The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

The Journal of Immunology, 2008, 181, 3232 -3242
Copyright © 2008 by The American Association of Immunologists, Inc.
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vettermann, C.
Right arrow Articles by Jäck, H.-M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vettermann, C.
Right arrow Articles by Jäck, H.-M.

A Unique Role for the {lambda}5 Nonimmunoglobulin Tail in Early B Lymphocyte Development1

Christian Vettermann*, Kai Herrmann*, Christine Albert*, Edith Roth*, Michael R. Bösl{dagger} and Hans-Martin Jäck2,*

* Division of Molecular Immunology, Department of Internal Medicine III, Nikolaus-Fiebiger-Center for Molecular Medicine, University of Erlangen, Erlangen, Germany; and {dagger} Max-Planck-Institute for Neurobiology, Martinsried, Germany


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Precursor BCR (pre-BCR) signaling governs proliferation and differentiation of pre-B cells during B lymphocyte development. However, it is controversial as to which parts of the pre-BCR, which is composed of Igµ H chain, surrogate L chain (SLC), and Ig{alpha}-Igβ, are important for signal initiation. Here, we show in transgenic mice that the N-terminal non-Ig-like (unique) tail of the surrogate L chain component {lambda}5 is critical for enhancing pre-BCR-induced proliferation signals. Pre-BCRs with a mutated {lambda}5 unique tail are still transported to the cell surface, but they deliver only basal signals that trigger survival and differentiation of pre-B cells. Further, we demonstrate that the positively charged residues of the {lambda}5 unique tail, which are required for pre-BCR self-oligomerization, can also mediate binding to stroma cell-associated self-Ags, such as heparan sulfate. These findings establish the {lambda}5 unique tail as a pre-BCR-specific autoreactive signaling motif that could increase the size of the primary Ab repertoire by selectively expanding pre-B cells with functional Igµ H chains.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Blymphocytes recognize Ags via the variable regions of their membrane-bound BCRs that consist of two covalently associated Ig H chains (HC)3 and two Ig L chains (LC). The exons encoding the variable regions of HC and LC are stepwise assembled during B lymphocyte development by DNA recombination from multiple variable (V), diversity (D), and joining (J) gene segments. Early progenitor (pro) B cells with a productive VDJ exon synthesize a µHC that can assemble with the surrogate L chain (SLC) and the signal transducers Ig{alpha}-Igβ into the immature precursor (pre) BCR (pre-BCR) (1, 2, 3, 4). Pre-BCR signals enhance the proliferation of large pre-B cells and guide their differentiation through the pre-BCR checkpoint into small quiescent pre-B cells that rearrange the LC gene (5, 6).

Pre-BCR-induced proliferation signals lead to the clonal expansion of pre-B cells producing a functional Igµ HC (µHC), that is, one that can pair with SLC and with LC later in development (7, 8, 9). On the one hand, this compensates for the loss of pro-B cells with two nonproductive VDJ exons and of pre-B cells producing a dysfunctional, that is, a nonpairing µHC (10, 11, 12). On the other hand, the expansion of a single pre-B cell gives rise to a clonal progeny in which all cells produce the same µHC; yet, each of these cells will rearrange a different LC gene and thus produce a BCR with different Ag specificity. Hence, the major function of the pre-BCR is to increase the combinatorial diversity, and thus the overall size, of the primary Ab repertoire (5, 11).

The importance of pre-BCR signals for B lymphocyte development has been established in various gene-targeted and transgenic mice (13, 14, 15, 16, 17, 18, 19, 20). Surprisingly, the SLC is not absolutely required for pre-BCR function (14, 21, 22), since SLC-deficient mice generate mature B lymphocytes, albeit at lower numbers, a finding that has been attributed to the reduced proliferative expansion of large pre-B cells (7, 9). However, it is unclear how the SLC, which consists of the invariant and noncovalently associated polypeptides VpreB and {lambda}5, controls the initiation of pre-BCR-mediated proliferation signals.

Structural motifs that distinguish the SLC from a conventional LC are the non-Ig-like (unique) tails at the C and N termini of VpreB and {lambda}5, respectively (11, 23). As shown previously, both tails are not required for SLC assembly (24). In silico modeling and x-ray crystallography revealed that the unique tails protrude from the pre-BCR at the position where the third CDR (CDR3) would be located in the BCR (25, 26, 27) and could, therefore, be accessible for ligands. Indeed, the {lambda}5 unique tail was required for binding of pre-BCRs to the stroma cell-associated self-Ags heparan sulfate and galectin-1, which have been proposed to induce pre-BCR signaling (28, 29, 30). Alternatively, signals could be initiated autonomously, since the pre-BCR is also reactive against itself, which leads to self-oligomerization, presumably via direct interaction of the oppositely charged unique tails of VpreB and {lambda}5 (25, 31, 32, 33).

However, none of these in vitro studies clarified whether the unique tails of the SLC are indeed critical for pre-BCR-mediated proliferation signals in vivo. On the contrary, previously published in vivo studies rather suggest that the SLC is functionally dispensable and can be replaced by a prematurely expressed conventional LC (16, 18, 34, 35). Therefore, we established transgenic mice with mutated pre-BCRs either lacking the {lambda}5 unique tail or bearing a modified {lambda}5 unique tail in which all positively charged amino acids were converted to alanine. Flow cytometry analyses of B lymphoid cells in these mice revealed that the proliferative expansion of µHC-positive pre-B cells with mutated pre-BCRs was impaired and, consequently, the numbers of mature B lymphocytes were markedly reduced. Hence, the {lambda}5 unique tail controls early B lymphocyte development and is critical to increase the primary Ab repertoire by enhancing the proliferation of pre-B cells that produce a functional µHC.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Transgenic mice

{lambda}5 transgenic mice were generated by microinjecting linearized DNA fragments (see "Retroviral, bacterial, and transgenic expression vectors" below) into pronuclei of oocytes from FVB mice. Transgenic offspring were verified by Southern blot (see below) and genotyped by PCR (95°C, 3 min; 35 cycles (95°C, 30 s; 60°C, 30 s; 72°C, 1 min); 72°C, 5 min) with the following primers: GGACTGGATATCAGTCAGGCAGAGCTG, ACTTTGCCCCCTCCATATAACATGAA. {lambda}5 transgenic mice, RAG2–/– mice (36), {lambda}5–/– mice (14), and µHC transgenic quasimonoclonal (QM) mice (37), in which the JH cluster was replaced with the VDJ exon from the hybridoma 17.2.25, were maintained under specific pathogen-free conditions. All animal experiments were performed in accordance with the guidelines of the Animal Care and Use Committee of the Government of Bavaria and the institutional guidelines of the University of Erlangen-Nürnberg.

Southern blot analysis

BamHI-digested genomic DNA was analyzed as described (38) by Southern blotting with a 1687-bp-sized {lambda}5 probe amplified by PCR from genomic DNA (primers: AGTCAGCTAGCAAACTCCAAATATCTGTAAAATTCCAAAGCTTCT and TGACTGCTAGCCAGCACACAAACCTATAGTGCAAACAGGTCC) and labeled with [32P]dCTP (RadPrime kit, Invitrogen). Radioactive bands were visualized with a FLA-3000 phosphoimager (Fujifilm) equipped with BASReader software (Raytest).

Mutagenesis of the {lambda}5 unique tail

The {lambda}5 coding sequence lacking the unique tail ({lambda}5{Delta}U) was constructed by inserting GCTCAGCATGGTATGTCTTTGGTGGTGGGACCCAGCTCACAATCCTAGG (Invitrogen) into BlpI and AvrII sites of the murine {lambda}5 coding sequence. {lambda}5Uala was constructed by site-directed mutagenesis of all basic amino acid codons (seven arginines and one lysine) in the {lambda}5 unique tail, as follows: Briefly, the synthetic BstZ17I/NaeI-digested fragment GTATACATAAGCTACATATACGCAGAAGCAAGCGCCGCTGTGGGCCCTGGAGCTTCAGTGGGAAGCAACGCCGGC was inserted into BstZ17I/StuI-digested pCR2.1-{lambda}5mel vector (29). Subsequently, an overlap PCR product was obtained from the modified {lambda}5mel sequence (primers: GCCGGAGCAGGTCCCGCTTGCTCGCCCCATGCCCTTCCATCTGCACCCCAG, AGCGGGACCTGCTCCGGCTGGGATGATCTGGAACAGGAGTGCGCCGGG, TCCCGGGACCATGAAGTTC, and TCTCGAGCTAAGAACACTCAGCAGGTGAC). Finally, the mutated {lambda}5 sequence with the murine leader was constructed by inserting into the {lambda}5{Delta}U coding sequence a BlpI/AvrII-digested PCR product obtained from mutated {lambda}5mel coding sequence (primers: CATACTTTCCCCAAGCTCAGCAGAAGCAAGCGCCGCTGTGG and CTTGGGCTGACCTAGGATTGTG).

Retroviral, bacterial, and transgenic expression vectors

Retroviral {lambda}5 expression vectors were constructed by inserting {lambda}5 coding sequences upstream of an internal ribosomal entry site-GFP cassette into the EcoRI-digested MIEV vector (39). Bacterial expression vectors encoding the GST fusion proteins were constructed by inserting the unique tail sequences of murine as well as human {lambda}5 and VpreB into the BamHI and EcoRI restriction sites of the GST-encoding plasmid pGEX2T (Amersham Biosciences). Wild-type and mutated unique tail sequences of {lambda}5 and VpreB were obtained by PCR with the following primers: U{lambda}5m forward, CGCGGATCCGAAAGGAGCAGAGCTGTGGG; U{lambda}5m reverse, CGGAATTCCTAAAACTGGGGCTTAGATGGAAG; UVpreBm forward, CGCGGATCCCAGGAAAAGAAGAGGATGGAG; UVpreBm reverse, CGGAATTCCTAAGATCCCAAATCTGTATACG; U{lambda}5h forward, CGCGGATCCTCGCAGAGCAGGGCCCTG; U{lambda}5h reverse, CGGAATTCCTACACTGAGTTATGCTTGGATTGA; UVpreBh forward, CGCGGATCCTCGGAGAAGGAGGAGAGGG; UVpreBh reverse, CGGAATTCTCAAGGGACACGTGTCCTGG. The mutated unique tail of murine {lambda}5 (Uala({lambda}5m)) was obtained from mutated {lambda}5mel coding sequence by PCR with the primers CGCGGATCCGAAGCAAGCGCCGCTGTGG and CGGAATTCCTAAAACTGGGGTGCAGATGGAAG. Transgenic expression vectors were constructed as follows: Mutated and wild-type murine {lambda}5 coding sequences with a Kozak consensus motif were inserted between a splice donor (exon 2)/intron/splice acceptor (exon 3) and the polyadenylation site of rabbit β-globin gene. The cassette was inserted downstream of the murine {lambda}5 promoter (40) and between two genomic fragments isolated from murine {lambda}5 locus by PCR as follows: The upstream 2773-bp genomic fragment starting with TATTCTGCAGAAGTGCAGCATGCAG and ending with GGCTAGAGTTGACTTTGGACTTGAGGGTCA contains the 5' locus control region (LCR) as well as the {lambda}5 promoter, and the downstream 4636-bp genomic fragment starting with CTAGGGGAGACATATGCAACGTGTGCCC and ending with TGGACCTGTTTGCACTATAGGTTTGTGTGCTG contains the 3'LCR (41).

Isolation, retroviral infection, and growth of B-lineage cells

CD19+c-kit+ BM cells were isolated by magnetic sorting on autoMACS (Miltenyi Biotec) with FITC-conjugated anti-CD19 Abs (BD Biosciences) and anti-FITC Abs coupled to magnetic beads (Multisort kit, Miltenyi Biotec), followed by R-phycoerithrin (RPE)-conjugated anti-c-kit Abs (BD Biosciences) and anti-RPE Abs coupled to magnetic beads, according to the manufacturer’s instructions (Miltenyi Biotec). Retroviral supernatants were produced by transfecting the appropriate vectors into phoenix-E packaging cells maintained in DMEM (1 mM sodium pyruvate, nonessential amino acids, 50 µM 2-ME, 50 U/ml penicillin G, 50 µg/ml streptomycin) with 10% FCS. Retrovirally infected B-lymphoid cells (104) were seeded in triplicate onto 104 mitomycin C-treated ST-2 stroma cells and grown in a 96-well plate in complete RPMI 1640 medium (7). Cell numbers were determined with Flow Count Fluorospheres (Beckman Coulter) on FACSCalibur (BD Biosciences).

Heparin affinity chromatography and Western blot analysis

GST fusion proteins in 10 mM phosphate (pH 7), 180 mM NaCl were loaded at 1 ml/min onto a heparin column (Amersham Biosciences) and eluted with 10 mM phosphate (pH 7), 1.5 M NaCl. Fractions were analyzed by Western blotting as previously described (42) with goat anti-GST Abs (Amersham Biosciences) and HRP-conjugated rabbit anti-goat Abs (Sigma-Aldrich).

Flow cytometry

Single-cell suspensions were stained as previously described (38) with the following Abs: RPE-conjugated rat anti-CD19 (clone 1D3, BD Biosciences), rat anti-CD19 (clone 1D3F2) conjugated to Alexa Fluor 488 with a labeling kit (Molecular Probes/Invitrogen), RPE-conjugated rat anti-CD25 (clone PC61, BD Biosciences), RPE-conjugated anti-c-kit (clone ACK45, BD Biosciences), RPE-conjugated monoclonal rat anti-Ig{kappa} (clone 187.1, Southern Biotechnology Associates), RPE-conjugated goat anti-Ig{lambda} (Southern Biotechnology Associates), rat anti-{lambda}5 (clone LM34, from F. Melchers) conjugated to Cy5 (GE Healthcare/Amersham Biosciences), FITC-conjugated anti-µHC (BD Biosciences), goat anti-µHC (Southern Biotechnology Associates) conjugated to Cy5 with a labeling kit (GE Healthcare/Amersham Biosciences), rat anti-pre-BCR (clone SL156 (43), from F. Melchers), and Cy5-conjugated goat anti-rat (The Jackson Laboratory). To detect cytoplasmic proteins, cells were fixed and permeabilized with Fix&Perm kit (An der Grub Bio Research). Cells in the lymphocyte gate were analyzed with a FACSCalibur. Binding of GST fusion proteins to ST-2 stroma cells was detected with goat anti-GST (Amersham Biosciences) and FITC-conjugated anti-goat IgG Abs (Jackson ImmunoResearch Laboratories).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
Generation of transgenic mice expressing pre-BCRs with a mutated {lambda}5 unique tail

The {lambda}5 unique tail is thought to initiate signals by mediating pre-BCR self-oligomerization (33) or by engaging with stroma cell-associated self-Ags (28, 30). Regardless of the utilized mechanism, mutations of the {lambda}5 unique tail should therefore interfere with pre-BCR signaling, and thus with the developmental transition of pre-B cells through the pre-BCR checkpoint (6, 11). To test this in vivo function of the {lambda}5 unique tail in early B lymphocyte development, we established three different transgenic mouse strains that were backcrossed with {lambda}5-deficient mice ({lambda}5–/–). The first transgene encoded a {lambda}5 chain lacking the unique tail ({lambda}5{Delta}U), the second a {lambda}5 chain with mutated unique tail, in which all positively charged amino acids (seven arginines and one lysine) were converted to alanine ({lambda}5Uala), and the third encoded wild-type {lambda}5 ({lambda}5wt) (Fig. 1A). Genomic integration of transgenes was confirmed by Southern blotting (Fig. 1B). Since transgenes were driven by the {lambda}5 promoter and two {lambda}5 locus control regions (Fig. 1A), which can be silenced by pre-BCR signals (41, 44, 45), we expected lineage- and stage-specific transgene expression in pro-B cells and early pre-B cells, but not in later B-lymphoid stages. Indeed, flow cytometry of bone marrow cells from the mouse lines {lambda}5{Delta}UTg1, {lambda}5UalaTg1, and {lambda}5wtTg13 detected transgenic {lambda}5 in CD19+c-kit+ pro-B and early pre-B cells, but not in CD19+CD25+ late pre-B or in CD19+IgM+ B cells (Fig. 2). Additionally, the abundance of {lambda}5 was comparable between pro-B cells from {lambda}5 transgenic and wild-type {lambda}5+/– mice (Fig. 2, left), and the surface expression of pre-BCRs containing {lambda}5{Delta}U or {lambda}5Uala was only slightly higher than that of wild-type pre-BCRs (Fig. 3). Therefore, pre-BCRs with a mutated {lambda}5 unique tail can reach the cell surface of early pre-B cells and induce signals that silence the expression of the SLC component {lambda}5 in late pre-B and IgM+ B cells.


Figure 1
View larger version (31K):
[in this window]
[in a new window]

  		FIGURE 1. A, Schematic of {lambda}5 transgenes (Tg) encoding murine {lambda}5 with intact unique tail ({lambda}5wt), lacking the unique tail ({lambda}5{Delta}U), or bearing a modified unique tail ({lambda}5Uala), in which all basic amino acids were converted to alanine. The coding sequences were inserted into a β-globin cassette with splice donor (SD), intron, splice acceptor (SA), and polyadenylation site (pA). This cassette was placed downstream of the {lambda}5 promoter ({lambda}5p) and between two {lambda}5 locus control regions (5'LCR and 3'LCR). L, leader; U, unique tail. B, BamHI-digested genomic DNA from the indicated {lambda}5 transgenic (Tg) mouse lines was separated, blotted, and hybridized with the radio-labeled probe shown below the blot as dark gray bar. The probe detects the {lambda}5{Delta}UTg (9.2-kb) and {lambda}5UalaTg (9.4-kb) transgenes as 7.8-kb and 8.0-kb fragments, respectively, which are located between the BamHI sites of two head-to-tail inserted transgene copies. The promoter (light gray filled circle), the {lambda}5 coding sequence (open box), and the LCRs (bold lines) are indicated.

 

Figure 2
View larger version (45K):
[in this window]
[in a new window]

  		FIGURE 2. In vivo expression of transgenic {lambda}5 with mutated unique tail was analyzed by flow cytometry with Abs (clone LM34) in permeabilized CD19+c-kit+ pro-B (left), CD19+CD25+ pre-B (middle), and CD19+IgM+ B cells (right) from the bone marrow (BM). Numbers in the histograms indicate mean fluorescence (MF), and numbers in the dot plots indicate frequencies of cells. BM cells from {lambda}5–/–/{lambda}5wtTg13 mice were analyzed separately from the other transgenic lines along with appropriate negative and positive controls (not shown); thus, the cell populations shifted slightly. FI, fluorescence intensity.

 

Figure 3
View larger version (55K):
[in this window]
[in a new window]

  		FIGURE 3. Pre-BCRs with mutated {lambda}5 are expressed at the surface of pre-B cells from {lambda}5 transgenic mice. Bone marrow (BM) cells from mice were cultured in media with IL-7 for 5 days and surface-stained with Abs that recognize only a completely assembled pre-BCR (clone SL156), permeabilized and stained with Abs against µHC and LC({kappa}+{lambda}). Large cytoplasmic µHC+LC– pre-B cells were gated and analyzed for surface pre-BCR expression by flow cytometry. Pre-B cells from {lambda}5–/– mice served as negative control (gray filled histograms). FI, fluorescence intensity, FSC, forward scatter, SSC, side scatter, MF, mean fluorescence.

 
The {lambda}5 unique tail is critical for early B lymphocyte development

If the {lambda}5 unique tail controls pre-BCR-induced clonal expansion signals in µHC-positive pre-B cells, we would expect that B lymphocyte development is impaired at the pre-B cell stage in mice with tail-mutated {lambda}5. As predicted, flow cytometry revealed that frequencies and numbers of CD19+CD25+ pre-B cells in the bone marrow and of CD19+IgM+ B cells in the bone marrow as well as in the spleen were reduced in {lambda}5{Delta}U and {lambda}5Uala transgenic mice when compared with wild-type mice ({lambda}5+/–) (Fig. 4A and Table I). Similar results were obtained for two other independent transgenic lines expressing mutated {lambda}5 (data not shown). In contrast, mice with transgenic wild-type {lambda}5 ({lambda}5wt) showed no substantial alterations in the frequency and number of B-lineage cells when compared with wild-type mice ({lambda}5+/–) (Fig. 4A and Table I). These findings exclude that random integration of {lambda}5 transgenes adversely affected B-lineage cells and demonstrate that the {lambda}5 unique tail is critical for developing B lymphocytes at the transition from the pro-B to the pre-B cell stage.


Figure 4
View larger version (73K):
[in this window]
[in a new window]

  		FIGURE 4. The {lambda}5 unique tail is critical for early B lymphocyte development. A, Bone marrow (BM) and spleen (Spl) cells from mice were analyzed by flow cytometry with indicated Abs. Numbers in the upper right quadrant indicate frequencies of either pro-B (CD19+c-kit+), pre-B (CD19+CD25+), or B cells (CD19+IgM+). B, BM cells from mice were surface-stained with Abs against CD19 and LC({kappa}+{lambda}), permeabilized, and stained with Abs against µHC. The CD19+LC– pro-B and pre-B cell population was gated and analyzed by flow cytometry for cytoplasmic µHC. Numbers indicate the frequencies of cytoplasmic µHC+ pre-B cells. BM cells from {lambda}5–/–/{lambda}5wtTg13 mice were analyzed separately from the other transgenic lines along with appropriate negative and positive controls (not shown); thus, cell populations shifted slightly in A and B. FI, fluorescence intensity.

 

View this table:
[in this window]
[in a new window]

  		Table I. Absolute numbers of B-lineage cells in {lambda}5 transgenic mice

 
If pre-BCR-mediated clonal expansion signals are impaired in transgenic mice with tail-mutated {lambda}5, we would expect a reduction in cytoplasmic µHC+LC– pre-B cells (46). As predicted, the frequencies of these cells among all CD19+LC– B-lineage cells (pro-B and pre-B cells) were reduced in the bone marrow of {lambda}5{Delta}U and {lambda}5Uala transgenic mice when compared with wild-type mice and mice transgenic for {lambda}5wt (Fig. 4B). This indicates that the {lambda}5 unique tail is required for efficient clonal expansion and/or survival of µHC+ pre-B cells. Additionally, no significant differences were detected in the absolute number of CD19+c-kit+ pro-B cells in mice with mutated or wild-type {lambda}5 (Table I), which provides further evidence that the {lambda}5 unique tail is critical for early B lymphocyte development at the pre-B cell stage.

The {lambda}5 unique tail enhances pre-BCR-mediated proliferation and growth of pre-B cells

The reduced number of pre-B cells in transgenic mice with mutated {lambda}5 chains could be attributed to a decrease in either proliferation or survival. To distinguish between these two possibilities, we analyzed the cell cycle by measuring the DNA content of DAPI-stained large µHC+LC– pre-B cells. As revealed in another staining, large µHC+LC– pre-B cells were surface pre-BCR-positive (Fig. 3), and they thus represent the earliest cells that coexpress a newly synthesized µHC and the SLC components VpreB and {lambda}5. Compared with wild-type mice ({lambda}5+/–), {lambda}5{Delta}U and {lambda}5Uala transgenic mice had lower frequencies of large pre-B cells in the proliferative cell cycle phases S/G2/M, albeit the frequencies were still higher than in {lambda}5–/– mice (Fig. 5A). In contrast, no significant differences were observed for the frequencies of cycling pre-B cells in {lambda}5wt transgenic and wild-type mice ({lambda}5+/–). Further, the frequency of cycling pre-B cells in {lambda}5Uala transgenic mice was slightly higher than in {lambda}5{Delta}U transgenic mice, which is consistent with the finding that {lambda}5Uala transgenic mice have more pre-B and B cells in the bone marrow when compared with {lambda}5{Delta}U transgenic mice (Fig. 4 and Table I). This indicates that pre-BCRs with mutated {lambda}5 unique tail induce some proliferative signals, which are, however, markedly reduced when compared with wild-type pre-BCRs. In contrast, apoptotic pre-B cells in the sub-G1 phase were hardly detectable in all mice (<2%; Fig. 5A). Hence, both the deletion and mutation of the {lambda}5 unique tail predominantly impair proliferation but do not severely affect the survival of pre-B cells.


Figure 5
View larger version (29K):
[in this window]
[in a new window]

  		FIGURE 5. The {lambda}5 unique tail controls pre-BCR-mediated proliferation and cell growth. A, Bone marrow (BM) cells from mice were intracellularly stained with DAPI and with Abs against µHC and LC({kappa}+{lambda}). The DNA content of large pre-B cells gated as large cytoplasmic µHC+LC– BM cells was determined by DAPI fluorescence (left). Numbers indicate frequencies of cells in the proliferative cell cycle phases S/G2/M and in the apoptotic sub-G1 phase. BM cells from {lambda}5–/–/{lambda}5wtTg mice were analyzed separately from the other transgenic lines along with appropriate negative (not shown) and positive controls; thus, histogram peaks shifted slightly. FI, fluorescence intensity. Mean values with SDs of frequencies of pre-B cells in the sub-G1, G1, and S/G2/M phases from four experiments are summarized in the bar diagram (right). *, p < 0.03 with Student’s t test. B, CD19+c-kit+ BM cells isolated from µHC transgenic (top) and nontransgenic (bottom) RAG2–/–{lambda}5–/– mice were retrovirally transduced with bicistronic {lambda}5/GFP-encoding vectors. The fold increase ± SD in the number of GFP+ cells was determined in triplicate over 4 days (left). The relative increase of GFP+ to GFP– cells is given as mean value with SD from four experiments (right). *, p < 0.04 with Student’s t test.

 
To confirm that the {lambda}5 unique tail controls pre-BCR-mediated cell expansion, we retrovirally transduced pre-B cells from µHC transgenic (37) RAG2/{lambda}5-deficient mice with bicistronic vectors encoding mutated or wild-type {lambda}5 and enhanced GFP. The cells were cultured on ST-2 stroma cells and the number of GFP-positive pre-B cells was determined over a period of 4 days. The increase in pre-B cells transduced with mutated {lambda}5 was lower than that of pre-B cells transduced with wild-type {lambda}5 (Fig. 5B, top), even though pre-BCRs with mutated {lambda}5 were properly expressed at the cell surface (data not shown). The increase in pre-B cells with mutated {lambda}5 was, however, higher than that of pre-B cells transduced with the GFP control vector (Fig. 5B, top), suggesting that the growth of µHC+ pre-B cells is enhanced by, but is not strictly dependent on, the {lambda}5 unique tail. In contrast, only minor or no differences were observed for the growth of transduced µHC– pro-B cells from RAG2/{lambda}5-deficient mice (Fig. 5B, bottom), which excludes nonspecific effects of mutated {lambda}5 chains on cell growth. Additionally, propidium iodide (PI) staining revealed a higher frequency of cycling pre-B cells from µHC transgenic RAG2/{lambda}5-deficient mice in cultures transduced with wild-type {lambda}5 than in cultures transduced with mutated {lambda}5 (data not shown). Therefore, the {lambda}5 unique tail is a pre-BCR-specific motif that controls the clonal expansion of pre-B cells with a functional µHC by amplifying proliferation signals.

The {lambda}5 unique tail is not required for pre-BCR-mediated differentiation of pre-B cells

To explain why tail-mutated {lambda}5 chains partially restored B lymphocyte development in {lambda}5-deficient mice (Fig. 4), we hypothesized that pre-BCR-mediated differentiation signals, in contrast to proliferation signals, do not require the presence of an intact {lambda}5 unique tail. For example, pre-BCRs with tail-mutated {lambda}5 could still induce the rearrangement and expression of LCs (47). In this case, the ratio of LC+ B cells to small LC– pre-B cells should be similar in mice with mutated and wild-type {lambda}5 (Fig. 6A). As expected, this ratio was comparable in {lambda}5{Delta}U transgenic, {lambda}5Uala transgenic, and wild-type mice when we analyzed cytoplasmic µHC+ B lineage cells for the expression of LC by flow cytometry (Fig. 6, B and C). In contrast, a much lower ratio of LC+ B cells to small LC– pre-B cells was observed in {lambda}5-deficient mice. These findings suggest that efficient pre-BCR-mediated differentiation signals, which induce LC expression in small pre-B cells, require the presence of the {lambda}5 chain, but not its unique tail. In summary, we have shown that the {lambda}5 unique tail is a critical pre-BCR-specific signaling motif that controls early B lymphocyte development by enhancing proliferation, but not differentiation, of pre-B cells.


Figure 6
View larger version (21K):
[in this window]
[in a new window]

  		FIGURE 6. The {lambda}5 unique tail is not required for pre-BCR-mediated differentiation of pre-B cells. A, Schematic depicting the development of large pre-B cells via small pre-B cells into B cells. B, The expected populations of µHC+LC+ B cells and large as well as small µHC+LC– pre-B cells are depicted (top). Flow cytometry analysis of permeabilized bone marrow (BM) cells after staining with Abs against µHC and LC({kappa}+{lambda}) (bottom): Total cytoplasmic µHC+ cells were gated and analyzed for cell size (FSC, forward scatter) and LC expression. Numbers indicate the frequencies of LC+ B cells and small LC– pre-B cells. FI, fluorescence intensity. C, The ratio of LC+ B cells to small LC– pre-B cells is presented as mean value with SD from three experiments.

 
The positively charged amino acids in the {lambda}5 unique tail mediate binding to heparan sulfate

Our finding that the clonal expansion of pre-B cells is impaired in mice with tail-mutated {lambda}5 can be explained by the model that the positively charged amino acids in the {lambda}5 unique tail are critical for pre-BCR self-oligomerization (33). However, our data do not exclude that the {lambda}5 unique tail is also involved in binding of the pre-BCR to self-Ags, such as bone marrow stroma cell-associated heparan sulfate (30). Since heparan sulfate contains many negatively charged sulfate and carboxyl groups, it is a good candidate to interact with the positively charged residues in the {lambda}5 unique tail.

To test this idea, we produced recombinant fusion proteins consisting of GST and the unique tail (U) of either murine {lambda}5 (m{lambda}5) or human {lambda}5 (h{lambda}5). Additionally, we replaced all positively charged amino acids (seven arginines and one lysine) in the {lambda}5 unique tail with alanine, fused the mutated tail to GST (Uala(m{lambda}5)-GST), and analyzed binding of all fusion proteins to immobilized heparin, a glycosaminoglycan closely related to heparan sulfate, by affinity chromatography. As expected, most of U(m{lambda}5)-GST and U(h{lambda}5)-GST were found in the elution fraction by Western blot analysis (Fig. 7A). In contrast, Uala(m{lambda}5)-GST was almost exclusively detected in the flow through and only a minor fraction was present in the elution fraction (Fig. 7A). Hence, the basic amino acids in the {lambda}5 unique tail are critical, but not absolutely required, for binding of the pre-BCR to heparan sulfate. Unconjugated GST (data not shown) and GST fused to the unique tail of murine VpreB (U(mVpreB)) or human VpreB (U(hVpreB)) were exclusively detected in the flow through, which demonstrates that only the unique tail of {lambda}5 contains binding sites for heparan sulfate.


Figure 7
View larger version (30K):
[in this window]
[in a new window]

  		FIGURE 7. The positively charged amino acid residues in the {lambda}5 unique tail mediate binding to heparan sulfate. A, Affinity chromatography of GST fusion proteins. Fusion proteins of the unique tails (U) of murine (m) and human (h) {lambda}5 and VpreB with GST were loaded in 180 mM NaCl onto heparin columns and eluted with 1.5 M NaCl. Flow through and elution fractions were analyzed by Western blotting (WB) with Abs against GST. In Uala(m{lambda}5)-GST, all positively charged amino acids (+) of wild-type U(m{lambda}5) were replaced with alanine (A). The negatively charged amino acids (–) in U(mVpreB) and U(hVpreB) are also indicated. B, Binding of GST fusion proteins to ST-2 stroma cells was analyzed by indirect flow cytometry with Abs against GST and FITC-conjugated secondary Abs. Unconjugated GST served as negative control (filled histogram). FI, fluorescence intensity.

 
These findings were corroborated when we analyzed the binding of GST fusion proteins to the surface of ST-2 bone marrow stroma cells by flow cytometry. When compared with wild-type U(m{lambda}5)-GST and U(h{lambda}5)-GST, only weak binding of Uala(m{lambda}5)-GST to ST-2 stroma cells could be detected with Abs against GST (Fig. 7B). In contrast, no binding was observed for unconjugated GST, U(mVpreB)-GST, or U(hVpreB)-GST. These findings demonstrate that the positively charged amino acids in the {lambda}5 unique tail mediate the interaction of pre-BCRs with stroma cell-associated self-Ags, such as heparan sulfate. Since that could explain the impaired clonal expansion of pre-B cells producing tail-mutated {lambda}5, the involvement of ligands in pre-BCR signal initiation should be considered in future studies.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
We determined the in vivo function of the {lambda}5 unique tail in B lymphocyte development by establishing transgenic mice lacking this pre-BCR-specific signaling motif. This was stimulated by recent in vitro experiments demonstrating that the {lambda}5 unique tail is critical for both autonomous pre-BCR signal initiation (25, 33) and binding of pre-BCRs to stroma cell-associated self-Ags (28, 30). Our analysis now establishes that the {lambda}5 unique tail controls the clonal expansion of pre-B cells with functional µHCs by accelerating the cell cycle (Figs. 4B and 5). Thus, the {lambda}5 tail is the major structural and functional hallmark that distinguishes a pre-BCR from a mature BCR and targets proliferation signals specifically to pre-B cells, but not to mature B cells. The clonal expansion of pre-B cells leads to a progeny of cells that produce the same µHC but will rearrange different LC genes, and thus synthesize Abs with different Ag specificities. Therefore, pre-BCR-mediated proliferation signals initiated by the {lambda}5 unique tail may be pivotal to increase the combinatorial diversity in the primary Ab repertoire.

Another important observation was that pre-BCRs lacking an intact {lambda}5 unique tail still delivered differentiation signals that terminated stage-specific SLC expression (Fig. 2, middle and right) and induced LC production in pre-B cells (Fig. 6). Based on these findings, we propose a unified pre-BCR signal initiation model in which the C-terminal Ig-like fold domain of {lambda}5 in concert with VpreB displace a µHC from the endoplasmic reticulum-resident chaperone BiP (48), facilitate the transport of pre-BCRs to the cell surface, but govern only basal signals that support survival and differentiation of pre-B cells (Fig. 8, left). Subsequently, crosslinking of pre-BCRs via the {lambda}5 unique tail increases the signal amplitude, thereby reaching the threshold required to induce efficient proliferation (Fig. 8, right).


Figure 8
View larger version (22K):
[in this window]
[in a new window]

  		FIGURE 8. In this unified model for pre-BCR signal initiation, the surface transport of pre-BCRs, even in the absence of the {lambda}5 unique tail, is sufficient to induce basal tonic signals that lead to survival and differentiation of pre-B cells. However, the unique tail of {lambda}5 is essential to enhance the signal amplitude by clustering of pre-BCR molecules, which accelerates proliferation and induces efficient clonal expansion of pre-B cells producing functional µHCs. Further details are found in the Discussion.

 
Crosslinking could be initiated, for example, by autonomous pre-BCR oligomerization via the positively and negatively charged amino acids in the unique tail of {lambda}5 and VpreB, respectively (25, 31, 32, 33). Similarly, pre-TCR signal initiation appears to occur through self-oligomerization via charged residues in the extracellular domain of pre-T{alpha} (49). However, as recently discussed (6, 50), pre-BCR crosslinking could also be mediated by pre-B cell-associated ligands (not depicted in Fig. 8) or by stroma cell-associated self-Ags, such as heparan sulfate and galectin-1 (28, 30), which bind to the positively charged residues in the {lambda}5 unique tail (Fig. 7). In support of this idea, heparan sulfate and galectin-1 appear to enhance the phosphorylation of signaling molecules downstream of the pre-BCR, such as Ig{alpha} and ERK (28, 51, 52). All of these models are not mutually exclusive, and ligand-mediated enhancement of autonomous pre-BCR signals may have evolved to maintain those pre-B cells that express only low amounts of the pre-BCR at their cell surface. Interestingly, heparan sulfate also interacts with the surface molecule CD19 (53), which may co-cluster pre-BCRs and CD19 to additionally enhance pre-BCR signaling (54).

In contrast, our finding that pre-BCR-mediated differentiation signals are triggered even in the absence of the {lambda}5 unique tail (Fig. 6) indicates that some tonic signals can be initiated without pre-BCR cross-linking (55). Stroma cell-associated self-Ags are unlikely to cross-link pre-BCRs containing tail-mutated {lambda}5, e.g., through the unique tail of VpreB, since the unique tail of VpreB did not interact with heparin or with the surface of stroma cells (Fig. 7). Tonic signals can be easily explained by our unified model for pre-BCR signal initiation, which postulates that weak signals sufficient for survival and differentiation of pre-B cells can be induced even by a pre-BCR that is unable to oligomerize (Fig. 8, left). Likewise, tonic signals in the absence of pre-BCR clustering might be triggered by truncated µHCs that are unable to associate with SLC, but nonetheless support the differentiation of pre-B cells in transgenic mice (13, 16, 18).

Compared with {lambda}5{Delta}U transgenic mice, the expansion of pre-B cells was slightly more efficient in {lambda}5Uala transgenic mice, in which all positively charged amino acids of the {lambda}5 unique tail were replaced with alanine (Figs. 4B and 5, Table I). Based on our finding that heparin still weakly binds to the {lambda}5 unique tail in the absence of its positively charged amino acids (Fig. 7A), we propose that weak engagement by stroma cell-associated heparan sulfate induces some proliferative signals through pre-BCRs carrying an uncharged {lambda}5 unique tail. Alternatively, the alanine residues in {lambda}5Uala might support weak pre-BCR self-oligomerization via direct hydrophobic interactions, and thus enhance basal autonomous signaling. Hence, the phenotype of {lambda}5Uala transgenic mice can be explained by our unified model for pre-BCR signal initiation (Fig. 8).

The number of B lymphocytes in {lambda}5-deficient mice can be restored by premature expression of a productively rearranged {kappa}LC transgene (34, 35). This suggests that a conventional LC can replace the SLC, and thus argues against a pivotal role of the {lambda}5 unique tail in the clonal expansion of µHC-positive pre-B cells. However, the premature and constitutive expression of a transgenic {kappa}LC in all newly generated pre-B cells bypasses the developmental stage at which cells with unproductive LC genes are usually eliminated. Therefore, the increased survival of pre-B cells in {kappa}LC transgenic mice might compensate for their presumably inefficient clonal expansion. A conventional LC may thus, in analogy to the SLC lacking the {lambda}5 unique tail, trigger only survival and differentiation, but not proliferation signals, which is in agreement with our unified model for pre-BCR signal initiation (Fig. 8, left). A critical role for the SLC in enhancing pre-BCR-mediated proliferation signals (Fig. 8, right) is also supported by recent findings that the SLC, in contrast to a conventional {kappa}LC, can efficiently induce Ig{alpha} phosphorylation and Ca2+ signaling in µHC-positive pre-B cell lines (32, 33).

Most of the basic amino acid residues in the unique tail of {lambda}5 are conserved in humans, mice, rats, and rabbits (33, 56). This suggests that the pro-proliferative function of the {lambda}5 tail may have favored the asynchronous rearrangement of HC and LC genes during mammalian evolution, because random pairing of one HC with various LCs to increase Ab diversity requires that the clonal expansion of µHC-positive pre-B cells precedes LC gene rearrangements. In this view, the assembly of a µHC with the SLC replaces an older evolutionary state, when rearrangement of HC and LC genes still occurred simultaneously and before clonal expansion (57). In support of this idea, no orthologs for {lambda}5 and VpreB1/VpreB2 genes were identified in chickens, in which HC and LC gene loci are simultaneously rearranged during early embryonic development (58, 59). Chickens may not require SLC, since Ab diversity is generated predominantly by gene conversion in the bursa of Fabricius after the IgM-positive B lymphocyte population has been expanded (60). In contrast, the evolutionary emergence of VpreB and {lambda}5 together with the autoreactive {lambda}5 unique tail may have provided the mammalian immune system a mechanism to build up its primary Ab repertoire by increasing the combinatorial diversity in pre-B cells. In this evolutionary perspective, the SLC may represent an ancient autoreactive LC that was hard-wired in the genome to become an invariant component of the pre-BCR (61). In accordance with this hypothesis, the expression of SLC including its autoreactive {lambda}5 unique tail is tightly regulated and terminated by pre-BCR signals (44, 45), which resembles a mechanism of tolerance induction. Thus, the exclusive expression of SLC in early pre-B cells could ensure that transient autoreactivity can be exploited to select the primary Ab repertoire, while avoiding the generation of autoreactive B lymphocytes.


   Acknowledgments
 
We thank Johannes Lutz and Katy Schmidt for critical reading of the manuscript, Maureen Grady for proofreading, and Dennis Castor, Rita Spannenberger, and Regina Vogelbacher for help in constructing vectors.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflicts of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was financed in part by the Interdisciplinary Center for Clinical Research (IZKF), the research Grants SFB466 and FOR832 (JA968/4) from the Deutsche Forschungsgemeinschaft (DFG) to H.-M.J.; the stipend of K.H. was supported by an intramural ELAN grant and the DFG training Grant GK592. Back

2 Address correspondence and reprint requests to Dr. Hans-Martin Jäck, Division of Molecular Immunology, University of Erlangen-Nürnberg, Glückstrasse 6, D-91054 Erlangen, Germany. E-mail address: hjaeck{at}molmed.uni-erlangen.de Back

3 Abbreviations used in this paper: HC, H chain; h, human; LC, L chain; LCR, locus control region; µHC, Igµ H chain; m, murine; PI, propidium iodide; pre-, precursor; pro-, progenitor; RPE, R-phycoerithrin; SLC, surrogate L chain; U, unique tail; wt, wild type. Back

Received for publication December 11, 2007. Accepted for publication June 26, 2008.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Kudo, A., F. Melchers. 1987. A second gene, VpreB in the lambda 5 locus of the mouse, which appears to be selectively expressed in pre-B lymphocytes. EMBO J. 6: 2267-2272. [Medline]
  2. Pillai, S., D. Baltimore. 1987. Formation of disulphide-linked µ2{omega}2 tetramers in pre-B cells by the 18K{omega}-immunoglobulin light chain. Nature 329: 172-174. [Medline]
  3. Sakaguchi, N., F. Melchers. 1986. {lambda}5, a new light-chain-related locus selectively expressed in pre-B lymphocytes. Nature 324: 579-582. [Medline]
  4. Tsubata, T., M. Reth. 1990. The products of pre-B cell-specific genes (lambda 5 and VpreB) and the immunoglobulin mu chain form a complex that is transported onto the cell surface. J. Exp. Med. 172: 973-976. [Abstract/Free Full Text]
  5. Burrows, P. D., R. P. Stephan, Y. H. Wang, K. Lassoued, Z. Zhang, M. D. Cooper. 2002. The transient expression of pre-B cell receptors governs B cell development. Semin. Immunol. 14: 343-349. [Medline]
  6. Vettermann, C., K. Herrmann, H. M. Jäck. 2006. Powered by pairing: the surrogate light chain amplifies immunoglobulin heavy chain signaling and pre-selects the antibody repertoire. Semin. Immunol. 18: 44-55. [Medline]
  7. Hess, J., A. Werner, T. Wirth, F. Melchers, H. M. Jäck, T. H. Winkler. 2001. Induction of pre-B cell proliferation after de novo synthesis of the pre-B cell receptor. Proc. Natl. Acad. Sci. USA 98: 1745-1750. [Abstract/Free Full Text]
  8. Kline, G. H., L. Hartwell, G. B. Beck-Engeser, U. Keyna, S. Zaharevitz, N. R. Klinman, H. M. Jäck. 1998. Pre-B cell receptor-mediated selection of pre-B cells synthesizing functional µ heavy chains. J. Immunol. 161: 1608-1618. [Abstract/Free Full Text]
  9. Rolink, A. G., T. Winkler, F. Melchers, J. Andersson. 2000. Precursor B cell receptor-dependent B cell proliferation and differentiation does not require the bone marrow or fetal liver environment. J. Exp. Med. 191: 23-32. [Abstract/Free Full Text]
  10. Keyna, U., G. B. Beck-Engeser, J. Jongstra, S. E. Applequist, H. M. Jäck. 1995. Surrogate light chain-dependent selection of Ig heavy chain V regions. J. Immunol. 155: 5536-5542. [Abstract]
  11. Melchers, F.. 2005. The pre-B-cell receptor: selector of fitting immunoglobulin heavy chains for the B-cell repertoire. Nat. Rev. Immunol. 5: 578-584. [Medline]
  12. ten Boekel, E., F. Melchers, A. G. Rolink. 1997. Changes in the VH gene repertoire of developing precursor B lymphocytes in mouse bone marrow mediated by the pre-B cell receptor. Immunity 7: 357-368. [Medline]
  13. Corcos, D., O. Dunda, C. Butor, J. Y. Cesbron, P. Lores, D. Bucchini, J. Jami. 1995. Pre-B-cell development in the absence of {lambda}5 in transgenic mice expressing a heavy-chain disease protein. Curr. Biol. 5: 1140-1148. [Medline]
  14. Kitamura, D., A. Kudo, S. Schaal, W. Muller, F. Melchers, K. Rajewsky. 1992. A critical role of lambda 5 protein in B cell development. Cell 69: 823-831. [Medline]
  15. Kitamura, D., J. Roes, R. Kuhn, K. Rajewsky. 1991. A B cell-deficient mouse by targeted disruption of the membrane exon of the immunoglobulin µ chain gene. Nature 350: 423-426. [Medline]
  16. Muljo, S. A., M. S. Schlissel. 2002. The variable, CH1, CH2 and CH3 domains of Ig heavy chain are dispensable for pre-BCR function in transgenic mice. Int. Immunol. 14: 577-584. [Abstract/Free Full Text]
  17. Mundt, C., S. Licence, T. Shimizu, F. Melchers, I. L. Martensson. 2001. Loss of precursor B cell expansion but not allelic exclusion in VpreB1/VpreB2 double-deficient mice. J. Exp. Med. 193: 435-445. [Abstract/Free Full Text]
  18. Shaffer, A. L., M. S. Schlissel. 1997. A truncated heavy chain protein relieves the requirement for surrogate light chains in early B cell development. J. Immunol. 159: 1265-1275. [Abstract]
  19. Shimizu, T., C. Mundt, S. Licence, F. Melchers, I. L. Martensson. 2002. VpreB1/VpreB2/{lambda}5 triple-deficient mice show impaired B cell development but functional allelic exclusion of the IgH locus. J. Immunol. 168: 6286-6293. [Abstract/Free Full Text]
  20. Papavasiliou, F., Z. Misulovin, H. Suh, M. C. Nussenzweig. 1995. The role of Igβ in precursor B cell transition and allelic exclusion. Science 268: 408-411. [Abstract/Free Full Text]
  21. Galler, G. R., C. Mundt, M. Parker, R. Pelanda, I. L. Martensson, T. H. Winkler. 2004. Surface µ heavy chain signals down-regulation of the V(D)J-recombinase machinery in the absence of surrogate light chain components. J. Exp. Med. 199: 1523-1532. [Abstract/Free Full Text]
  22. Schuh, W., S. Meister, E. Roth, H. M. Jäck. 2003. Cutting edge: Signaling and cell surface expression of a µ H chain in the absence of {lambda}5: a paradigm revisited. J. Immunol. 171: 3343-3347. [Abstract/Free Full Text]
  23. Guelpa-Fonlupt, V., D. Bossy, P. Alzari, F. Fumoux, M. Fougereau, C. Schiff. 1994. The human pre-B cell receptor: structural constraints for a tentative model of the pseudo-light (psi L) chain. Mol. Immunol. 31: 1099-1108. [Medline]
  24. Minegishi, Y., L. M. Hendershot, M. E. Conley. 1999. Novel mechanisms control the folding and assembly of {lambda}5/14.1 and VpreB to produce an intact surrogate light chain. Proc. Natl. Acad. Sci. USA 96: 3041-3046. [Abstract/Free Full Text]
  25. Bankovich, A. J., S. Raunser, Z. S. Juo, T. Walz, M. M. Davis, K. C. Garcia. 2007. Structural insight into pre-B cell receptor function. Science 316: 291-294. [Abstract/Free Full Text]
  26. Lanig, H., H. Bradl, H. M. Jäck. 2004. Three-dimensional modeling of a pre-B-cell receptor. Mol. Immunol. 40: 1263-1272. [Medline]
  27. Melchers, F.. 1999. Fit for life in the immune system? Surrogate L chain tests H chains that test L chains. Proc. Natl. Acad. Sci. USA 96: 2571-2573. [Free Full Text]
  28. Gauthier, L., B. Rossi, F. Roux, E. Termine, C. Schiff. 2002. Galectin-1 is a stromal cell ligand of the pre-B cell receptor (BCR) implicated in synapse formation between pre-B and stromal cells and in pre-BCR triggering. Proc. Natl. Acad. Sci. USA 99: 13014-13019. [Abstract/Free Full Text]
  29. Bradl, H., H. M. Jäck. 2001. Surrogate light chain-mediated interaction of a soluble pre-B cell receptor with adherent cell lines. J. Immunol. 167: 6403-6411. [Abstract/Free Full Text]
  30. Bradl, H., J. Wittmann, D. Milius, C. Vettermann, H. M. Jäck. 2003. Interaction of murine precursor B cell receptor with stroma cells is controlled by the unique tail of {lambda}5 and stroma cell-associated heparan sulfate. J. Immunol. 171: 2338-2348. [Abstract/Free Full Text]
  31. Guloglu, F. B., E. Bajor, B. P. Smith, C. A. Roman. 2005. The unique region of surrogate light chain component {lambda}5 is a heavy chain-specific regulator of precursor B cell receptor signaling. J. Immunol. 175: 358-366. [Abstract/Free Full Text]
  32. Meixlsperger, S., F. Kohler, T. Wossning, M. Reppel, M. Muschen, H. Jumaa. 2007. Conventional light chains inhibit the autonomous signaling capacity of the B cell receptor. Immunity 26: 323-333. [Medline]
  33. Ohnishi, K., F. Melchers. 2003. The nonimmunoglobulin portion of {lambda}5 mediates cell-autonomous pre-B cell receptor signaling. Nat. Immunol. 4: 849-856. [Medline]
  34. Papavasiliou, F., M. Jankovic, M. C. Nussenzweig. 1996. Surrogate or conventional light chains are required for membrane immunoglobulin µ to activate the precursor B cell transition. J. Exp. Med. 184: 2025-2030. [Abstract/Free Full Text]
  35. Pelanda, R., S. Schaal, R. M. Torres, K. Rajewsky. 1996. A prematurely expressed Ig{kappa} transgene, but not V{kappa}J{kappa} gene segment targeted into the Ig{kappa} locus, can rescue B cell development in {lambda}5-deficient mice. Immunity 5: 229-239. [Medline]
  36. Shinkai, Y., G. Rathbun, K. P. Lam, E. M. Oltz, V. Stewart, M. Mendelsohn, J. Charron, M. Datta, F. Young, A. M. Stall, et al 1992. RAG-2-deficient mice lack mature lymphocytes owing to inability to initiate VDJ rearrangement. Cell 68: 855-867. [Medline]
  37. Cascalho, M., A. Ma, S. Lee, L. Masat, M. Wabl. 1996. A quasi-monoclonal mouse. Science 272: 1649-1652. [Abstract]
  38. Vettermann, C., J. Lutz, M. Selg, M. Bösl, H. M. Jäck. 2006. Genomic suppression of murine B29/Ig-β promoter-driven transgenes. Eur. J. Immunol. 36: 3324-3333. [Medline]
  39. Martin, D. A., L. Lu, M. Cascalho, G. E. Wu. 2007. Maintenance of surrogate light chain expression induces developmental delay in early B cell compartment. J. Immunol. 179: 4996-5005. [Abstract/Free Full Text]
  40. Yang, J., M. A. Glozak, B. B. Blomberg. 1995. Identification and localization of a developmental stage-specific promoter activity from the murine {lambda}5 gene. J. Immunol. 155: 2498-2514. [Abstract]
  41. Sabbattini, P., A. Georgiou, C. Sinclair, N. Dillon. 1999. Analysis of mice with single and multiple copies of transgenes reveals a novel arrangement for the {lambda}5-VpreB1 locus control region. Mol. Cell. Biol. 19: 671-679. [Abstract/Free Full Text]
  42. Vettermann, C., H. M. Jäck, D. Mielenz. 2002. A colloidal silver staining-destaining method for precise assignment of immunoreactive spots in two-dimensional protein patterns. Anal. Biochem. 308: 381-387. [Medline]
  43. Winkler, T. H., A. Rolink, F. Melchers, H. Karasuyama. 1995. Precursor B cells of mouse bone marrow express two different complexes with the surrogate light chain on the surface. Eur. J. Immunol. 25: 446-450. [Medline]
  44. Parker, M. J., S. Licence, L. Erlandsson, G. R. Galler, L. Chakalova, C. S. Osborne, G. Morgan, P. Fraser, H. Jumaa, T. H. Winkler, et al 2005. The pre-B-cell receptor induces silencing of VpreB and {lambda}5 transcription. EMBO J. 24: 3895-3905. [Medline]
  45. Sabbattini, P., M. Lundgren, A. Georgiou, C. Chow, G. Warnes, N. Dillon. 2001. Binding of Ikaros to the {lambda}5 promoter silences transcription through a mechanism that does not require heterochromatin formation. EMBO J. 20: 2812-2822. [Medline]
  46. Raff, M. C., M. Megson, J. J. Owen, M. D. Cooper. 1976. Early production of intracellular IgM by B-lymphocyte precursors in mouse. Nature 259: 224-226. [Medline]
  47. Tsubata, T., R. Tsubata, M. Reth. 1992. Crosslinking of the cell surface immunoglobulin (µ-surrogate light chains complex) on pre-B cells induces activation of V gene rearrangements at the immunoglobulin {kappa} locus. Int. Immunol. 4: 637-641. [Abstract/Free Full Text]
  48. Haas, I. G., M. Wabl. 1983. Immunoglobulin heavy chain binding protein. Nature 306: 387-389. [Medline]
  49. Yamasaki, S., T. Saito. 2007. Molecular basis for pre-TCR-mediated autonomous signaling. Trends Immunol. 28: 39-43. [Medline]
  50. Espeli, M., B. Rossi, S. J. Mancini, P. Roche, L. Gauthier, C. Schiff. 2006. Initiation of pre-B cell receptor signaling: common and distinctive features in human and mouse. Semin. Immunol. 18: 56-66. [Medline]
  51. Milne, C. D., S. A. Corfe, C. J. Paige. 2008. Heparan sulfate and heparin enhance ERK phosphorylation and mediate preBCR-dependent events during B lymphopoiesis. J. Immunol. 180: 2839-2847. [Abstract/Free Full Text]
  52. Rossi, B., M. Espeli, C. Schiff, L. Gauthier. 2006. Clustering of pre-B cell integrins induces galectin-1-dependent pre-B cell receptor relocalization and activation. J. Immunol. 177: 796-803. [Abstract/Free Full Text]
  53. de Fougerolles, A. R., F. Batista, E. Johnsson, D. T. Fearon. 2001. IgM and stromal cell-associated heparan sulfate/heparin as complement-independent ligands for CD19. Eur. J. Immunol. 31: 2189-2199. [Medline]
  54. Krop, I., A. L. Shaffer, D. T. Fearon, M. S. Schlissel. 1996. The signaling activity of murine CD19 is regulated during cell development. J. Immunol. 157: 48-56. [Abstract]
  55. Monroe, J. G.. 2006. ITAM-mediated tonic signalling through pre-BCR and BCR complexes. Nat. Rev. Immunol. 6: 283-294. [Medline]
  56. Jasper, P. J., S. K. Zhai, S. L. Kalis, M. Kingzette, K. L. Knight. 2003. B lymphocyte development in rabbit: progenitor B cells and waning of B lymphopoiesis. J. Immunol. 171: 6372-6380. [Abstract/Free Full Text]
  57. Pelanda, R., S. Schwers, E. Sonoda, R. M. Torres, D. Nemazee, K. Rajewsky. 1997. Receptor editing in a transgenic mouse model: site, efficiency, and role in B cell tolerance and antibody diversification. Immunity 7: 765-775. [Medline]
  58. Rosnet, O., C. Blanco-Betancourt, K. Grivel, K. Richter, C. Schiff. 2004. Binding of free immunoglobulin light chains to VpreB3 inhibits their maturation and secretion in chicken B cells. J. Biol. Chem. 279: 10228-10236. [Abstract/Free Full Text]
  59. Reynaud, C. A., B. A. Imhof, V. Anquez, J. C. Weill. 1992. Emergence of committed B lymphoid progenitors in the developing chicken embryo. EMBO J. 11: 4349-4358. [Medline]
  60. Ratcliffe, M. J.. 2006. Antibodies, immunoglobulin genes and the bursa of Fabricius in chicken B cell development. Dev. Comp. Immunol. 30: 101-118. [Medline]
  61. van Loo, P. F., G. M. Dingjan, A. Maas, R. W. Hendriks. 2007. Surrogate-light-chain silencing is not critical for the limitation of pre-B cell expansion but is for the termination of constitutive signaling. Immunity 27: 468-480. [Medline]

Related articles in The JI:

IN THIS ISSUE

The JI 2008 181: 2939-2940. [Full Text]  



This article has been cited by other articles:


Home page
 BloodHome page
M. Espeli, S. J. C. Mancini, C. Breton, F. Poirier, and C. Schiff
Impaired B-cell development at the pre-BII-cell stage in galectin-1-deficient mice due to inefficient pre-BII/stromal cell interactions
Blood, June 4, 2009; 113(23): 5878 - 5886.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vettermann, C.
Right arrow Articles by Jäck, H.-M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vettermann, C.
Right arrow Articles by Jäck, H.-M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS