The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

The Journal of Immunology, 2008, 181, 1710 -1716
Copyright © 2008 by The American Association of Immunologists, Inc.
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kisielow, J.
Right arrow Articles by Karjalainen, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kisielow, J.
Right arrow Articles by Karjalainen, K.

SCART Scavenger Receptors Identify a Novel Subset of Adult {gamma}{delta} T Cells1

Jan Kisielow2,*, Manfred Kopf* and Klaus Karjalainen{dagger}

* Molecular Biomedicine, Institute of Integrative Biology, Swiss Federal Institute of Technology (ETH), Zürich-Schlieren, Switzerland and {dagger} Nanyang Technological University, School of Biological Sciences, Singapore


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Although there has been great progress in the characterization of {alpha}β T cell differentiation, selection, and function, {gamma}{delta} T cells have remained poorly understood. One of the main reasons for this is the lack of {gamma}{delta} T cell-specific surface markers other than the TCR chains themselves. In this study we describe two novel surface receptors, SCART1 and SCART2. SCARTs are related to CD5, CD6, and CD163 scavenger receptors but, unlike them, are found primarily on developing and mature {gamma}{delta} T cells. Characterization of SCART2 positive immature and peripheral {gamma}{delta} T cells suggests that they undergo lineage specification in the thymus and belong to a new IL-17-producing subset with distinct homing capabilities.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
T lymphocytes are composed of two main lineages, the {alpha}β and the {gamma}{delta} cells. Both of them exist in all vertebrates; however, their ratio changes dramatically depending on the organism and tissue studied. Whereas in cattle and sheep the {gamma}{delta} lineage predominates, in humans and rodents {alpha}β T cells are much more common. Only ~1–5% of total T cells in peripheral lymphoid organs are {gamma}{delta} T cells; however, in some tissues {gamma}{delta} T cells can represent 20–50% of lymphoid cells and carry out protective and immunoregulatory functions (1, 2, 3, 4, 5). Most of these {gamma}{delta} T cells develop during fetal life and use "canonical" TCRs. Their very restricted repertoire is thought to enable them to respond quickly to foreign Ags or tissue stress and act as the first line of defense. In contrast, {gamma}{delta} cells developing postnatally carry mainly V{gamma}1+ and V{gamma}4+ TCRs that comprise a much wider repertoire and give rise to the systemic {gamma}{delta} T cells (6).

Although some progress has been made in the understanding of the fetal {gamma}{delta} T cell development, especially that of the V{gamma}5V{delta}1+ dendritic epidermal T cells (DETC)3 (7), the differentiation and function of adult {gamma}{delta} T cells remain scarcely characterized.

Both {alpha}β and {gamma}{delta} T cells arise from bone marrow-derived precursors that continuously seed the thymus. The earliest T cell precursors can be found in the CD4–CD8– double negative (DN) compartment in the cKit+CD44+CD25– DN1 population. During maturation, as these precursors traverse the DN2 and DN3 stages, they gradually acquire CD25 and loose the cKit and CD44 molecules from their surface. After expansion in the cKit+CD44+CD25+ DN2 stage, cells stop dividing and rearrange the {gamma}, {delta}, and β TCR loci. This happens mainly in the cKit–CD44–CD25+ DN3 stage (8), even though some rearrangement can be detected earlier (9). Around this stage the {alpha}β and {gamma}{delta} lineages diverge. Although it has been shown that the DN2, DN3, and DN4 stages contain {gamma}{delta} precursors, the precise maturation pathway of the {gamma}{delta} T cells is still under intense investigation (10).

Rearranged TCR genes and their protein products are required for the development of T cells, but whether the TCRβ, {gamma},or {delta} play instructive or selective roles in the lineage development is still under debate. In fact, both {alpha}β and {gamma}{delta} TCRs can substitute for each other and support, to some extent, the development of the "wrong" lineage, which is incompatible with both the instructive and the stochastic model. Recently, TCR signal strength alone or in combination with Notch1 signaling was proposed to drive differentially {alpha}β and {gamma}{delta} lineage development (11, 12, 13, 14).

It is unclear how, if at all, adult {gamma}{delta} T cells are selected in the thymus. In contrast to the {alpha}β T cells, where the MHC molecules play a central role, the {gamma}{delta} T cell development is largely MHC class I- and class II-independent (15, 16). Apart from a few exceptions, like the nonclassical MHC class I molecules T10 and T22 (17), the ligands for the majority of adult {gamma}{delta} T cells have not been identified. Interestingly, structural analyses have suggested that Ag recognition by {gamma}{delta} TCRs resembles that of Abs rather than that of {alpha}β TCRs (18) and, indeed, many of the {gamma}{delta} T cells do not require processing and can recognize Ags in the native form (19).

Two checkpoints have been proposed to operate during {gamma}{delta} T cell development. During the first one, at the DN3 stage, the appearance of a functional {gamma}{delta} TCR is accompanied by the expression of CD5. When TCR signaling is disrupted, e.g., in the absence of LAT (linker for activation of T cells), {gamma}{delta} thymocytes are blocked at the CD5–TCRlow DN3 stage (20). The second checkpoint, positive selection on thymic stromal cells, has to date been shown only for the DETCs of the skin (7). Similar to the selection of double positive (DP) cells, during DETC-positive selection CD45RB is up-regulated and heat-stable Ag (HSA) is down-regulated; however in contrast to DP selection, CD5 is down-regulated (21, 22, 23). Consistently, in a genetic variant of the FVB/N strain that lacks normal DETCs, precursors are blocked at the immature HSAhighCD45RBlow stage and do not leave the thymus (7). However, in adult mice many {gamma}{delta} thymocytes are exported as HSAhigh immature cells (24). At present, it is unknown whether these cells undergo positive selection before export. In the periphery, these recent thymic emigrants (RTEs) mature to become HSA–CD62LhighCD45RBhigh naive cells, many of which acquire an activated/memory phenotype (HSA–CD44highCD45RBlow) that is probably driven by the recognition of environmental Ags (25). Taken together, it is clear that {gamma}{delta} T cells follow a different path of development than {alpha}β T cells, but precisely how different remains to be characterized.

In this article we describe two scavenger receptors (SCART1 and SCART2) that are expressed on a subset of developing and mature {gamma}{delta} T cells but not on conventional {alpha}β T cells. As discussed below, SCARTs have given us a new handle to characterize the developmental paths and potential selection events of a new functional subset of mouse adult {gamma}{delta} T cells.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Mice and cell lines

C57BL/6, RAG knock-out (KO) C57BL/6, TCR7, SMARTA, DO11.10, and HY mice were bred at BioSupport or purchased from Charles River. OT-I and HA mice were on RAG KO background and kindly provided by Dr. J. Kirberg, Max-Planck Institute, Freiburg, Germany. The BEKO cell line is a thymoma derived from TCRβ deficient mice isolated in our laboratory.

Generation of the subtractive cDNA library

A cDNA library was made from B6 RAG KO thymi in the pBluescript vector and converted into a ssDNA library with M13 phage (26). The library was hybridized with sscDNA made from the cell lines K46, A20, and WEHI-3. The hybrids were removed with hydroxyapatite. After five rounds of enrichment, individual clones from the resulting subtractive cDNA library were sequenced and analyzed by basic local alignment search tool (BLAST) searches.

Semiquantitative PCR

Total RNA was extracted from sorted cells using TRIzol (Invitrogen). cDNA was generated using SuperScript III (Invitrogen) according to manufacturer’s instruction.

RT-PCR was done using Taq polymerase and standard protocols. Thermal cycling conditions were 2 min at 95°C followed by 30–32 cycles of 95°C for 30 s, 56°C for 20 s, and 72°C for 1 min. The cDNA was normalized to β-actin and/or hypoxanthine phosphoribosyltransferase. The oligonucleotides used were as follows: SCART1, CAGCTCCTATTTTCAGGAGAG (5') and CAGGCCAGCTCCAGAAGAA (3'); SCART2, GGTTGGCAGCGGGTAAGAAC (5') and AATCGTAGACGAGCCCCTT (3'); and IL-17, AGCTTCCCAGATCACAGAGG (5') and GCAAAAGTGAGCTCCAGAAGG (3').

Real-time PCR analysis

Real-time PCR was made by MyiQ real-time PCR detection system (Bio-Rad) using SYBR Green (Stratagene) and the following gene-specific primers for SCART2: CCCTCAGAGGTTGTCTATGAA (5') and CATAATCCTCATCCTGCACTG (3'). The thermal cycling conditions were 8 min at 95°C followed by 45 cycles of 95°C for 20s and 60°C for 1 min. Gene expression was normalized to β-actin and expressed in arbitrary units.

Cloning of SCART2 EGFP bicistronic retroviral construct and BEKO infection

Full-length SCART2 was cloned by RT-PCR into p123T (MoBiTec), sequenced, and recloned into the pMYiresGFP retroviral vector (27). Retrovirus-containing supernatant was produced in Ecotropic Phoenix packaging cells and used to infect the BEKO cell line.

Antibodies

Anti-SCART2 polyclonal serum was produced in rats by immunization with purified recombinant protein composed of the three most N-terminal scavenger receptor cysteine-rich (SRCR) domains fused to the human Fc{gamma}1 region. As a secondary reagent for SCART2 staining, PE- or allophycocyanin-labeled donkey anti-rat IgG(H+L)-F(ab')2 purchased from eBioscience was used. All other Abs and streptavidin were purchased from BD Pharmingen or eBioscience.

Cell preparation, flow cytometry, and cell sorting

Single-cell suspensions from the thymus, spleen, and lymph nodes (LNs) were made by pressing through a nylon mesh in PBS with 2% FCS. To enrich DN thymocytes and {gamma}{delta} T cells, CD4+ and CD8+ cells were depleted using Low-Tox rabbit complement (Cedarlane Laboratories). All of the subpopulations were sorted on a FACSAria or a FACSVantage cell sorter (BD Bioscience) to a >95% purity. Conventional and nonconventional (CD4–CD8–) {alpha}β, {gamma}{delta}, and non-T cells were sorted from CD4, CD8,TCRβ, and TCR{delta} staining. To obtain DN thymocytes, subpopulations of total thymocytes were depleted of CD4- and CD8-expressing cells and sorted according to CD25, CD44/c-Kit, and {gamma}{delta}TCR expression. To detect SCART2, cells were stained first with SCART2-specific rat antiserum and then with labeled donkey anti-rat IgG F(ab')2, washed, and blocked extensively with normal rat serum. Then all of the additional stainings were performed.

Expression of markers was analyzed by flow cytometry on a FACSCalibur instrument (BD Biosciences) and the data were analyzed by FlowJo (Tree Star). Statistical analysis was done using Prism 4.0 (GraphPad Software). Cells were cultured in IMDM with 2%FCS and 0.03% Primatone RL/LF (Quest International).

Intracelluar staining for IL-17

For IL-17 intracellular staining, freshly isolated LN cells were stimulated for 2 h with 0.1 µM PMA and 1 µg/ml ionomycin in the presence of 2 µM monensin, stained first for surface markers, fixed with 2% PFA, and stained with anti-IL-17 mAb or isotype control in the presence of 0.5% saponin.

Cell preparation from epidermal and dermal sheets

Ear skin was separated into dorsal and ventral sides and placed in PBS containing 10 mM EDTA at 37°C for 30 min. The skin epidermal and dermal sheets were separated, washed with PBS containing 2 mM CaCl2, and digested with collagenase for 1 h. Cells were washed with PBS and stained with the indicated monoclonal abs. In control stainings, rat normal serum and second step Abs only were used. The FACS analysis was performed through a "lymphocyte" gate.

In vitro TCR stimulation

Cells were stimulated for 2.5 days in tissue culture plates coated with anti-CD3 (2C11) and anti-CD28 (37.51) mAbs (2 mg/ml each) plus IL-2. As an IL-2 source, supernatant from an X63 line producing rIL-2 was used.

Gene sequence accession numbers are as follows: WC1.1, NM_176651 (GenBank); bovine SCART, ENSBTAT00000013918 (Ensembl transcript identifier); SCART1, identical with AK088010 (European Molecular Biology Laboratory); SCART2, EF624462 (European Molecular Biology Laboratory).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
SCART1 and SCART2 are novel scavenger receptors expressed in {gamma}{delta} T cells

The cDNA clone encoding a novel T cell-specific transcript was found in a subtractive cDNA library generated from RAG KO mouse thymus. GenBank search located the sequence in the 5'UTR of a novel gene encoding a putative scavenger receptor like protein on the mouse chromosome 7 (AK088010). Closer inspection of the genomic region revealed a second gene located downstream encoding a very similar protein. These two novel genes were named scart1 and scart2. The sequences of SCART1 and SCART2 proteins had an arrangement of cysteines typical for a SRCR domain (Fig. 1A), and the predicted protein structures showed eight or nine such domains (depending on the splice variant), a transmembrane region, and an intracellular domain (Fig. 1, A and B). Further structural comparisons placed these proteins in the scavenger receptor superfamily group B together with CD5, CD6, and CD163. Sequence homology searches showed significant homology to WC1.1 (also called CD163L1), a {gamma}{delta} T cell specific protein found only in cattle and sheep (28). In addition, a novel bovine expressed sequence tag (EST) encoding a putative protein with even higher homology to SCART1 and 2 (bovine SCART (BoSCART); Fig. 1, A and C) was found, indicating that SCARTs do not represent WC1 mouse orthologs but novel scavenger receptor superfamily members.


Figure 1
View larger version (53K):
[in this window]
[in a new window]

  		FIGURE 1. SCART1 and SCART2 represent new scavenger receptors expressed mainly by {gamma}{delta} T cells. A, Alignment of protein sequences of SCART1 and SCART2 with a bovine EST (BoSCART) and bovine WC1.1 (BoWC1.1). Only the first and most membrane proximal SRCR domains, the transmembrane region, and the intracellular domain are shown. Identical amino acids are marked with a black dot, similar ones with a bar, and the cysteines characteristic for SRCR domain are highlighted in gray. The predicted transmembrane region is marked with a box. B, Schematic structures of SCART1 and SCART2 together with CD5, CD6, and WC1.1. C, An estimate of SCART phylogeny. Branch lengths are proportional to the amount of inferred evolutionary change (Clustal). D, Semiquantitative RT-PCR analysis of SCART1 (sc1) and SCART2 (sc2) and β-actin (β-act) expression in various tissues. cDNA dilutions are indicated below the pictures. The star marks a background band. E, Semiquantitative RT-PCR analysis of SCART1 (sc1) and SCART2 (sc2) expression in sorted {gamma}{delta}, {alpha}β, and non-T cells from peripheral LNs. F, Real-time PCR quantification of SCART2 mRNA expression in sorted conventional (CD4+ and CD8+) {alpha}β T cells, non-T cells, nonconventional CD4–CD8– {alpha}β T cells (DN{alpha}β), and {gamma}{delta} T cells from peripheral LNs. Gene expression was normalized to β-actin and expressed in arbitrary units (AU).

 
RT-PCR analysis of cDNAs from mouse tissues revealed that scart1 and scart2 were expressed very highly in the thymus and the LN and to a lower extent in the spleen and lung (Fig. 1D). Detailed analysis of sorted peripheral LN cells showed that SCARTs were particularly abundant in {gamma}{delta} T cells (Fig. 1, E and F). Little expression was found in {alpha}β T cells and was confined to the nonconventional CD4–CD8– {alpha}β T cells (Fig. 1F).

Because the expression patterns of scart1 and scart2 were identical, in this study we concentrated on the analysis of SCART2. First, a polyclonal antiserum against SCART2 was generated in rats. The specificity of this antiserum was then tested on a thymoma transduced with a bicistronic retroviral construct allowing simultaneous expression of SCART2 and enhanced GFP (EGFP). As shown in Fig. 2A, GFP+ (expressing SCART2) cells showed positive staining with SCART2 serum. Normal rat serum and serum from rats immunized with an irrelevant Ag showed no positive staining. Importantly, SCART2 serum stained specifically {gamma}{delta} T cells from the thymus and LN (Fig. 2A). In the thymus it also stained DN3 pre-T cells (discussed below).


Figure 2
View larger version (30K):
[in this window]
[in a new window]

  		FIGURE 2. SCARTs define a novel {gamma}{delta} T cell subset present in the peripheral LNs. A, Characterization of the SCART2-specific polyclonal rat antiserum. Left dot plots show SCART2 antiserum (top) and irrelevant rat antiserum (IRS) (bottom) stainings on BEKO thymoma transduced with a bicistronic construct encoding SCART2 and GFP. Middle and right dot plots show SCART2 and irrelevant rat antiserum vs {gamma}{delta}TCR staining of the thymus and peripheral LN cells (pLN) respectively. B, SCART2-staining profile of {gamma}{delta} T cells from the mesenteric (filled gray) and inguinal (black line) LNs. C and D, CD5/SCART2 (C) and V{gamma}4/SCART2 (D) staining of {gamma}{delta} T cells from inguinal LNs, respectively. E, CD44/CD62L and CD45RB/HSA stainings of SCART2–, SCART2low (lo), and SCART2high (hi) {gamma}{delta} T cells from inguinal LNs. Results are representative of multiple experiments.

 
SCART2 identifies a new {gamma}{delta} T cell subset homing to the peripheral LN and dermis

Detailed FACS analysis of SCART2 surface staining indicated high expression levels on thymocytes (see below) and LN cells. Interestingly, SCART2high {gamma}{delta} T cells were detected in the skin-draining LNs but not in the mesenteric LNs or spleen, where only SCART2– and SCART2low cell could be found (Fig. 2B and data not shown). In naive mice SCART2high cells usually constituted between 5 and 10% of the peripheral LN {gamma}{delta} T cells (Fig. 2B). Further analysis revealed that SCART2low cells contained mainly HSA+CD45RBintCD62L+CD44– RTEs (where int indicates "intermediate"). In contrast, SCART2high and SCART2– cells were a mixture of RTEs, HSA–CD45RBhigh naive cells and HSA–CD45RBlowCD62L–CD44high activated/memory cells, with SCARThigh cells being heavily enriched for activated/memory cells (Fig. 2E) Notably, SCART2high {gamma}{delta} T cells represented a discrete CD5low subpopulation and were dramatically enriched for V{gamma}4 TCRs (Fig. 2, C and D). Consistent with their exclusive presence in the peripheral LNs, SCART2high {gamma}{delta} T cells were found in the skin (Fig. 3). But, in contrast to the most prominent skin {gamma}{delta} T cell population, the DETCs, they resided in the dermis (Fig. 3, A and B) and were V{gamma}5 negative (Fig. 3C). Moreover, they represented >20% of all dermal {gamma}{delta} T cells (Fig. 3D). All this suggested that SCART2high cells represented a distinct subset of {gamma}{delta} T cells that, upon thymic emigration, rapidly acquired an activated/memory phenotype probably driven by Ag recognition in the skin. In fact, this subset could be distinguished already during thymic {gamma}{delta} differentiation.


Figure 3
View larger version (31K):
[in this window]
[in a new window]

  		FIGURE 3. SCART2+ {gamma}{delta} T cell localization in the skin. A, SCART2 and {gamma}{delta}TCR stainings of dermal and epidermal cells from wild-type (WT) and RAG KO mouse ears. B, Immunohistological staining of epidermal and dermal sheets from the mouse ear with SCART2 antiserum. C, SCART2 and {gamma}{delta}TCR or V{gamma}5 TCR staining of dermal cells from wild-type mouse ears. D, Scatter plot of the percentage SCART2+ cells among dermal {gamma}{delta} T cells from 4 B6 mice. Results are representative of at least two independent experiments.

 
Thymic lineage specification of SCART2high {gamma}{delta} T cells

In the thymus, similar to the LNs, SCART2 mRNA was highly expressed in {gamma}{delta} T cells. Lower levels were found in DN3 pre-T cells and nonconventional CD4–CD8– (DN) {alpha}β T cells (Fig. 4, A and B). SCART2 first appeared on the surface of precursor cells that transit from the DN2 to the DN3 stage, coinciding with the initiation of TCR rearrangements (Fig. 4C). However, the TCR was not required for scart2 gene expression because mRNA (data not shown) and protein surface expression was also observed in the thymuses of RAG KO mice (Fig. 4E). At the DN3 stage of WT mice, ~30% of the cells expressed variable levels of SCART2 (Fig. 4C). Later in development, SCART2 was either up-regulated in a subpopulation of cells developing toward the {gamma}{delta} lineage or eventually shut off in the remaining DN4 cells. Conventional DP and single-positive thymocytes were found to be SCART2 negative (Fig. 4, A–C).


Figure 4
View larger version (28K):
[in this window]
[in a new window]

  		FIGURE 4. Characterization of SCART2+ thymocytes and thymic {gamma}{delta} T cells. A, Semiquantitative RT-PCR analysis of SCART2 and β-actin (β-act) expression in sorted DN1, DN2, DN3, and TCR{gamma}{delta}+ or TCR{gamma}{delta}– DN4, as well as DP thymocytes. B, Real-time PCR quantification of SCART2 mRNA expression in sorted DN1, DN2, DN3, and DN4 subpopulations and thymic {gamma}{delta} T cells (left panel) and total DN, CD4+CD8+ (DP), CD4, CD8, nonconventional CD4–CD8– {alpha}β T cells (DN{alpha}β), and {gamma}{delta} T cells from the thymus (right panel). Gene expression was normalized to β-actin and expressed in arbitrary units (AU). C, Black line histograms depict SCART2 staining profiles of different thymocyte subpopulations defined according to the gates shown in the dot plots. Filled histograms represent irrelevant rat polyclonal antiserum. D, Expression profiles of CD5 and CD45RB and V{gamma}4 on SCART2– (gray histograms), SCART2low (dotted lines), and SCART2high (black lines) {gamma}{delta}TCR+ thymocytes. E, SCART2 vs CD25 staining of thymocytes from RAG-2-deficient mice. F, HSA/SCART2 staining of TCR{gamma}{delta}+ thymocytes. FACS staining is representative of multiple experiments. mRNA quantification was done twice independently by semiquantitative RT-PCR and once by real-time PCR.

 
Three subpopulations of {gamma}{delta} thymocytes could be discriminated based on SCART2 levels: high, low, and negative (Fig. 4D). Interestingly, all of these subpopulations differed in their surface expressions of CD5, CD45RB, and cell size. SCART2high {gamma}{delta} thymocytes, in contrast to SCART2– and SCART2low cells, were small and expressed lower levels of CD5 and CD45RB (Fig. 4D). SCART2low cells had variable levels of CD5 and evidently formed a transitional population that was not present in the mature HSAlow {gamma}{delta} thymocytes (Fig. 4F). In addition, SCART2high cells were enriched for V{gamma}4+ cells and SCART2– cells were enriched for V{gamma}4– cells, whereas SCART2low contained both populations (Fig. 4D).

Lineage-diverted DN TCR transgenic cells express high levels of SCART2

Another population of cells committed to the {gamma}{delta} lineage exists in {alpha}β TCR transgenic mice where, due to the early expression of the TCRs, exaggerated numbers of thymocytes are directed into the "wrong" {gamma}{delta} lineage (29). Surprisingly, in all of the {alpha}β TCR transgenic mice tested, including DO11.10, SMARTA, TCR7, OT-I, HA, and HY (Fig. 5A), the great majority of these lineage-deviated cells, were SCART2 positive. This observation suggested that early expressed transgenic {alpha}β TCR mimicked the signaling that allows the development of SCART2+ {gamma}{delta} thymocytes. However, most transgenic {alpha}β TCRs were not able to support full maturation of SCART2high lineage cells, as mature HSA–TCR+SCART2high T cells could not be found at the expected numbers or could not be found at all (Fig. 5A and data not shown). Interestingly, in the HY male mice, but not in female mice, a substantial proportion of mature (HSA–) SCART2– and SCART2low cells developed. The DO11.10 strain, in contrast, was permissive for the development of some HSA–TCR+SCART2high T cells. These results suggested that discrete TCR signals were required for the maturation of the SCART2high and SCART2– {gamma}{delta} lineages.


Figure 5
View larger version (33K):
[in this window]
[in a new window]

  		FIGURE 5. Discrete TCR signals are required for the development of SCART2high {gamma}{delta} thymocytes. A, SCART2 and HSA staining of {alpha}β TCR+ transgenic DN thymocytes. HY-f, HY female mice; HY-m, HY male mice. B, SCART2 and CD69 expression levels on in vitro anti-TCR stimulated, sorted SCART2+ (black line) or SCART2– (filled histogram) {gamma}{delta} thymocytes. Gray line represents SCART2 levels on sorted SCART2+ cells before stimulation, and dashed gray line represents negative control. C, SCART2 expression levels on sorted SCART2+ {gamma}{delta} thymocytes cultured without stimulation (black line) compared with cells before (gray dashed line) and after (filled histogram) in vitro anti-TCR stimulation. Results are representative of at least two independent experiments.

 
Strong TCR stimulation leads to SCART2 down-regulation

Because we hypothesized that stringent selection leads to SCART2high {gamma}{delta} lineage, potentially in a SCART2-dependent manner, we wanted to analyze whether experimental {gamma}{delta} TCR stimulation can regulate SCART2 levels in developing thymocytes. In vitro TCR stimulation has been used previously to successfully drive {gamma}{delta} thymocyte maturation (7). For this purpose, SCART2+ and SCART2– {gamma}{delta} cells from the thymus were sorted and subjected to anti-CD3/anti-CD28 stimulation in the presence of IL-2. Interestingly, in SCART2+ cells this treatment resulted in SCART2 down-regulation to almost undetectable levels, whereas SCART2– cells remained negative. Importantly, T cell activation markers were turned on equally well in both populations (see CD69 data in Fig. 5B; CD25 data not shown) and without TCR stimulation, SCART2 levels remained unchanged (Fig. 5C).

SCART2high {gamma}{delta} T cells can produce high amounts of IL-17 under "noninflamed" conditions

To shed some light on the functional capabilities of the SCART2high {gamma}{delta} T cells, cells from peripheral LNs of naive mice were tested for the production of several cytokines. Unexpectedly, high expression of IL-17 mRNA was found in the SCART2high {gamma}{delta} T cell subset (Fig. 6A). SCART2high {gamma}{delta} T cells not only expressed the mRNA but also produced high quantities of the IL-17 protein as measured by ELISA (not shown) and confirmed by intracellular staining (Fig. 6, B and C).


Figure 6
View larger version (10K):
[in this window]
[in a new window]

  		FIGURE 6. SCART2+ cells can produce high amounts of IL-17 under "noninflamed" conditions. A, RT-PCR analysis of IL-17 mRNA expression on sorted CD8+, CD4+, SCART2+, and SCART2– {gamma}{delta} T cells from peripheral LNs. FoxP3 and SCART2 mRNAs were used as controls B, Histograms represent intracellular staining for IL-17 protein on SCART2+ (black line) and SCART2– (dashed line) {gamma}{delta} T cells from peripheral LN. Filled histogram indicates staining with the isotype control. C, Scatter plot shows the percentage of IL-17+ cells among CD4+, SCART2–, and SCART2+ {gamma}{delta} T cells from four naive B6 mice; p < 0.0001. Results are representative of at least two independent experiments.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
{alpha}β and {gamma}{delta} T cells are the two main T cell lineages that develop in the thymus. There has been a great advance in the understanding of the development and function of {alpha}β T cells, but not of the {gamma}{delta} lineage. One of the main problems that hampered the description of the {gamma}{delta} lineage development was the lack of specific markers that would distinguish it from the {alpha}β lineage. To date, the only surface marker for {gamma}{delta} T cells has been the TCR itself. In this work we describe two novel, developmentally regulated cell surface receptors, SCART1 and SCART2, expressed predominantly on {gamma}{delta} T cells. Based on the sequence analysis, SCART1 and SCART2 belong to the family of scavenger receptors and represent the first mouse cell surface molecules that distinguish {gamma}{delta} T cells from conventional {alpha}β T cells. SCART1 and SCART2 belong to the same protein family as WC1, the {gamma}{delta} T cell-specific protein found in sheep and cattle. However, SCARTs do not represent WC1 mouse orthologs because we found a novel bovine EST encoding a putative protein closely related to SCART1 and SCART2.

With the help of SCART2 as a marker, we identified a novel, heavily V{gamma}4-biased SCART2highCD5lowCD45RBlow {gamma}{delta} T cell subset present in the dermis and the skin-draining LNs. Because very little is known about dermal {gamma}{delta} T cells (30), at this point we can only speculate about their function. However, SCART2high {gamma}{delta} T cells have an activated/memory phenotype and express high levels of IL-17. This lymphokine is characteristic for aggressive Th17 cells involved in the pathology of many autoimmune diseases (31). Recently, IL-17-producing {gamma}{delta} T cells have been implicated in the pathology of collagen-induced arthritis (32). Moreover, the number of IL-17-producing {gamma}{delta} T cells in the draining LNs of arthritic mice was equivalent to that of the Th17 cells, showing their major contribution to total IL-17 production. Interestingly, like SCART2high cells, these IL-17-producing {gamma}{delta} T cells expressed mainly V{gamma}4. In addition, {gamma}{delta} T cells were described to be the primary sources of IL-17 during Mycobacterium tuberculosis infection, where it was important for the regulation of innate and acquired immune responses (33). Whether SCARTs play a role in the development of autoimmune diseases or defense against microbes will be addressed in future experiments. Nevertheless, SCART2high cells can produce high amounts of IL-17 in the peripheral LN under apparently noninflamed conditions. This could rather indicate a role in homeostatic processes. In fact, IL-17 was proposed to control the homeostatic regulation of neutrophil production (34). In their work, Stark et al. suggested a mechanism in which the phagocytosis of dying neutrophils inhibits IL-23 secretion by dendritic cells and/or macrophages (34). IL-23 was required for IL-17 production by {gamma}{delta} T cells (and nonconventional T cells) that in turn regulated granulopoiesis via G-CSF. It will be interesting to see whether SCART receptors play a role in this process.

The novel {gamma}{delta} T cell subset described in this article seems to be specified already in the thymus, as among immature HSA+{gamma}{delta}TCR+ thymocytes we found a similar SCART2highCD5lowCD45RBlow population. Furthermore, SCART2-positive cells were detectable at the DN3 stage, likely representing early precursors of the SCART2 subset. Possibly SCART2high and SCART2– {gamma}{delta} thymocytes represent distinct lineages that have been selected by different ligands. Consistent with positive selection, SCART2high cells had dramatically increased frequency of V{gamma}4+ cells as compared with SCART2– cells. As mentioned previously, this V{gamma} bias was maintained in the periphery in the respective lineages. These results indicate that HSA+ {gamma}{delta} thymocytes have undergone some sort of selection before export from the thymus.

What the precise signaling events are that lead to the generation of SCART2high {gamma}{delta} T cells is at present unknown. However, strong TCR stimulation in vitro leads to SCART2 down-regulation. Hence, it is feasible that quantitatively and/or qualitatively different selecting signals "instruct" the development of SCART2high and SCART2– {gamma}{delta} lineages. Because the CD5 expression level has been proposed to be regulated by the affinity of {alpha}β TCR to positively selecting ligands (21), it is tempting to speculate that the ligands selecting homogenously CD5lowSCART2high {gamma}{delta} T cells are of low avidity. Interestingly, we found that most of the deviated {gamma}{delta} lineage cells in {alpha}β TCR transgenic mice were blocked at the thymic SCART2-positive stage, suggesting that {alpha}β TCRs could expand SCART2+ precursors in the thymus but did not allow their efficient maturation. In fact, a higher proportion of mature (HSA–) deviated {gamma}{delta} lineage cells could be found only in male HY mice; however these cells were all SCART2– or SCART2low. This indicates that strong TCR ligation was incompatible with SCART2high T cell maturation. Defining the specific TCR signals that divert the SCART2high cells from the other {gamma}{delta} lineage(s) will help us to understand the process of {gamma}{delta} T cell development and, ultimately, their functional role in the immune system.


   Acknowledgments
 
We thank Dr. J. Kirberg for OT-1 and HA mice, F. Ampenberger for help with real-time PCR analysis, Dr. S. Schenk for help with the generation of the polyclonal rat anti-serum, and O. Büchi from the Institut für Biomedizinische Technik, Eidgenössische Technische Hochschule and Universität Zürich for cell sorting. We also thank Prof. A. Rolink for generous support and Dr. R. Ceredig for discussions.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 J.K. was supported by the Swiss National Science Foundation Grant No.3100A0-100351. K.K was supported by Biomedical Research Council Grant 06/1/22/19/469. Back

2 Address correspondence and reprint requests to Dr. Jan Kisielow, Molecular Biomedicine, Swiss Federal Institute of Technology (ETH), Zürich, Wagistrasse 27, CH-8952 Zürich-Schlieren, Switzerland. E-mail: jan.kisielow{at}env.ethz.ch Back

3 Abbreviations used in this paper: DETC, dendritic epidermal T cell; DN, double negative; DP, double positive; EST, expressed sequence tag; HA, hemagglutinin; HSA, heat-stable Ag; KO, knockout; LN, lymph node; RTE, recent thymic emigrant; SRCR, scavenger receptor cysteine-rich (domain). Back

Received for publication January 17, 2008. Accepted for publication May 16, 2008.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Allison, J. P., D. M. Asarnow, M. Bonyhadi, A. Carbone, W. L. Havran, D. Nandi, J. Noble. 1991. {gamma}{delta} T cells in murine epithelia: origin, repertoire, and function. Adv. Exp. Med. Biol. 292: 63-69. [Medline]
  2. Chen, Y., K. Chou, E. Fuchs, W. L. Havran, R. Boismenu. 2002. Protection of the intestinal mucosa by intraepithelial {gamma}{delta} T cells. Proc. Natl. Acad. Sci. USA 99: 14338-14343. [Abstract/Free Full Text]
  3. Girardi, M., D. E. Oppenheim, C. R. Steele, J. M. Lewis, E. Glusac, R. Filler, P. Hobby, B. Sutton, R. E. Tigelaar, A. C. Hayday. 2001. Regulation of cutaneous malignancy by {gamma}{delta} T cells. Science 294: 605-609. [Abstract/Free Full Text]
  4. Jameson, J., K. Ugarte, N. Chen, P. Yachi, E. Fuchs, R. Boismenu, W. L. Havran. 2002. A role for skin {gamma}{delta} T cells in wound repair. Science 296: 747-749. [Abstract/Free Full Text]
  5. Lahn, M., A. Kanehiro, K. Takeda, A. Joetham, J. Schwarze, G. Kohler, R. O'Brien, E. W. Gelfand, W. K. Born. 1999. Negative regulation of airway responsiveness that is dependent on {gamma}{delta} T cells and independent of {alpha}β T cells. Nat. Med. 5: 1150-1156. [Medline]
  6. Hayday, A. C.. 2000. {gamma}{delta} cells: a right time and a right place for a conserved third way of protection. Annu. Rev. Immunol. 18: 975-1026. [Medline]
  7. Lewis, J. M., M. Girardi, S. J. Roberts, S. D. Barbee, A. C. Hayday, R. E. Tigelaar. 2006. Selection of the cutaneous intraepithelial {gamma}{delta}+ T cell repertoire by a thymic stromal determinant. Nat. Immunol. 7: 843-850. [Medline]
  8. Petrie, H. T., F. Livak, D. Burtrum, S. Mazel. 1995. T cell receptor gene recombination patterns and mechanisms: cell death, rescue, and T cell production. J. Exp. Med. 182: 121-127. [Abstract/Free Full Text]
  9. Capone, M., R. D. Hockett, A. Zlotnik. 1998. Kinetics of T cell receptor β, {gamma}, and {delta} rearrangements during adult thymic development: T cell receptor rearrangements are present in CD44+CD25+ pro-T thymocytes. Proc. Natl. Acad. Sci. USA 95: 12522-12527. [Abstract/Free Full Text]
  10. Pennington, D. J., B. Silva-Santos, A. C. Hayday. 2005. {gamma}{delta} T cell development–having the strength to get there. Curr. Opin. Immunol. 17: 108-115. [Medline]
  11. Ciofani, M., G. C. Knowles, D. L. Wiest, H. von Boehmer, J. C. Zuniga-Pflucker. 2006. Stage-specific and differential notch dependency at the {alpha}β and {gamma}{delta} T lineage bifurcation. Immunity 25: 105-116. [Medline]
  12. Garbe, A. I., A. Krueger, F. Gounari, J. C. Zuniga-Pflucker, H. von Boehmer. 2006. Differential synergy of Notch and T cell receptor signaling determines {alpha}β versus {gamma}{delta} lineage fate. J. Exp. Med. 203: 1579-1590. [Abstract/Free Full Text]
  13. Haks, M. C., J. M. Lefebvre, J. P. Lauritsen, M. Carleton, M. Rhodes, T. Miyazaki, D. J. Kappes, D. L. Wiest. 2005. Attenuation of {gamma}{delta}TCR signaling efficiently diverts thymocytes to the {alpha}β lineage. Immunity 22: 595-606. [Medline]
  14. Hayes, S. M., L. Li, P. E. Love. 2005. TCR signal strength influences {alpha}β/{gamma}{delta} lineage fate. Immunity 22: 583-593. [Medline]
  15. Bigby, M., J. S. Markowitz, P. A. Bleicher, M. J. Grusby, S. Simha, M. Siebrecht, M. Wagner, C. Nagler-Anderson, L. H. Glimcher. 1993. Most {gamma}{delta} T cells develop normally in the absence of MHC class II molecules. J. Immunol. 151: 4465-4475. [Abstract]
  16. Correa, I., M. Bix, N. S. Liao, M. Zijlstra, R. Jaenisch, D. Raulet. 1992. Most {gamma}{delta} T cells develop normally in β 2-microglobulin-deficient mice. Proc. Natl. Acad. Sci. USA 89: 653-657. [Abstract/Free Full Text]
  17. Crowley, M. P., A. M. Fahrer, N. Baumgarth, J. Hampl, I. Gutgemann, L. Teyton, Y. Chien. 2000. A population of murine {gamma}{delta} T cells that recognize an inducible MHC class Ib molecule. Science 287: 314-316. [Abstract/Free Full Text]
  18. Shin, S., R. El-Diwany, S. Schaffert, E. J. Adams, K. C. Garcia, P. Pereira, Y. H. Chien. 2005. Antigen recognition determinants of {gamma}{delta} T cell receptors. Science 308: 252-255. [Abstract/Free Full Text]
  19. Schild, H., N. Mavaddat, C. Litzenberger, E. W. Ehrich, M. M. Davis, J. A. Bluestone, L. Matis, R. K. Draper, Y. H. Chien. 1994. The nature of major histocompatibility complex recognition by {gamma}{delta} T cells. Cell 76: 29-37. [Medline]
  20. Prinz, I., A. Sansoni, A. Kissenpfennig, L. Ardouin, M. Malissen, B. Malissen. 2006. Visualization of the earliest steps of {gamma}{delta} T cell development in the adult thymus. Nat. Immunol. 7: 995-1003. [Medline]
  21. Azzam, H. S., A. Grinberg, K. Lui, H. Shen, E. W. Shores, P. E. Love. 1998. CD5 expression is developmentally regulated by T cell receptor (TCR) signals and TCR avidity. J. Exp. Med. 188: 2301-2311. [Abstract/Free Full Text]
  22. Wallace, V. A., W. P. Fung-Leung, E. Timms, D. Gray, K. Kishihara, D. Y. Loh, J. Penninger, T. W. Mak. 1992. CD45RA and CD45RBhigh expression induced by thymic selection events. J. Exp. Med. 176: 1657-1663. [Abstract/Free Full Text]
  23. Leclercq, G., J. Plum, D. Nandi, M. De Smedt, J. P. Allison. 1993. Intrathymic differentiation of V{gamma}3 T cells. J. Exp. Med. 178: 309-315. [Abstract/Free Full Text]
  24. Kelly, K. A., M. Pearse, L. Lefrancois, R. Scollay. 1993. Emigration of selected subsets of {gamma}{delta}+ T cells from the adult murine thymus. Int. Immunol. 5: 331-335. [Abstract/Free Full Text]
  25. Tough, D. F., J. Sprent. 1998. Lifespan of {gamma}/{delta} T cells. J. Exp. Med. 187: 357-365. [Abstract/Free Full Text]
  26. Sambrook, J., D. W. Russell. 2001. Molecular Cloning: A Laboratory Manual 3rd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor.
  27. Fujio, K., Y. Misaki, K. Setoguchi, S. Morita, K. Kawahata, I. Kato, T. Nosaka, K. Yamamoto, T. Kitamura. 2000. Functional reconstitution of class II MHC-restricted T cell immunity mediated by retroviral transfer of the {alpha}β TCR complex. J. Immunol. 165: 528-532. [Abstract/Free Full Text]
  28. Wijngaard, P. L., N. D. MacHugh, M. J. Metzelaar, S. Romberg, A. Bensaid, L. Pepin, W. C. Davis, H. C. Clevers. 1994. Members of the novel WC1 gene family are differentially expressed on subsets of bovine CD4–CD8– {gamma}{delta} T lymphocytes. J. Immunol. 152: 3476-3482. [Abstract]
  29. Bruno, L., H. J. Fehling, H. von Boehmer. 1996. The {alpha}β T cell receptor can replace the {gamma}{delta} receptor in the development of {gamma}{delta} lineage cells. Immunity 5: 343-352. [Medline]
  30. Tamaki, K., M. Sugaya, Y. Tada, N. Yasaka, M. Uehira, H. Nishimoto, K. Nakamura. 2001. Epidermal and dermal {gamma}-{delta} T cells. Chem. Immunol. 79: 43-51. [Medline]
  31. Zheng, Y., D. M. Danilenko, P. Valdez, I. Kasman, J. Eastham-Anderson, J. Wu, W. Ouyang. 2007. Interleukin-22, a TH17 cytokine, mediates IL-23-induced dermal inflammation and acanthosis. Nature 445: 648-651. [Medline]
  32. Roark, C. L., J. D. French, M. A. Taylor, A. M. Bendele, W. K. Born, R. L. O'brien. 2007. Exacerbation of collagen-induced arthritis by oligoclonal, IL-17-producing {gamma}{delta} T cells. J. Immunol. 179: 5576-5583. [Abstract/Free Full Text]
  33. Umemura, M., A. Yahagi, S. Hamada, M. D. Begum, H. Watanabe, K. Kawakami, T. Suda, K. Sudo, S. Nakae, Y. Iwakura, G. Matsuzaki. 2007. IL-17-mediated regulation of innate and acquired immune response against pulmonary Mycobacterium bovis bacille Calmette-Guerin infection. J. Immunol. 178: 3786-3796. [Abstract/Free Full Text]
  34. Stark, M. A., Y. Huo, T. L. Burcin, M. A. Morris, T. S. Olson, K. Ley. 2005. Phagocytosis of apoptotic neutrophils regulates granulopoiesis via IL-23 and IL-17. Immunity 22: 285-294. [Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kisielow, J.
Right arrow Articles by Karjalainen, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kisielow, J.
Right arrow Articles by Karjalainen, K.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS