The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

The Journal of Immunology, 2008, 181, 1627 -1631
Copyright © 2008 by The American Association of Immunologists, Inc.
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chaix, J.
Right arrow Articles by Walzer, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chaix, J.
Right arrow Articles by Walzer, T.

Cutting Edge: Priming of NK Cells by IL-181

Julie Chaix*, Marlowe S. Tessmer{dagger}, Kasper Hoebe{ddagger}, Nicolas Fuséri*, Bernhard Ryffel§, Marc Dalod*, Lena Alexopoulou*, Bruce Beutler, Laurent Brossay{dagger}, Eric Vivier2,*,|| and Thierry Walzer2,*

* Centre d’Immunologie de Marseille-Luminy, Université de la Méditerranée, Institut National de la Santé et de la Recherche Médicale Unité, Centre National de la Recherche Scientifique Unité Mixte de Recherche 6102, Case 906, Campus de Luminy, Marseille, France; {dagger} Department of Molecular Microbiology and Immunology, Division of Biology and Medicine, Brown University, Providence, RI 02912; {ddagger} Cincinnati Children’s Hospital Research Foundation, University of Cincinnati College of Medicine, Division of Molecular Immunology, Cincinnati, OH 45229; § University of Orléans and Centre National de la Recherche Scientifique Unité Mixte de Recherche 6218, Orléans, France; Department of Immunology, Scripps Research Institute, La Jolla, CA 92037; and || Hôpital de la Conception, Assistance Publique, Hôpitaux de Marseille, Marseille, France


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results and Discussion
 Disclosures
 References
 
Recent evidence suggests that NK cells require priming to display full effector activity. In this study, we demonstrate that IL-18 contributed to this phenomenon. IL-18 signaling-deficient NK cells were found to be unable to secrete IFN-{gamma} in response to ex vivo stimulation with IL-12. This was not due to a costimulatory role of IL-18, because blocking IL-18 signaling during the ex vivo stimulation with IL-12 did not alter IFN-{gamma} production by wild-type NK cells. Rather, we demonstrate that IL-18 primes NK cells in vivo to produce IFN-{gamma} upon subsequent stimulation with IL-12. Importantly, IL-12-induced IFN-{gamma} transcription by NK cells was comparable in IL-18 signaling-deficient and -sufficient NK cells. This suggests that priming by IL-18 leads to an improved translation of IFN-{gamma} mRNA. These results reveal a novel type of cooperation between IL-12 and IL-18 that requires the sequential action of these cytokines.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results and Discussion
 Disclosures
 References
 
Natural killer cells are lymphocytes of the innate immune system that play a role in the protection against pathogens and tumors by means of cell cytotoxicity and the secretion of IFN-{gamma} (1, 2). Recent evidence has shown that, similar to other lymphocytes, NK cells need to be primed to acquire their full effector functions. This priming involves an encounter with activated dendritic cells (DC)3 in lymphoid organs (3). Mechanistically, NK cell priming has been found to be mediated in part by IL-15, trans-presented by IL-15R{alpha} on DC. Accordingly, NK cells isolated from IL-15-deficient mice display low cytotoxicity and reduced IFN-{gamma} secretion (4, 5). In this study, we aimed at identifying other molecules involved in NK cell priming using a candidate gene approach. We focused our attention on MyD88, a crucial integrator of innate immune responses required for signaling through most TLR and receptors of the IL-1 receptor family.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results and Discussion
 Disclosures
 References
 
Mice

Inbred mice were purchased from Charles River. All mice were on a C57BL/6 background. Polyinosinic:polycytidylic acid (poly(I:C); Invivogen) was injected i.p. (200 µg/mouse). Bone marrow chimeras were generated as described (6). IL-18 knockout (KO) mice and IL-18R KO mice were purchased from The Jackson Laboratory.

NK cell culture

NK cells were enriched by negative selection as described (6). They were cultured with YAC1 cells (1:1 ratio), cytokines, or coated Abs (clone 29A1.4, anti-NKp46; clone 4E5, anti-Ly49D) and anti-CD107a/GolgiStop (BD Biosciences). IL-2 (3,000 U/ml; Peprotech), IL-12 (20 ng/ml), IL-18 (5 ng/ml; R&D Systems), anti-IL-18 (20 µg/ml; MBL International), and anti-IL-18R (12.5 µg/ml; R&D Systems) were used. Following stimulation, IFN-{gamma} production by NK cells was measured as described (6). For lymphokine-activated killer (LAK) generation, splenocytes were cultured in medium with recombinant human IL-2 (2000 IU/ml; Peprotech). IFN-{gamma} was also measured by ELISA (R&D Systems). In some experiments, NK cells were cultured for 4 h with IL-18 (5 ng/ml), washed three times, and then stimulated as described above.

Quantitative RT-PCR

RNA was extracted with the RNeasy micro kit (Qiagen). Reverse transcriptase (Invitrogen) was used to generate cDNA. PCR was conducted with a SYBR Green-based kit (Qiagen) using the following primers: mouse Hprt 5', GCCCCAAAATGGTTAAGGTT; mouse Hprt 3', TTGCGCTCATCTTAGGCTTT, mouse IFN-{gamma} 5', GAACTGGCAAAAGGATGGTGA; and mouse IFN-{gamma} 3', TGTGGGTTGTTGACCTCAAAC.

Statistics

A nonparametric permutation test was used for statistical analysis using StatXxact 8 software (Cytel Studio). Two-sided p values are shown as follows: *, p < 0.05; **, p < 0.001; ***, p < 0.0001.


   Results and Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
Disclosures
 References
 
MyD88 is required for IFN-{gamma} production by NK cells in response to IL-12

We first compared the function of NK cells isolated from unchallenged wild-type and MyD88 KO mice. For this purpose, we used an ex vivo assay in which freshly purified NK cells were stimulated for 4 h with YAC-1 target cells or cytokines or with mAb specific to the activating NK cell receptors Ly49D and NKp46. IFN-{gamma} secretion and cytotoxic granule release (which is proportional to surface CD107a exposure; Ref. 7) were measured. MyD88 KO NK cells produced four times less IFN-{gamma} than wild-type NK cells in response to stimulation with IL-12 or IL-2 plus IL-12 (Fig. 1, A–C). This was true over a wide range of IL-12 concentrations (data not shown). Similar results were also obtained using ELISA and for longer periods of stimulation (Fig. 1D). By contrast, both cell types produced similar levels of IFN-{gamma} in response to all other stimuli tested, i.e., IL-2, YAC1 cells, or cross-linking of Ly49D or NKp46 (Fig. 1, A and B and data not shown). Wild-type and MyD88 KO NK cells were equally potent in their degranulation response to YAC1 cells or to Ly49D or NKp46 cross-linking (Fig. 1, B and C). Moreover, NK cell development and maturation were found to be normal in MyD88 KO mice (data not shown). Unexpectedly, MyD88 KO NK cells produced similar levels of IFN-{gamma} transcripts as wild-type NK cells in response to stimulation with IL-12 or IL-2 plus IL-12 (Fig. 1E). Thus, MyD88 regulates NK cell IFN-{gamma} production induced by IL-12 at the posttranscriptional level.


Figure 1
View larger version (21K):
[in this window]
[in a new window]

  		FIGURE 1. MyD88 is required for IFN-{gamma} production by NK cells in response to IL-12. NK cells from wild-type (WT) and MyD88 KO mice were stimulated under the indicated conditions. A–C, The expression of NK1.1, CD3, CD107a, and IFN-{gamma} were measured. A, Representative FACS analysis of NK1.1 and IFN-{gamma} expression by gated CD3– cells. Cytokine stimulation did not induce CD107a surface exposure (data not shown). B, Representative FACS analysis of IFN-{gamma} expression and CD107a surface exposure by gated NK1.1+ CD3– cells. C, Mean production of IFN-{gamma} (left) and CD107a surface exposure (right) by gated MyD88 NK cells, expressed as the percentage of the wild-type value in each condition. Data are mean ± SD of n = 8 mice. D, IFN-{gamma} level was measured by ELISA in the culture supernatant over time. Data are mean ± SD for n = 4 MyD88 KO mice and n = 3 WT mice. E, Detection of IFN-{gamma} transcripts as assessed by quantitative RT-PCR upon 4 h of stimulation. The relative quantity of IFN-{gamma} transcripts was determined by normalization to Hprt1 mRNA. Data are mean ± SD of n = 3.

 
We then tested whether MyD88 functioned in a way intrinsic to NK cells. We reconstituted irradiated recipient mice with a 1:1 mixture of wild-type CD45.1+ and MyD88-deficient CD45.1– bone marrow cells. The NK cell response was assessed 8 wk after transplantation. MyD88 KO NK cells displayed reduced IFN-{gamma} production in response to IL-12 or IL-2 plus IL-12 stimulation in comparison with CD45.1+ wild-type NK cells (Fig. 2A). Their response was otherwise similar to that of wild-type NK cells (Fig. 2A). These results indicate that MyD88 has a cell autonomous function in IL-12-induced production of IFN-{gamma} by NK cells. Next, we analyzed the response of NK cells in other mutants of the IL-1/TLR/MyD88 pathway. MyD88 associates with receptors of the TLR and IL-1R families through a homotypic interaction of their respective TLR/IL-1R (TIR) domains (8). The Pococurante point mutation in the mouse MyD88 TIR domain abrogates this interaction (9). Signaling downstream of MyD88 is also dependent on IL-1R-associated kinase 4 (IRAK4) (10). We found that both Pococurante and IRAK4 KO mice phenocopied MyD88 KO mice for the NK cell response (Fig. 2B). These results show that the NK cell response to IL-12 requires the association of MyD88 with a TIR domain-containing receptor signaling through the canonical MyD88/IRAK4 signaling pathway.


Figure 2
View larger version (25K):
[in this window]
[in a new window]

  		FIGURE 2. MyD88 and IRAK4 have an intrinsic role in NK cell response to IL-12. NK cells from mixed bone marrow chimera mice (wild-type CD45.1 with MyD88 KO or Pococurante or IRAK4 KO) were stimulated as indicated. The expression of NK1.1, CD45.1, CD3, CD107a, and IFN-{gamma} were measured. A, Mean production of IFN-{gamma} (left) and CD107a surface exposure (right) by gated MyD88 KO NK cells, expressed as the percentage of the wild-type value in each condition. Data are mean ± SD of n = 8 mice. B, Mean production of IFN-{gamma} (left) and CD107a surface exposure (right) by gated Pococurante or IRAK4 KO NK cells, expressed as the percentage of the wild-type value in each condition. Data are mean ± SD of n = 4 mice.

 
IL-18 signaling is required for optimal IL-12-induced IFN-{gamma} production by NK cells

We sought to determine which MyD88-coupled receptor(s) were involved in the NK cell response to IL-12. NK cells isolated from TLR1, TLR2, TLR3, TLR4, TLR 5, TLR7, or TLR9 knockout mice responded normally to stimulation with IL-12 (data not shown). NK cells from 3d mutant mice, bearing a mutation in Unc93b impairing TLR3, TLR7, and TLR9 (11) also responded normally to stimulation with IL-12 (data not shown). By contrast and similarly to MyD88 KO NK cells, IL-18R KO NK cells responded poorly to IL-12 and IL-2 plus IL-12 but normally to Ly49D and NKp46 cross-linking (Fig. 3A). Thus, the IL-18R/MyD88/IRAK4 pathway is required for ex vivo IFN-{gamma} production by NK cells in response to IL-12. In support of this conclusion, NK cells isolated from IL-18 KO mice produced four times less IFN-{gamma} than wild-type NK cells in response to stimulation with IL-12 or IL-2 plus IL-12 (Fig. 3B).


Figure 3
View larger version (14K):
[in this window]
[in a new window]

  		FIGURE 3. IL-18 signaling is required for IL-12-induced IFN-{gamma} production by NK cells. NK cells from wild-type, IL-18R KO, or IL-18 KO mice were stimulated as indicated. The expression of NK1.1, CD3, and IFN-{gamma} were measured. Results show the mean production of IFN-{gamma} by gated NK cells from IL-18R KO mice (A) or IL-18 KO mice (B). Results are expressed as the percentage of the wild-type value in each condition. Data are mean ± SD of n = 10 mice for each genotype.

 
IL-12 and IL-18 are well-known to synergize in inducing IFN-{gamma} production by NK cells when coadministered in vitro (12, 13). It has also been previously reported that during a 24-h culture of splenocytes with exogenous IL-12, endogenous production of IL-18 can occur and subsequently costimulate IL-12-induced IFN-{gamma} production (14). This phenomenon could potentially explain why, in our experiments, NK cells deficient for the IL-18 pathway were impaired for IFN-{gamma} production in response to stimulation by exogenous IL-12. However, the addition of blocking mAbs to IL-18 and IL-18R or NF-{kappa}B inhibitors did not block the production of IFN-{gamma} by wild-type NK cells induced by IL-12 or IL-2 plus IL-12 stimulation (Fig. 4 and data not shown). As a control, these reagents efficiently blocked the production of IFN-{gamma} by wild-type NK cells induced by exogenously added IL-18 (Fig. 4 and data not shown). Thus, IL-18 signaling is not required for NK cells to respond to IL-12 during a 4-h in vitro assay but it is mandatory in vivo to prime NK cells to respond to a subsequent stimulation with IL-12.


Figure 4
View larger version (12K):
[in this window]
[in a new window]

  		FIGURE 4. Endogenous IL-18 does not costimulate NK cells stimulated with IL-12. NK cells isolated from wild-type mice were stimulated 4 h in vitro as indicated in the presence or absence of anti-IL-18 Ab (A) or anti-IL-18R{alpha} mAbs (B). Results show the mean production of IFN-{gamma} by gated NK cells, expressed as the percentage of the control (no antibody) value. Data are mean ± SD of n = 7 (A) or n = 8 (B).

 
In vitro or in vivo NK cell preactivation restores IL-12-induced IFN-{gamma} production by MyD88 KO NK cells

Next, we asked whether the defective NK cell response to IL-12 observed in IL-18 signaling-deficient mice could be overcome by prior in vivo or in vitro NK cell activation. We first cultured WT and IL-18 KO NK cells with IL-18 before the stimulation with either IL-12 or IL-2 plus IL-12. In these conditions, IL-18 KO NK cells produced IFN-{gamma} as efficiently as WT NK cells in response to both stimuli (Fig. 5A). Second, MyD88 KO and WT mice were injected with poly(I:C) to activate NK cells in vivo. IFN-{gamma} production by in vivo activated MyD88 KO NK cells in response to IL-12 or IL-2/IL-12 was lower than that of WT NK cells (Fig. 5B), but the difference was less than that between resting WT and MyD88 KO NK cells (Fig. 1A). Third, NK cells from MyD88 KO and WT mice were cultured for 6 days in vitro with IL-2 to generate LAK. The response of MyD88 KO LAK in response to IL-12 or IL-2/IL-12 was comparable to the response of WT LAK (Fig. 5C). Thus, the responsiveness of MyD88 KO NK cells to IL-12 can be restored by in vitro activation with IL-2 and partially recovered by in vivo activation with poly(I:C). Altogether, these results show that the defective production of IFN-{gamma} by NK cells in IL-18 signaling-deficient mice is not due to a developmental deficiency but rather to a defect of priming.


Figure 5
View larger version (18K):
[in this window]
[in a new window]

  		FIGURE 5. In vitro or in vivo NK cell preactivation restores IL-12-induced IFN-{gamma} production by MyD88 KO NK cells. A, NK cells from wild-type (WT) and IL-18 KO mice were cultured for 4 h in vitro with IL-18, extensively washed, and then stimulated for 4 h as indicated. The percentage of IFN-{gamma}+ NK cells was measured; n = 4–5. B, NK cells from poly(I:C)-injected wild-type and MyD88 KO mice were stimulated for 4 h in vitro as indicated. The percentage of IFN-{gamma}+ NK cells was measured; n = 4. C, LAK cells from wild-type and MyD88 KO NK cells were stimulated for 4 h in vitro as indicated. The percentage of IFN-{gamma}+ LAK cells was measured; n = 4.

 
Our results reveal a novel type of cooperation between IL-12 and IL-18 that requires a sequential activity of these cytokines. What is the molecular basis of this phenomenon? IL-12 and IL-18 have been previously reported to act synergistically to induce IFN-{gamma} secretion by T cells and NK cells (12, 13). Synergy between IL-12 and IL-18 signaling arises from the distinct transcription factors induced and by the cooperation between these factors. For instance, IL-12-induced STAT4 up-regulates the binding activity of IL-18-induced AP-1 on the IFN-{gamma} promoter (15). However, we found that the IFN-{gamma} gene was transcribed at a similar level in WT and MyD88 KO NK cells in response to IL-12 stimulation. Accordingly, we found the following: 1) IL-12R chains were expressed normally in MyD88 KO NK cells at both the mRNA and protein levels; and 2) STAT4 was phosphorylated at a normal level in MyD88 KO NK cells upon stimulation with IL-12 (data not shown). These results suggest an unexpected role of the IL-18 pathway in the posttranscriptional regulation of IFN-{gamma} induced by IL-12. Posttranscriptional regulation of IFN-{gamma} has been shown to occur at different stages, from the localization of IFN-{gamma} mRNA (16) to the stability (17) and even the translation of this mRNA (18, 19). Our results do not favor a role for IL-18 in IFN-{gamma} mRNA stabilization, as the level of IFN-{gamma} mRNA is similar in wild-type and MyD88 KO NK cells stimulated with IL-12. They are, however, compatible with the two other possibilities. Interestingly, Hodge et al. found that IL-12 induces IFN-{gamma} mRNA accumulation in the nucleus of cells of the NK92 line. They also found that stimulation with IL-2 improves the translocation of IFN-{gamma} mRNA to the cytoplasm, which could be linked to an improved translation of this mRNA (16). Thus, it is possible that the stimulation of NK cells with IL-12 induces a suboptimal production of IFN-{gamma} by NK cells, because translation is limiting. In this model, a prior stimulation by IL-18 could result in a better nuclear export and translation of IFN-{gamma} mRNA. Of note, other NK cell effector functions such as cytotoxicity have been found to be primed at the level of translation. In particular, perforin and granzyme B mRNA are translated upon IL-15-mediated priming (20). Thus, the control of mRNA translation could be central in NK cell priming. Interestingly, although we found no effect of IL-18 signaling on the capacity of NK cells to degranulate, others previously reported that NK cells isolated from IL-18 KO mice had defective cytotoxicity against YAC1 cells (21). One possible explanation for this discrepancy could be that the level of granule proteins are also limiting in IL-18 KO NK cells.

Another open question is the source of IL-18 in vivo. IL-18 has been shown to be produced at the basal level (14) by different cell types including macrophages (22) and DC (23). Interactions between macrophages or DC and NK cells have been documented in recent years. In particular, DC have been shown to be essential for IL-15-mediated NK cell priming (3). Therefore, they could also potentially prime NK cells through IL-18 production. This could occur during NK cell development, as bone marrow NK cells were found to produce IFN-{gamma} in response to stimulation with IL-12 (24). The absence of one cytokine could be partly compensated by the others during inflammation. Indeed, we found that in vitro stimulation with IL-2 or in vivo stimulation with poly(I:C) restored at least partially the ability of MyD88 KO NK cells to produce IFN-{gamma} in response to stimulation with IL-12. Similarly, IL-18 deficiency has been shown to be compensated by other pathways in the production of IFN-{gamma} in the liver upon infection with mouse CMV (25). Redundancy in different cytokine pathways might thus contribute to the robustness of NK cell responses.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 The E.V. laboratory is supported by European Union (<<Allostem>>), Ligue Nationale contre le Cancer ("Equipe labelisée"), Agence Nationale de la Recherche, INSERM, CNRS, Ministère de l’Enseignement Supérieur et de la Recherche, and Institut Universitaire de France. This work was also supported by National Institutes of Health Grant AI058181 (to L.B.). Back

2 Address correspondence and reprint requests to Dr. Eric Vivier and Dr. Thierry Walzer, Centre d’Immunologie de Marseille-Luminy, Université de la Méditerranée, Institut National de la Santé et de la Recherche Médicale Unité, Centre National de la Recherche Scientifique Unité Mixte de Recherche 6102, Case 906, Campus de Luminy, Marseille 13288, France. E-mail addresses: vivier{at}ciml.univ-mrs.fr and walzer{at}ciml.univ-mrs.fr Back

3 Abbreviations used in this paper: DC, dendritic cell; IRAK4, IL-1R-associated kinase 4; KO, knockout; LAK, lymphokine-activated killer; poly(I:C), polyinosinic:polycytidylic acid; TIR, TLR/IL-1R. Back

Received for publication February 25, 2008. Accepted for publication June 4, 2008.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Disclosures
 References
 

  1. Yokoyama, W. M.. 2005. Natural killer cell immune responses. Immunol. Res. 32: 317-326. [Medline]
  2. Vivier, E., E. Tomasello, M. Baratin, T. Walzer, S. Ugolini. 2008. Functions of natural killer cells. Nat. Immunol. 9: 503-510. [Medline]
  3. Lucas, M., W. Schachterle, K. Oberle, P. Aichele, A. Diefenbach. 2007. Dendritic cells prime natural killer cells by trans-presenting interleukin 15. Immunity 26: 503-517. [Medline]
  4. Nakazato, K., H. Yamada, T. Yajima, Y. Kagimoto, H. Kuwano, Y. Yoshikai. 2007. Enforced expression of Bcl-2 partially restores cell numbers but not functions of TCR{gamma}{delta} intestinal intraepithelial T lymphocytes in IL-15-deficient mice. J. Immunol. 178: 757-764. [Abstract/Free Full Text]
  5. Vosshenrich, C. A., T. Ranson, S. I. Samson, E. Corcuff, F. Colucci, E. E. Rosmaraki, J. P. Di Santo. 2005. Roles for common cytokine receptor {gamma}-chain-dependent cytokines in the generation, differentiation, and maturation of NK cell precursors and peripheral NK cells in vivo. J. Immunol. 174: 1213-1221. [Abstract/Free Full Text]
  6. Walzer, T., L. Chiossone, J. Chaix, A. Calver, C. Carozzo, L. Garrigue-Antar, Y. Jacques, M. Baratin, E. Tomasello, E. Vivier. 2007. Natural killer cell trafficking in vivo requires a dedicated sphingosine 1-phosphate receptor. Nat. Immunol. 8: 1337-1344. [Medline]
  7. Alter, G., J. M. Malenfant, M. Altfeld. 2004. CD107a as a functional marker for the identification of natural killer cell activity. J. Immunol. Methods 294: 15-22. [Medline]
  8. Adachi, O., T. Kawai, K. Takeda, M. Matsumoto, H. Tsutsui, M. Sakagami, K. Nakanishi, S. Akira. 1998. Targeted disruption of the MyD88 gene results in loss of IL-1- and IL- 18-mediated function. Immunity 9: 143-150. [Medline]
  9. Jiang, Z., P. Georgel, C. Li, J. Choe, K. Crozat, S. Rutschmann, X. Du, T. Bigby, S. Mudd, S. Sovath, et al 2006. Details of Toll-like receptor:adapter interaction revealed by germ-line mutagenesis. Proc. Natl. Acad. Sci. USA 103: 10961-10966. [Abstract/Free Full Text]
  10. Suzuki, N., N. J. Chen, D. G. Millar, S. Suzuki, T. Horacek, H. Hara, D. Bouchard, K. Nakanishi, J. M. Penninger, P. S. Ohashi, W. C. Yeh. 2003. IL-1 receptor-associated kinase 4 is essential for IL-18-mediated NK and Th1 cell responses. J. Immunol. 170: 4031-4035. [Abstract/Free Full Text]
  11. Tabeta, K., K. Hoebe, E. M. Janssen, X. Du, P. Georgel, K. Crozat, S. Mudd, N. Mann, S. Sovath, J. Goode, et al 2006. The Unc93b1 mutation 3d disrupts exogenous antigen presentation and signaling via Toll-like receptors 3, 7 and 9. Nat. Immunol. 7: 156-164. [Medline]
  12. Robinson, D., K. Shibuya, A. Mui, F. Zonin, E. Murphy, T. Sana, S. B. Hartley, S. Menon, R. Kastelein, F. Bazan, A. O'Garra. 1997. IGIF does not drive Th1 development but synergizes with IL-12 for interferon-{gamma} production and activates IRAK and NF{kappa}B. Immunity 7: 571-581. [Medline]
  13. Shibuya, K., D. Robinson, F. Zonin, S. B. Hartley, S. E. Macatonia, C. Somoza, C. A. Hunter, K. M. Murphy, A. O'Garra. 1998. IL-1{alpha} and TNF-{alpha} are required for IL-12-induced development of Th1 cells producing high levels of IFN-{gamma} in BALB/c but not C57BL/6 mice. J. Immunol. 160: 1708-1716. [Abstract/Free Full Text]
  14. Fantuzzi, G., D. A. Reed, C. A. Dinarello. 1999. IL-12-induced IFN-{gamma} is dependent on caspase-1 processing of the IL-18 precursor. J. Clin. Invest. 104: 761-767. [Medline]
  15. Nakahira, M., H. J. Ahn, W. R. Park, P. Gao, M. Tomura, C. S. Park, T. Hamaoka, T. Ohta, M. Kurimoto, H. Fujiwara. 2002. Synergy of IL-12 and IL-18 for IFN-{gamma} gene expression: IL-12-induced STAT4 contributes to IFN-{gamma} promoter activation by up-regulating the binding activity of IL-18-induced activator protein 1. J. Immunol. 168: 1146-1153. [Abstract/Free Full Text]
  16. Hodge, D. L., A. Martinez, J. G. Julias, L. S. Taylor, H. A. Young. 2002. Regulation of nuclear {gamma} interferon gene expression by interleukin 12 (IL-12) and IL-2 represents a novel form of posttranscriptional control. Mol. Cell Biol. 22: 1742-1753. [Abstract/Free Full Text]
  17. Ye, J., J. R. Ortaldo, K. Conlon, R. Winkler-Pickett, H. A. Young. 1995. Cellular and molecular mechanisms of IFN-{gamma} production induced by IL-2 and IL-12 in a human NK cell line. J. Leukocyte Biol. 58: 225-233. [Abstract]
  18. Ben-Asouli, Y., Y. Banai, Y. Pel-Or, A. Shir, R. Kaempfer. 2002. Human interferon-{gamma} mRNA autoregulates its translation through a pseudoknot that activates the interferon-inducible protein kinase PKR. Cell 108: 221-232. [Medline]
  19. Khabar, K. S., H. A. Young. 2007. Post-transcriptional control of the interferon system. Biochimie 89: 761-769. [Medline]
  20. Fehniger, T. A., S. F. Cai, X. Cao, A. J. Bredemeyer, R. M. Presti, A. R. French, T. J. Ley. 2007. Acquisition of murine NK cell cytotoxicity requires the translation of a pre-existing pool of granzyme B and perforin mRNAs. Immunity 26: 798-811. [Medline]
  21. Takeda, K., H. Tsutsui, T. Yoshimoto, O. Adachi, N. Yoshida, T. Kishimoto, H. Okamura, K. Nakanishi, S. Akira. 1998. Defective NK cell activity and Th1 response in IL-18-deficient mice. Immunity 8: 383-390. [Medline]
  22. Dinarello, C. A.. 1999. Interleukin-18. Methods 19: 121-132. [Medline]
  23. Andrews, D. M., A. A. Scalzo, W. M. Yokoyama, M. J. Smyth, M. A. Degli-Esposti. 2003. Functional interactions between dendritic cells and NK cells during viral infection. Nat. Immunol. 4: 175-181. [Medline]
  24. Kim, S., K. Iizuka, H. S. Kang, A. Dokun, A. R. French, S. Greco, W. M. Yokoyama. 2002. In vivo developmental stages in murine natural killer cell maturation. Nat. Immunol. 3: 523-528. [Medline]
  25. Pien, G. C., A. R. Satoskar, K. Takeda, S. Akira, C. A. Biron. 2000. Cutting edge: selective IL-18 requirements for induction of compartmental IFN-{gamma} responses during viral infection. J. Immunol. 165: 4787-4791. [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Infect. Immun.Home page
D. Prantner, T. Darville, J. D. Sikes, C. W. Andrews Jr., H. Brade, R. G. Rank, and U. M. Nagarajan
Critical Role for Interleukin-1{beta} (IL-1{beta}) during Chlamydia muridarum Genital Infection and Bacterial Replication-Independent Secretion of IL-1{beta} in Mouse Macrophages
Infect. Immun., December 1, 2009; 77(12): 5334 - 5346.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
H. Beuneu, J. Deguine, B. Breart, O. Mandelboim, J. P. Di Santo, and P. Bousso
Dynamic behavior of NK cells during activation in lymph nodes
Blood, October 8, 2009; 114(15): 3227 - 3234.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M. R. Hepworth and R. K. Grencis
Disruption of Th2 Immunity Results in a Gender-Specific Expansion of IL-13 Producing Accessory NK Cells during Helminth Infection
J. Immunol., September 15, 2009; 183(6): 3906 - 3914.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
E. A. Haddad, L. K. Senger, and F. Takei
An Accessory Role for B Cells in the IL-12-Induced Activation of Resting Mouse NK Cells
J. Immunol., September 15, 2009; 183(6): 3608 - 3615.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
C. Sola, P. Andre, C. Lemmers, N. Fuseri, C. Bonnafous, M. Blery, N. R. Wagtmann, F. Romagne, E. Vivier, and S. Ugolini
Genetic and antibody-mediated reprogramming of natural killer cell missing-self recognition in vivo
PNAS, August 4, 2009; 106(31): 12879 - 12884.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
P. Krebs, M. J. Barnes, K. Lampe, K. Whitley, K. S. Bahjat, B. Beutler, E. Janssen, and K. Hoebe
NK cell-mediated killing of target cells triggers robust antigen-specific T cell-mediated and humoral responses
Blood, June 25, 2009; 113(26): 6593 - 6602.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
M. A. Cooper, J. M. Elliott, P. A. Keyel, L. Yang, J. A. Carrero, and W. M. Yokoyama
Cytokine-induced memory-like natural killer cells
PNAS, February 10, 2009; 106(6): 1915 - 1919.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chaix, J.
Right arrow Articles by Walzer, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chaix, J.
Right arrow Articles by Walzer, T.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS