) was found in the lipogranulomas and spleens of immunized mice (Fig. 4). B cells from the lipogranulomas expressed almost exclusively V186.2 or other VH genes implicated in the anti-NP response, representing >90% of the total sequences (including 20% V186.2). In comparison, 60% of VH sequences from the spleen were V186.2, CH10, V303, or V102 (7% V186.2). V186.2 and other genes encoding presumptive NP-specific Abs were infrequent in the lipogranulomas from un-immunized mice. The higher percentage of likely NP-specific VH genes in lipogranulomas vs spleen from immunized mice is consistent with the possibility that T cell-dependent clonal expansion of Ag-specific B cells may be ongoing within the lipogranulomas.


Figure 4
View larger version (22K):
[in this window]
[in a new window]

  		FIGURE 4. VH segment usage in lipogranulomas and spleen. Lipogranulomas from a TMPD-treated mouse immunized with NP-KLH were pooled at day 12 and RNA was isolated. Ig VH sequences were determined from lipogranulomas (n = 50) and spleen (n = 50) from the same mouse. All of the sequences recovered from lipogranulomas bore V186.2, CH10, V303, V102, or V124 vs 62.6% of the sequences recovered from the spleen (representative of three independent experiments).

 
To assess the clonality of B cells in ectopic lymphoid tissue induced by TMPD following immunization with the test Ag, we sequenced the VH genes expressed by B cells in individual lipogranulomas and spleen. As shown in Fig. 5A, diverse VH sequences were recovered from the spleens of TMPD-treated mice immunized with NP-KLH. In some instances the same VH-D-JH combination was obtained from two individual clones from the same spleen. Interestingly, the combination CH10-DSP2.X-JH1 (CH10 is implicated in the formation of anti-NP Abs) was recovered in duplicate clones from two different mice (Fig. 5A). In striking contrast to spleen, individual lipogranulomas from TMPD-treated mice, immunized 12 days earlier with NP-KLH, contained highly oligoclonal populations of B cells expressing VH sequences associated with anti-NP reactivity (V186.2 and related sequences) (Fig. 5A, mouse 1 and 2, lipogranulomas 1 and 2). The lipogranulomas from immunized mice displayed almost exclusively (95%) V186.2 and analogous VH sequences vs 50% of the VH genes recovered from the spleens of NP-KLH immunized mice (Fig. 5B). Lipogranulomas from TMPD-treated mice that were not immunized with NP-KLH contained more diverse populations of B cells with few V186.2 and related sequences (Fig. 5, A and B). The "anti-NP" sequences found in individual lipogranulomas were distinct from those isolated in spleen and other lipogranulomas from the same mouse.


Figure 5
View larger version (43K):
[in this window]
[in a new window]

  		FIGURE 5. Oligoclonal VH sequences from lipogranulomas of immunized mice. A, H chain sequences are shown from spleen and lipogranulomas of two mice immunized with NP-KLH (day 12) and two preimmune (not immunized) mice. V-D-J sequences were amplified from cDNA by PCR and sequenced to determine VH, D, and JH usage. Boxed sequences use VH sequences associated with anti-NP reactivity. Related sequences are shown in the same format. B, Graphical representation of the percentage of anti-NP H chains in tissues from immunized or unimmunized mice.

 
Analysis of somatic mutation frequencies in V186.2 sequences revealed that 8 of 9 (88%) of the lipogranuloma V186.2 sequences were somatically mutated (Table I). Lipogranuloma and spleen sequences both had replacement/silent ratios >5.7, suggestive of the occurrence of somatic hypermutation during a primary response to NP (17). None of the somatically mutated sequences contained the prototypical 33 (W -> L) mutation characteristic of affinity maturation (18), consistent with an early NP-specific response in the lipogranulomas from these mice that had received only a primary immunization.


View this table:
[in this window]
[in a new window]

  		Table I. V186.2 sequences from mice undergoing primary NP-KLH immunization

 
To help address the issue of whether the lipogranuloma B cells were undergoing a primary anti-NP response locally as opposed to migrating there from other sites, such as secondary lymphoid tissue, the CDRs of related sequences isolated from lipogranulomas were compared (Fig. 6). Sequences obtained from individual lipogranulomas displayed identical or closely related somatic mutations, as might be expected if they underwent expansion locally (e.g., mouse 2, lipogranuloma 1, V303-DSP2.8-JH4 sequences) (Fig. 6, top). However, although occasional new somatic mutations were found (e.g., sequence VH6–2) extensive "clonal trees" were not seen. In other cases (e.g., mouse 1, lipogranuloma 2, V303-DSP2.9-JH1) collections of identical germline sequences were found (Fig. 6, bottom). Individual somatic mutations seen in the CDR sequences recovered from lipogranulomas were not found in the spleen of the same mouse, providing further evidence that the splenic and lipogranuloma anti-NP responses developed independently of each other.


Figure 6
View larger version (15K):
[in this window]
[in a new window]

  		FIGURE 6. CDR1 and CDR2 sequences from H chains isolated from lipogranulomas. Sequences of H chains from mouse 1, lipogranuloma 2 (V303-DSP2.9-JH1) and mouse 2, lipogranuloma 1 (V303-DSP2.8-JH4) are aligned. Somatic mutations are indicated. Replacement mutations capitalized, silent mutations lower case.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
There are many examples of structures resembling secondary lymphoid tissue arising at sites of chronic inflammation (2), but it remains unclear whether this ectopic lymphoid tissue is a site of cognate T-B interactions. Specifically, although autoantigen-specific B cells have been reported in ectopic lymphoid tissue (19, 20), it is not known whether immune responses actually develop there or whether Ag-specific B cells arising in secondary lymphoid tissues subsequently colonize the ectopic lymphoid tissue. Here, we addressed this question by active s.c. immunization coupled with tracking of Ag-specific B and T lymphocytes to peritoneal ectopic lymphoid tissue induced by TMPD. To our knowledge, this is the first study to show that both hapten-specific B cells and proliferating, carrier-specific T effector cells are present within ectopic lymphoid tissue.

Our data strongly suggest that cognate Ag-specific T-B interactions occur in ectopic lymphoid tissue. Following s.c. immunization with Ags such as NP-OVA, T and B cell proliferation was seen in the TMPD-induced ectopic lymphoid tissue (Fig. 1E) and both OVA-specific T cells and NP hapten-specific B cells accumulated there (Figs. 2 and 3). T cells in the ectopic lymphoid tissue also produced IFN-{gamma} and other cytokines (Fig. 2E). H chain sequences isolated from ectopic lymphoid tissue were highly enriched for V186.2 and other H chains known to generate NP-specific Abs (Figs. 4 and 5), and the proportion of such sequences was higher than in the spleen. Lipogranulomas also exhibited strong {lambda} L chain staining consistent with an anti-NP response (Fig. 3). Moreover, anti-NP Ab secreting cells were enriched in ectopic lymphoid tissue in comparison with the spleen. Taken together, these data suggest that Ag-specific B cell and T cell responses may preferentially develop within the ectopic lymphoid tissue.

Individual lipogranulomas from preimmune mice contain relatively diverse populations of B cells (Fig. 5; D. C. Nacionales et al., submitted). In contrast, following s.c. immunization, the B cells present in individual lipogranulomas were highly oligoclonal or even monoclonal (Figs. 5 and 6) and preferentially used H chains previously reported in anti-NP responses. Oligoclonal B cell expansions also are seen in individual germinal centers microdissected from secondary lymphoid tissues (11), suggesting that individual lipogranulomas from TMPD-treated mice are in some respects analogous to single germinal centers. The oligoclonal B cell proliferation apparent in TMPD-induced ectopic lymphoid tissue is consistent with previous observations in ectopic lymphoid tissues from rheumatoid arthritis, Sjögren’s syndrome, and myasthenia gravis patients (19, 21, 22).

A key question is whether the B cells in ectopic lymphoid tissue develop in situ or migrate into the ectopic lymphoid tissue from secondary lymphoid organs, such as the lymph nodes or spleen. In view of the timing of immunization and the VH sequences obtained, it is unlikely that the B cells found in lipogranulomas 10–12 days after immunization originated from the germinal centers of secondary lymphoid tissues followed by migration to the tertiary lymphoid tissues. The fact that individual lipogranulomas contained non-overlapping and unrelated sets of clonal B cells also suggests they were not "seeded" with the products of previous germinal center reactions in the lymph nodes or spleen. Moreover, the sequences recovered from spleen did not overlap with the lipogranuloma sequences.

We did not find the extensive clonal trees reported previously from spleen of MRL mice (23). However, extensive clonal trees were not seen in individual germinal centers, either (11), and the sequences illustrated in Fig. 6 (mouse 2, granuloma 1) are not that dissimilar from those reported previously from individual germinal centers. The lack of clonal trees could reflect the relatively small number of sequences analyzed per lipogranuloma or a lower rate of somatic hypermutation in ectopic lymphoid tissue vs secondary lymphoid tissues.

There are other important differences between the ectopic lymphoid tissue induced by TMPD and authentic germinal center reactions, notably the absence of well-developed follicular DC networks and PNA+ B cells (7). ELISPOTs were larger using spleen cells vs cells from the ectopic lymphoid tissue, suggesting that the splenic anti-NP B cells secrete more Ab than those from ectopic lymphoid tissue or that affinity maturation of B cells in the lipogranuloma is less efficient than in the spleen, an interpretation consistent with the lower affinity of anti-NP Abs in the sera of TMPD-treated mice vs controls (Fig. 1D) and the paucity of clonal trees. Together, these data suggest that 1) a significant portion of the low affinity serum anti-NP response in TMPD-treated mice may derive from the ectopic lymphoid tissue, and 2) affinity maturation may be defective in the ectopic lymphoid tissue, i.e., high affinity B cells may enjoy less of a competitive advantage over lower affinity cells in ectopic lymphoid tissue than in authentic secondary lymphoid tissues. We speculate that reduced affinity maturation in the lipogranulomas might reflect an absence of follicular dendritic cells in view of the lack of FDC-M1+ staining (7). Further studies will be necessary, however, to determine whether the low affinity of serum anti-NP Abs in TMPD-treated mice is due to their production in ectopic lymphoid tissue or whether it is a systemic effect of TMPD treatment.

The presence of oligoclonal B cell populations in individual lipogranulomas, lack of shared H chain sequences between lipogranulomas and spleen and between individual lipogranulomas from the same mouse, expression of activation-induced cytidine deaminase, and the presence of circular DNA intermediates generated during active class switch recombination (D. C. Nacionales et al., submitted), as well as the presence of proliferating B and T cells in these structures lead us to conclude that TMPD-induced ectopic lymphoid tissue is a site of germinal center-like cognate T-B interactions. However, the lipogranulomas may not be true germinal centers and instead could be more analogous to the previously reported extrafollicular sites of Ag-driven somatic hypermutation of rheumatoid factor B cells (24). Recently, ectopic lymphoid tissue was also found to express activation-induced cytidine deaminase in the salivary glands of patients with Sjögren’s syndrome (25), supporting the idea that this may be a general feature of ectopic lymphoid tissue in a variety of locations.

The formation of ectopic lymphoid tissue is strongly associated with autoimmunity and autoantibody production in a variety of disorders (2), including the rheumatoid synovium (21, 26), salivary glands in Sjögren’s syndrome (27), thymus in myasthenia gravis (19), and the thyroid in Hashimoto’s thyroiditis (28). In several examples of organ-specific autoimmune disease, autoreactive B cells have been found within ectopic lymphoid tissue in the target tissues. We have shown recently that anti-RNP autoantibody-producing B cells are enriched in ectopic lymphoid tissue of TMPD-treated mice, strongly suggesting that this may be a site where autoreactivity may develop preferentially (D. C. Nacionales et al., submitted). It will be of interest to determine where the APCs responsible for activating autoreactive T cells acquire self-Ags, as the present data indicate that APCs from remote (e.g., s.c.) locations are capable of homing to ectopic lymphoid tissue located within the peritoneum. The role of chemokines, such as CXCL19, CXCL21, and CXCL13, expressed at high levels in the ectopic lymphoid tissue (7) in establishing autoantibody production in ectopic sites remains to be determined. Finally, it will be of interest to see whether therapy aimed at disrupting the formation of ectopic lymphoid tissue will prevent the development of lupus in TMPD-treated mice.


   Acknowledgments
 
We thank Dr. Laurence Morel for providing OT-II mice and the University of Florida DNA Sequencing Core and Flow Cytometry Core Laboratory for assistance.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by Research Grants R01-AR44731 and T32-AR007603 from the U.S. Public Health Service and by generous gifts from Lupus Link, Inc. (Daytona Beach, FL) and Lewis M. Schott to the University of Florida Center for Autoimmune Disease. D.C.N. is the recipient of an Arthritis Foundation Postdoctoral Fellowship. This work was supported with resources and the use of facilities at the Malcolm Randall Veterans Affairs Medical Center, Gainesville, FL. Back

2 Address correspondence and reprint requests to Dr. Westley H. Reeves, Division of Rheumatology and Clinical Immunology, University of Florida, PO Box 100221, Gainesville, FL 32610. E-mail address: whreeves{at}ufl.edu Back

3 Abbreviations used in this paper: TMPD, tetramethylpentadecane; DC, dendritic cell; NP-KLH, 4-hydroxy-3-nitrophenyl acetyl-keyhole limpet hemocyanin. Back

Received for publication January 23, 2008. Accepted for publication June 24, 2008.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Kratz, A., A. Campos-Neto, M. S. Hanson, N. H. Ruddle. 1996. Chronic inflammation caused by lymphotoxin is lymphoid neogenesis. J. Exp. Med. 183: 1461-1472. [Abstract/Free Full Text]
  2. Drayton, D. L., S. Liao, R. H. Mounzer, N. H. Ruddle. 2006. Lymphoid organ development: from ontogeny to neogenesis. Nat. Immunol. 7: 344-353. [Medline]
  3. Hjelmstrom, P.. 2001. Lymphoid neogenesis: de novo formation of lymphoid tissue in chronic inflammation through expression of homing chemokines. J. Leukocyte Biol. 69: 331-339. [Abstract/Free Full Text]
  4. Cassese, G., S. Lindenau, B. de Boer, S. Arce, A. Hauser, G. Riemekasten, C. Berek, F. Hiepe, V. Krenn, A. Radbruch, R. A. Manz. 2001. Inflamed kidneys of NZB / W mice are a major site for the homeostasis of plasma cells. Eur. J. Immunol. 31: 2726-2732. [Medline]
  5. Satoh, M., W. H. Reeves. 1994. Induction of lupus-associated autoantibodies in BALB/c mice by intraperitoneal injection of pristane. J. Exp. Med. 180: 2341-2346. [Abstract/Free Full Text]
  6. Satoh, M., A. Kumar, Y. S. Kanwar, W. H. Reeves. 1995. Antinuclear antibody production and immune complex glomerulonephritis in BALB/c mice treated with pristane. Proc. Natl. Acad. Sci. USA 92: 10934-10938. [Abstract/Free Full Text]
  7. Nacionales, D. C., K. M. Kelly, P. Y. Lee, H. Zhuang, J. S. Weinstein, E. Sobel, Y. Kuroda, J. Akaogi, M. Satoh, W. H. Reeves. 2006. Type I interferon production by tertiary lymphoid tissue developing in response to 2,6,10,14-tetramethylpentadecane (pristane). Am. J. Pathol. 168: 1227-1240. [Abstract/Free Full Text]
  8. Chowdhary, V. R., J. P. Grande, H. S. Luthra, C. S. David. 2007. Characterization of haemorrhagic pulmonary capillaritis: another manifestation of Pristane-induced lupus. Rheumatology 46: 1405-1410. [Abstract/Free Full Text]
  9. Okada, T., V. N. Ngo, E. H. Ekland, R. Forster, M. Lipp, D. R. Littman, J. G. Cyster. 2002. Chemokine requirements for B cell entry to lymph nodes and Peyer’s patches. J. Exp. Med. 196: 65-75. [Abstract/Free Full Text]
  10. McHeyzer-Williams, L. J., M. G. McHeyzer-Williams. 2005. Antigen-specific memory B cell development. Annu. Rev. Immunol. 23: 487-513. [Medline]
  11. Jacob, J., G. Kelsoe. 1992. In situ studies of the primary immune response to (4-hydroxy-3- nitrophenyl)acetyl: II. A common clonal origin for periarteriolar lymphoid sheath-associated foci and germinal centers. J. Exp. Med. 176: 679-687. [Abstract/Free Full Text]
  12. Jacob, J., R. Kassir, G. Kelsoe. 1991. In situ studies of the primary immune response to (4-hydroxy-3- nitrophenyl)acetyl: I. The architecture and dynamics of responding cell populations. J. Exp. Med. 173: 1165-1175. [Abstract/Free Full Text]
  13. Schwickert, T. A., R. L. Lindquist, G. Shakhar, G. Livshits, D. Skokos, M. H. Kosco-Vilbois, M. L. Dustin, M. C. Nussenzweig. 2007. In vivo imaging of germinal centres reveals a dynamic open structure. Nature 446: 83-87. [Medline]
  14. White, H. N.. 1998. Restriction-PCR fingerprinting of the immunoglobulin VH repertoire: direct detection of an immune response and global analysis of B cell clonality. Eur. J. Immunol. 28: 3268-3279. [Medline]
  15. Han, S., B. Zheng, J. Dal Porto, G. Kelsoe. 1995. In situ studies of the primary immune response to (4-hydroxy-3-nitrophenyl)acetyl: IV. Affinity-dependent, antigen-driven B cell apoptosis in germinal centers as a mechanism for maintaining self-tolerance. J. Exp. Med. 182: 1635-1644. [Abstract/Free Full Text]
  16. Barnden, M. J., J. Allison, W. R. Heath, F. R. Carbone. 1998. Defective TCR expression in transgenic mice constructed using cDNA-based {alpha}- and β-chain genes under the control of heterologous regulatory elements. Immunol. Cell Biol. 76: 34-40. [Medline]
  17. Weiss, U., R. Zoebelein, K. Rajewsky. 1992. Accumulation of somatic mutants in the B cell compartment after primary immunization with a T cell-dependent antigen. Eur. J. Immunol. 22: 511-517. [Medline]
  18. Allen, D., T. Simon, F. Sablitzky, K. Rajewsky, A. Cumano. 1988. Antibody engineering for the analysis of affinity maturation of an anti-hapten response. EMBO J. 7: 1995-2001. [Medline]
  19. Sims, G. P., H. Shiono, N. Willcox, D. I. Stott. 2001. Somatic hypermutation and selection of B cells in thymic germinal centers responding to acetylcholine receptor in myasthenia gravis. J. Immunol. 167: 1935-1944. [Abstract/Free Full Text]
  20. Gause, A., K. Gundlach, M. Zdichavsky, G. Jacobs, B. Koch, T. Hopf, M. Pfreundschuh. 1995. The B lymphocyte in rheumatoid arthritis: analysis of rearranged V kappa genes from B cells infiltrating the synovial membrane. Eur. J. Immunol. 25: 2775-2782. [Medline]
  21. Schroder, A. E., A. Greiner, C. Seyfert, C. Berek. 1996. Differentiation of B cells in the nonlymphoid tissue of the synovial membrane of patients with rheumatoid arthritis. Proc. Natl. Acad. Sci. USA 93: 221-225. [Abstract/Free Full Text]
  22. Stott, D. I., F. Hiepe, M. Hummel, G. Steinhauser, C. Berek. 1998. Antigen-driven clonal proliferation of B cells within the target tissue of an autoimmune disease. J. Clin. Invest. 102: 938-946. [Medline]
  23. Shlomchik, M. J., A. H. Aucoin, D. S. Pisetsky, M. G. Weigert. 1987. Structure and function of anti-DNA autoantibodies derived from a single autoimmune mouse. Proc. Natl. Acad. Sci. USA 84: 9150-9154. [Abstract/Free Full Text]
  24. Herlands, R. A., J. William, U. Hershberg, M. J. Shlomchik. 2007. Anti-chromatin antibodies drive in vivo antigen-specific activation and somatic hypermutation of rheumatoid factor B cells at extrafollicular sites. Eur. J. Immunol. 37: 3339-3351. [Medline]
  25. Bombardieri, M., F. Barone, F. Humby, S. Kelly, M. McGurk, P. Morgan, S. Challacombe, S. de Vita, G. Valesini, J. Spencer, C. Pitzalis. 2007. Activation-induced cytidine deaminase expression in follicular dendritic cell networks and interfollicular large B cells supports functionality of ectopic lymphoid neogenesis in autoimmune sialoadenitis and MALT lymphoma in Sjogren’s syndrome. J. Immunol. 179: 4929-4938. [Abstract/Free Full Text]
  26. Natvig, J. B., I. Randen, K. Thompson, O. Forre, R. A. Mageed, R. Jefferis, D. A. Carson, H. Tighe, V. Pascual, K. D. Victor, et al 1990. Probing of the rheumatoid factor (RF) V gene repertoire in rheumatoid arthritis (RA) by hybridoma clones. Clin. Exp. Rheumatol. 8: (Suppl. 5):75-80. [Medline]
  27. Stott, D. I., F. Hiepe, M. Hummel, G. Steinhauser, C. Berek. 1998. Antigen-driven clonal proliferation of B cells within the target tissue of an autoimmune disease: the salivary glands of patients with Sjogren’s syndrome. J. Clin. Invest. 102: 938-946. [Medline]
  28. Armengol, M. P., M. Juan, A. Lucas-Martin, M. T. Fernandez-Figueras, D. Jaraquemada, T. Gallart, R. Pujol-Borrell. 2001. Thyroid autoimmune disease: demonstration of thyroid antigen-specific B cells and recombination-activating gene expression in chemokine-containing active intrathyroidal germinal centers. Am. J. Pathol. 159: 861-873. [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
D. C. Nacionales, J. S. Weinstein, X.-J. Yan, E. Albesiano, P. Y. Lee, K. M. Kelly-Scumpia, R. Lyons, M. Satoh, N. Chiorazzi, and W. H. Reeves
B Cell Proliferation, Somatic Hypermutation, Class Switch Recombination, and Autoantibody Production in Ectopic Lymphoid Tissue in Murine Lupus
J. Immunol., April 1, 2009; 182(7): 4226 - 4236.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Weinstein, J. S.
Right arrow Articles by Reeves, W. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Weinstein, J. S.
Right arrow Articles by Reeves, W. H.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS