The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


The Journal of Immunology, 2008, 181, 1264-1271
Copyright © 2008 by The American Association of Immunologists, Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Su, W.
Right arrow Articles by Spencer, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Su, W.
Right arrow Articles by Spencer, J.

Lambda Light Chain Revision in the Human Intestinal IgA Response1

Wen Su*, John N. Gordon{dagger}, Francesca Barone*, Laurent Boursier*, Wayne Turnbull*, Surangi Mendis*, Deborah K. Dunn-Walters* and Jo Spencer2,*

* Department of Immunobiology, Kings College London School of Medicine at Guy’s King’s College and St. Thomas’ Hospitals, London, United Kingdom; and {dagger} Division of Infection, Inflammation and Repair, University of Southampton School of Medicine, Southampton General Hospital, Southampton, United Kingdom


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Revision of Ab L chains by secondary rearrangement in mature B cells has the potential to change the specific target of the immune response. In this study, we show for the first time that L chain revision is normal and widespread in the largest Ab producing population in man: intestinal IgA plasma cells (PC). Biases in the productive and non-productive repertoire of {lambda} L chains, identification of the circular products of rearrangement that have the characteristic biases of revision, and identification of RAG genes and protein all reflect revision during normal intestinal IgA PC development. We saw no evidence of IgH revision, probably due to inappropriately orientated recombination signal sequences, and little evidence of {kappa}-chain revision, probably due to locus inactivation by the {kappa}-deleting element. We propose that the {lambda} L chain locus is available and a principal modifier and diversifier of Ab specificity in intestinal IgA PCs.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Precursors of IgA plasma cells (PC)3 are chronically challenged on the immunological front line, defending the body against potentially deadly microorganisms and toxins in the gut lumen. One of the strategies that IgA PCs use to meet this daily challenge is quantity; they generate between 3 and 5g of IgA that is transported into the gut lumen every day (1, 2, 3). Clonal expansion of PC precursors is involved in generating sheer numbers of IgA PCs (4, 5), but extensive clonal expansion would intrinsically compromise one of the defining characteristics of the adaptive immune system: diversity of receptors.

Like Ab diversity generally, generation of IgA diversity begins in the bone marrow with RAG dependent, imprecise joining of single V, D [IgH only], and J segments of multiple alternatives at the Ig loci. Ig genes rearrange strictly hierarchically, starting at the IgH locus. If IgH rearrangement is successful, rearrangement at the Ig {kappa} L chain ({kappa}) locus is initiated and if rearrangement of Ig{kappa} is productive, the B cell matures expressing Ig{kappa}. If rearrangement fails at both Ig{kappa} alleles, despite potential editing at the Ig{kappa} locus, rearrangement at the Ig {lambda} ({lambda}) locus proceeds, and if this is successful an Ig{lambda} expressing B cell is generated (6, 7). Most non-productive rearrangements at the {kappa} loci are inactivated by recombination of the {kappa}-deleting element (KDE) that excises the constant region and the intronic enhancer from non-functional rearrangements, thus disabling somatic hypermutation, which is dependent on the intronic enhancer (7, 8).

Precursors of human intestinal IgA PCs that have been activated in GALT are expanded in germinal centers where somatic hypermutation changes ~5% of the V region sequence on average (9, 10). Analysis of the acquisition and types of mutations with time in murine Peyer’s patches and analysis of lineage trees from the germinal centers of human GALT does not suggest that the mechanism of hypermutation is different or more rapid in mucosal compared with peripheral sites (11, 12). The high frequency of mutation in GALT is thought to be due to a greater number of mutational cycles coupled with chronic challenge (12). There is evidence that adaptive and innate mechanisms are involved in generating the intestinal PC response (13, 14). Therefore, it is also possible that the high frequency of mutation reflects a higher tolerance threshold for mutations due to differences in selection pressure when B cells are driven by innate mechanisms. Selection for specificity can result in the elimination of sequences carrying mutations that reduce binding affinity. In the absence of antigenic selection, mutations that would affect affinity could theoretically accumulate, so long as they did not affect the structural integrity of the Ig molecule.

Receptor revision is a third potential mechanism of diversifying the Ab repertoire, though the nature and extent of revision is contentious. Receptor revision involves replacement of rearranged IgH or IgL V regions through additional DNA recombination events in mature peripheral B cells. Evidence of revision in man has been observed in autoimmunity and malignant human tissues (15, 16), though it has not been universally accepted to be part of normal B cell physiology. Expression of RAGs, which would be essential for revision, has been observed in germinal centers by some groups but not others (15, 17, 18). Data from a transgenic mouse model suggested that RAGs are not re-expressed in the periphery but that expression may be retained by recent emigration from the bone marrow (19).

Our evidence that IgL revision modifies the normal intestinal IgA repertoire is based on comparison of the rearranged gene repertoire, the frequency of recombination excision circles (RECs) at the Ig{lambda} locus, biases in J segment usage in {lambda}RECs, and local expression of RAG-2 in GALT. All gene rearrangements, whether primary or secondary, generate RECs. These do not divide but are passed on to single daughter cells through progressive cycles of division. Their frequency in intestinal IgA PC precursors, together with estimates of proliferative cycles gained from the load of somatic mutations (20, 21, 22, 23), indicates substantial revision. The gut is a site of generation of Ab diversity in many species and by different mechanisms (24, 25). We suggest that IgL revision is another mechanism that diversifies human intestinal IgA, thus enhancing the capacity to bind luminal Ags. Although autoreactivity would be a possible consequence of revision in other circumstances, this may not be relevant to IgA, first because it is relatively non-inflammatory compared with other isotypes and secondly because IgA secreted by intestinal PCs is largely destined for the gut lumen.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Human tissues and cells

Human ileum from right hemicolectomy specimens and isolated human lamina propria cells from macroscopically normal colon of two patients following therapeutic surgery for colon cancer were used with the approval of the Local Research Ethics Committee, as described previously (5). Isolated cells were immunostained with RPE-conjugated CD38 (Dako) (1 µg/100 µl) then fixed and permeabilized with an IntraStain kit (Dako) and immunostained with anti-IgA-FITC (4 µg/100 µl) for intracytoplasmic Ig and sorted by FACS as single cells into 96-well plates. IgA immunoblasts, identified as triple-positive cells immunostained by IgA-FITC (4 µg/100 µl) (Dako), CD79b-RPE (BD Biosciences) (0.5 µg/100 µl), and {alpha}4β7-Cy5 (BD Biosciences) (0.6 µg/100 µl), were isolated by FACS from buffy coats of two healthy donors. Small IgD+ B cells from the same buffy coats were sorted by FACS with mouse anti-human IgD (0.8 µg/100 µl) and goat anti-mouse-FITC (Dako) for analysis of {lambda}RECs. Equivalently processed isotype and concentration matched controls were used throughout.

B cell clones

The FACS-isolated IgA+, CD79b+, {alpha}4β7+ cells (immumnostained as described above) at 20 or 50 cells per well in 96-well plates were cultured with EBV, irradiated allogenic feeder cells, and 2.5 µg/ml CpG (26). After 3 wk, the culture supernatants were screened for Ig{lambda} and IgA secretion by ELISA and IgA{lambda}-positive cell lines cloned out on irradiated feeder cells with CpG.

PCR Amplification of Ig{kappa}, Ig{lambda}, and IgH gene rearrangements

Single gut PCs were analyzed by amplification of rearrangements involving 7 V{kappa} (27) and 10 V{lambda} families (12, 28). Similarly, 6 IgH (29) and 10 V{lambda} family gene rearrangements were retrieved from B cell clones and IgA+, CD79b+, {alpha}4β7+ B cells. PCR products were purified and cloned into the pGEM-T Vector (Promega) and sequenced by LARK Technologies. Sequences analyzed are accessible from EMBL/GenBank under accession numbers (AJ972151-AJ972375, AM941072–1110, and AM943489–3516).

Amplification of {lambda}RECs from IgD+ and IgA+, CD79b+, {alpha}4β7+ B cells

The primers to amplify {lambda}RECs were designed according to IMGT database (http://imgt.cines.fr) to recover the signal joints from the circular DNA (Table I) with a multiplex nested PCR program as described (10). PCR products were purified and cloned into the pGEM-T Vector (Promega) and then sequenced by LARK Technologies. The frequency of {lambda}RECs in IgD+ B cells and IgA immunoblasts was performed by doubling dilutions starting from 400 cells to less than one cell per reaction. Each dilution was tested with four replicates in each of three separate experiments. Limiting dilution was further conducted with 2 cells per reaction for IgD+ and 20 cells per reaction for IgA immunoblasts with 40 reactions for each analysis.


View this table:
[in this window]
[in a new window]

 
Table I. Primers use for detection of {lambda}REC

 
Isolation of germinal center cells from human gut tissue by laser capture microdissection

Frozen sections of human gut tissue (8 µm) on PALM membrane slides (P.A.L.M. Microlaser Technologies) were fixed with 70% pre-cooled (–20°C) ethanol for 2 or 3 min, and then stained with 1% cresyl violet acetate for 20 s. The stained slides from specimens from two individuals were stored at –80°C until use. The replicate germinal centers from entire well-orientated follicles, where zonation was clearly apparent, were dissected by laser capture microdissection and put into PALM adhesive Caps tubes containing 100 µl of mRNA lysis/Binding Buffer RLT (Qiagen RNeasy Mini Kit) with 10% carrier-N (ExpressArt Pico RNA Care reagents) to protect mRNA from degradation. The mRNA were isolated and reverse transcribed using a Qiagen RNeasy Mini Kit.

Detection gene expression in microdissected fragments

A semi-nested PCR was conducted in 50-µl volumes containing 5 µl cDNA from germinal center cells, 1 µmol 5' primer, 1 µmol of each 3' primer, 200 µm of each dNTP and 2.5 mM MgCl2 in TaqDNA polymerase 1x reaction buffer (Promega), and 1 unit of TaqDNA polymerase (Promega). Then, 2 µl of first round PCR product was used for the second round. Both rounds of PCR were performed as 30 cycles of 94°C for 30 min, 60°C for 1 min, and 72°C for 2 min, followed by the extension at 72°C for 5 min. PCR sense primer for RAG-2 is 5'GCAGCCCCTCTGGCCTTC 3'. External and internal anti-sense primers were 5'TTTCAGACTCCAAGCTGCCT 3' and 5'AGCGAAGAGGAGGGAGGTAG 3', respectively.

Namalwa B cell line (European collection of cell cultures) was used a positive control for RAG-2. The expression GAPDH gene was detected in both Namalwa and microdissected gut germinal centers. Activation-induced deaminase (AID) expression was detected in the germinal center cells microdissected by laser capture microdissection using a nested PCR (30) as an additional positive control.

Immunohistochemistry

RAG-2 was visualized in 3 µm paraffin sections of four different specimens of human terminal ileum using rabbit anti-human RAG-2 raised to amino acids 1–300 of RAG-2 (4 µg/ml) and goat anti-human RAG-2 raised against the C terminus of RAG-2 (4 µg/ml) (both from Santa Cruz Biotechnology) after Ag retrieval using Dako Ag retrieval solution. Staining controls were species- and concentration-matched Abs with other specificities. Dako Ab reactivity was visualized with the EnVision kit (Dako) or anti-goat biotinylated Ab followed by ExtrAvidin-Peroxidase (Sigma-Aldrich) and developed with DAB plus (Dako). Slides immunostained using goat anti-RAG-2 were double stained with CD20 and an EnVision kit (Dako).

Statistical methods

Comparisons of observed vs expected numbers were carried using {chi}2 tests in Excel. Observed differences were considered to be statistically significant at p ≤ 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
IgL rearrangements at the {kappa} locus in intestinal IgA PCs

Single IgA PCs were sorted by FACS from cell suspensions of lamina propria cells, and IgL gene rearrangements were amplified by PCR. Sequence characteristics of 164 different rearrangements at the Ig{kappa} and Ig{lambda} loci of 125 single IgA PCs were analyzed. There were no biases in the repertoire of IgV{kappa} gene segments used, either by comparison with existing studies of blood B cells or by comparison of productive vs non-productive rearrangements (Fig. 1A). A bias against Jk1 segment rearrangements was observed in non-productive rearrangements (Fig. 1B). This has been observed before in a study of blood B cells (6, 8) and is considered to be a consequence of editing during B cell development rather than revision in mature B cells.


Figure 1
View larger version (20K):
[in this window]
[in a new window]

 
FIGURE 1. Characteristics of Igk rearrangements from single IgA PCs. Comparison of productive and non-productive rearrangements involving the V{kappa} families (A) and individual J{kappa} segments (B). The only bias observed was a tendency not to observe J{kappa}1 in the non-productive rearrangements, consistent with editing of these rearrangements as seen in another study (7 8 ). In most cells, the somatic hypermutation mechanism was only active on productive rearrangements of V{kappa}J{kappa} (C), presumably due to the activity of the KDE in non-productive rearrangements. The activity of the KDE is illustrated in D, where a V{kappa}J{kappa} rearrangement is identified by "a." The KDE can inactivate this rearrangement if it is non-productive. The KDE can either recombine with an RSS in the intronic sequence between J{kappa} and C{kappa} identified by "b" or with an upstream V segment identified by "c." Evidence for revision or allelic inclusion was apparent in three different PCs where each had two mutated in-frame alleles. One in-frame rearrangement involving the germline V segment V3-11 had acquired stops by somatic hypermutation and may have been replaced by rearrangement at the second allele (E).

 
The majority of productive rearrangements at the Ig{kappa} locus had undergone somatic hypermutation, whereas the majority of non-productive rearrangements had not (Fig. 1C). Failed rearrangements at the Ig{kappa} locus are most often inactivated by the KDE, which stops hypermutation of any remaining rearrangement by excision of the intronic enhancer (Fig. 1D). Therefore, simply the presence of a mutated Ig{kappa} allele implies that it probably is or was functional (31). The presence of two mutated, in-frame rearrangements in a cell could reflect revision if an allele that has become non-productive as a consequence of somatic hypermutation is replaced functionally by secondary rearrangement on the other allele. Alternatively, this could reflect allelic inclusion where both in-frame alleles are used (31). Only 4 cells out of the 125 single cells studied showed evidence of either revision of Ig{kappa} rearrangements or allelic inclusion. Three cells contained two mutated in-frame Ig{kappa} rearrangements each. In one of these cells, one allele had acquired stops as a consequence of somatic hypermutation, rendering it non-productive (Fig. 1E). This suggests that previously functional Ig{kappa} rearrangement rendered non-productive by somatic hypermutation could have been replaced by Ig{kappa} rearrangement on the second allele. One cell had a productive Ig{lambda} rearrangement and a mutated productive Ig{kappa} rearrangement, implying either replacement of previously used (mutated) Ig{kappa} rearrangement with Ig{lambda}, or allelic inclusion. Therefore revisions from Ig{kappa}, and allelic inclusion probably occur in intestinal IgA PCs, but are relatively rare.

Evidence for extensive Ig{lambda} revision

The repertoire of IgV{lambda} segments in productive rearrangements from single IgA PCs was not significantly different from other studies of naive B cells (either peripheral or mucosal) or from previously analyzed populations of PCs (12, 28) (data not shown). However, the ratio of productive to non-productive rearrangements was dramatically skewed toward productive rearrangements in the most commonly used V{lambda} familes, V{lambda}1 and V{lambda}2, and toward non-productive rearrangements in the V{lambda}5 family and related V{lambda}9 segment (Fig. 2). No biases in the other, less commonly used of the 10 V{lambda} families, were apparent.


Figure 2
View larger version (23K):
[in this window]
[in a new window]

 
FIGURE 2. Biased ratio of productive:non-productive Ig{lambda} rearrangements in IgA PCs compared with mature naive B cells. Ratio of productive (open bars) to non-productive (black bars) rearrangements in the V{lambda}1 and 2 families and the V{lambda}5 family and related V{lambda}9 segment. Data from single B cells and from B cell lines in this study are shown alongside data from populations of IgA PCs and naive B cells, including Peyer’s patch cells from other studies (10 28 ). The actual number of sequences contributing is written inside the bars. In IgA PCs and immunoblasts, there is a bias toward productive rearrangements in the V{lambda}1 and 2 families and toward non-productive rearrangements in theV{lambda}5 and 9 families. This skewing is not apparent in naive B cells and is therefore a consequence of revision and not editing.

 
Somatic hypermutation, which particularly affects IgV in gut PCs could generate biases in PCR by mutating the primer binding sites (32). Productive and non-productive rearrangements may differ in their susceptibility to mutation in certain sequences, which might generate the observed biases. Therefore, to eliminate the possibility that the dramatic biases in IgL rearrangements observed by PCR were an artifact of PCR, B cell clones were prepared. B cells from blood that expressed integrin {alpha}4β7, CD79b, and IgA were considered to be precursors of mucosal IgA PCs in transit through the blood, on their way back to the mucosal lamina propria (IgA immunoblasts). They were sorted and transformed with EBV, then cloned at limiting dilution with feeder cells and CpG (26). Emerging clones were screened for Ig{lambda} and IgA production and 19 different IgA{lambda} clones were generated. H and L chain gene rearrangements from these clones were analyzed and detailed in Table II. These clones showed the same bias toward productive rearrangements in V{lambda}1 and V{lambda}2 and toward non-productive rearrangements in the V{lambda}5 family as observed previously in individual and populations of gut PCs (10) (Fig. 2). This demonstrates beyond doubt that the skewed ratio originally observed by PCR is real and that the mechanism generating it is common, so that its effects are clearly apparent in a sample of 19 cell lines.


View this table:
[in this window]
[in a new window]

 
Table II. Details of H and L chain rearrangements from EBV clones derived from IgA+, CD79b+, {alpha}4β7+ cells from blood

 
Frequency and composition of {lambda}RECs in IgA immunoblasts and PCs

Since the skewed ratios of productive and non-productive rearrangements in IgA immunoblasts and intestinal PCs had not been seen in mature naive B cells, we hypothesized that the skewing may be a consequence of widespread receptor revision. If this hypothesis is correct, IgA immunoblasts and PCs should firstly contain more {lambda}RECs than expected if the only {lambda}RECs present were those generated during B cell development in the bone marrow. Secondly, {lambda}RECs from IgA PCs/precursors should be biased toward the most distal J segment usage compared with naive B cells, but might not show biases in V segment rearrangement since the profile of used segments appears unaffected by the revision process.

{lambda}RECs amplified by PCR (Fig. 3) were observed in 28.6% of IgD+ cells, determined by limiting dilution analysis. We plotted the number of cells expected to contain a single {lambda}RECs within an exponentially expanding population starting from the observed number of cells containing {lambda}RECs in the naive IgD+ B cell population (Fig. 4A). To determine the number of IgA immunoblasts expected to contain {lambda}RECs, we first deduced how many cycles of replication they are likely to have been through using the observed frequency of hypermutation in these cells. The average mutation frequency in IgH and IgL chain, in intestinal PCs or IgA immunoblasts studied, was 4.9% over 280 bp of V region sequence (Fig. 4B). There are several estimates of the rate of hypermutation; therefore, we calculated the number of cell divisions required to generate the observed hypermutation frequency of 4.9% using a recent study that defined a range from 0.07 to 0.11 mutations/100 bp/cycle (23), and also a conservative rate of hypermutation widely used in models of the germinal center reaction, and supported by earlier studies, of 0.5 mutations/V segment/cycle (20, 21, 22). The number of cycles of replication derived from these figures is from 44.5 to 70 cycles and 27.4 cycles, respectively. Therefore, the number of cells expected to contain a single {lambda}REC ranges from 9.4 x 108 to 4.1 x 1021 cells (Fig. 4A). Although this is a wide window, the observed frequency of {lambda}RECs in IgA immunoblasts of 1 per 89 cells determined by limiting dilution analysis is ~7 orders of magnitude higher than the most conservative estimate within the range of expected {lambda}REC frequency.


Figure 3
View larger version (18K):
[in this window]
[in a new window]

 
FIGURE 3. Illustration of generation and detection of {lambda}RECs. When V{lambda} and J{lambda} segments rearrange, illustrated by "a," a coding joint is formed between V{lambda} and J{lambda}. The intervening sequence forms a circular DNA, which we term the {lambda}REC that includes a signal joint characterized by a pair of RSS in opposite orientations (illustrated by triangles). The binding sites of 5' and 3' primers used to amplify {lambda}RECs are shown as arrows.

 

Figure 4
View larger version (29K):
[in this window]
[in a new window]

 
FIGURE 4. Calculation of expected and observed frequency of {lambda}RECs. The graph in A illustrates the decreasing frequency of {lambda}RECs in an exponentially expanding population (y-axis) which starts with a frequency of {lambda}RECs of 1 in 3.5 cells, as observed in mature naive IgD+ B cells, as cell cycles progress (x-axis). The observed frequency of {lambda}RECs is the experimental observation of 1 {lambda}REC per 89 IgA immunoblasts, which would be derived from 4.7 cycles of proliferation if revision did not occur. Three expected frequencies of {lambda}RECs are illustrated. Two use the range of hypermutation frequencies of 0.07 to 0.11 mutations/100 bp/cycle to generate the 4.9% observed mutations over 44.5 to 70 cycles of replication, respectively (23 ). This would result in 1 {lambda}REC in between 1.2 x 1014 and 4.1 x 1021 cells. The third expected frequency of {lambda}RECs is derived from an estimate of 0.5 mutations/V segment/cycle, which would generate 4.9% mutation frequency over 27.5 cycles resulting in 1 {lambda}REC per 9.4 x 108 cells (22 ). B, The frequencies of hypermutation in the IgH and IgL from the IgA immunoblast clones, IgH from the untransformed IgA immunoblasts from which clones were made, and IgH from gut PCs. The frequencies of hypermutation were on average 4.9%. The gels in C illustrate the frequency of {lambda}RECs when analyzed by PCR. Cells for PCR were diluted by doubling dilutions from a starting cell number of 400 IgD+ lymphocytes or IgA immunoblasts per well. The top four rows are IgA immunoblasts, the bottom four rows are IgD+ lymphocytes from the same individual. The IgA immunoblasts are between 4 and 5 doubling dilutions (analogous to doubling during cell cycles) behind the IgD+ cells if it is assumed that revision does not occur, consistent with figures calculated from limiting dilution studies.

 
If no revision had occurred, the observed proportion of cells containing {lambda}RECs in IgA immunoblasts (1/89) would be reached after ~4.7 cell divisions (Fig. 4A). This figure can also be visualized in the doubling dilution analysis of {lambda}REC frequency in IgD+ cells and IgA immunoblasts in Fig. 4C. However, if this were correct and no revision had occurred, the hypermutation mechanism would have to introduce mutations at a rate of ~1 mutation per 100 nucleotides per division into this population, which is ~6 times faster than the most rapid rates estimated and is not substantiated by lineage tree analysis of germinal center responses in human GALT (Ref. 11 and D.D.-W., unpublished data) or studies of the hypermutation mechanism in murine Peyer’s patch cells (12).

The frequency of J segment recombination signal sequences (RSS), that mediate the recombination event, in the {lambda}REC sequence was strongly biased toward replacement with J2/3 in the IgA immunoblast (p < 0.001) and intestinal PC populations (p < 0.02), compared with approximately equal proportions of J1 and J2/3 in the {lambda}RECs from IgD+ cells from blood, confirming that they are consequences of revision (Fig. 5A). The V segment, and V family replacements observed in the {lambda}RECs, showed approximately the same repertoire as all other populations analyzed (Fig. 5, B and C).


Figure 5
View larger version (24K):
[in this window]
[in a new window]

 
FIGURE 5. Analysis of J and V segment rearrangements in {lambda}RECs. J segment involvement in {lambda}RECs from IgD+ B cells, IgA immunoblasts, and IgA PCs from the gut (A). J{lambda}1 is most common in the {lambda}REC from IgD+ cells, whereas there is a significant tendency to see J{lambda}2/3 in the {lambda}RECs from IgA immunoblasts (*, p < 0.001) and PCs (**, p < 0.02). In contrast, there is no strong bias in V{lambda} segments in {lambda}RECs, other than a tendency not to see the commonly rearranged V{lambda}2–14 segment in the {lambda}RECs from IgA immunoblasts (B). Similar profile of V{lambda} familes in productive rearrangements from naive B cells (28 ) and PCs (10 ) and in the {lambda}RECs from the IgA immunoblasts (C).

 
Identification of RAG

RAG protein expression in Peyer’s patches of the terminal ileum was assessed by immunohistochemistry. Expression characteristics observed using two different Abs generated in different species and to different epitopes of RAG-2 are illustrated. RAG-2 was detected on subsets of germinal center B cells, including germinal center centroblasts (Fig. 6, A and C). In addition, RAG-2 expression by a subset of intraepithelial reddish/brown cells was observed (Fig. 6B).


Figure 6
View larger version (144K):
[in this window]
[in a new window]

 
FIGURE 6. RAG-2 expression in Peyer’s patches. A and B, double immunostain with goat anti-RAG-2 (brown) and CD20 (red) on paraffin sections of normal human Peyer’s patches. A, Detection of RAG-2 positive B cells in the germinal center of a Peyer’s patch (arrowed with higher power detail in insert). B, RAG-2 expressing cells infiltrating the epithelium adjacent to the Peyer’s patches (arrowheads). C, Rabbit anti-RAG-2 also identified germinal center cells (arrows and in insert) and a subset of intraepithelial lymphocytes (not illustrated) consistent with the staining illustrated in B and C. D, Example of amplification of RAG-2 gene transcripts by RT-PCR from laser capture microdissected samples of germinal centers RNA. m.w. marker is identified by "M," the cell line Namalwa (N) that rearranges L chain genes in vitro (unpublished) is a positive control. AID transcripts are the positive control for laser microcapture of germinal center cells.

 
The expression of RAG-2 in germinal centers was confirmed by RT-PCR of cDNA derived from germinal centers isolated from Peyer’s patches by laser capture microdissection. PCR for AID served as a positive control for germinal center origin of the microdissected fragments (Fig. 6D).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The data presented here highlight a role of secondary Ig{lambda} rearrangements as modifiers of the Ag-binding repertoire of IgA. Potential revision of IgH is thwarted by the removal of the D segments with appropriately orientated flanking RSS, that mediate recombination from D to J and from V to D, by the initial rearrangement process. It is theoretically possible to use embedded RSS in IgVH for receptor revision (33), but there is no evidence from examination of junctional regions of IgH rearrangements from IgA PCs that this occurs (J.S., unpublished observations). Editing of Ig{kappa} has been described (34) but failed Ig{kappa} rearrangements in man are generally inactivated by the KDE, which removes the potential for future rearrangement events in mature B cells (6, 7, 8). Examples of revision of Ig{kappa} have been described here, but they are relatively rare. In contrast, the Ig{lambda} locus has "nested" V and J segments that can recombine to generate new rearrangements on the same allele and there is no known mechanism for inactivation of the locus. The intact Ig{lambda} locus is also available for secondary rearrangements following Ig{kappa} expression.

Revision of Ig{lambda} does not substantially alter the profile of V{lambda} usage. V{lambda}1 and 2 families are dominant in the used repertoire in naive B cells, in intestinal IgA PCs, IgA immunoblasts, and the {lambda}RECs. In contrast, the non-productive repertoire of rearrangements involves predominantly V{lambda}5 and 9 families in the IgA+ populations studied only. We have previously shown that the non-productive rearrangements involving V{lambda}5 and 9 are biased toward rearrangement with J{lambda}2 and 3, implying that the non-productive rearrangements involving V{lambda}5 and 9 are the products of secondary rearrangements (10). The data on the whole are consistent with the hypothesis that rearrangements from V{lambda}1 and 2 families can be replaced by revision, but those from V{lambda}5 and 9 cannot, so that they accumulate in the non-productive repertoire.

Through analysis of somatic hypermutations in IgV segments from IgA PCs and the rates at which they are introduced, we know that at least 9 x 108 cells are generated from a single precursor (Fig. 4), though not all will survive the germinal center response since some mutations are likely to be functionally deleterious and the cells carrying them will die during the selection process (35). Since replacement of L chain can result in changes in Ag binding (36), L chain revision would add to the spectrum of specificities in the chronically dividing B cells that sustain the extensive lamina propria PC population.

The requirement for cognate B cell-T cell interaction during germinal center formation guards against the generation and propagation of autoantibody responses (14). Receptor revision generates new specificities within germinal centers once this initial regulatory barrier is crossed, which is potentially dangerous in the context of autoimmunity. In the periphery, high affinity BCR enhances B cell survival through selection, which would form a second level of regulation to prevent autoreactivity (14), though this process may not regulate B cell survival in GALT germinal centers (14). However, it is possible that the consequences of generating a new specificity in an IgA response in a mucosal microenvironment are not as hazardous as an equivalent event in the periphery, partly because of the relatively passive functional properties of IgA. Most autoantibodies associated with disease processes are IgM or IgG isotypes, which are complement fixing and are more ‘proinflammatory’ than IgA. In addition, most IgA is produced beneath the intestinal epithelium and is transported into the gut lumen (2), where diversity at the expense of potential autoimmunity may not be a problem. One example of secondary L chain rearrangement has been identified in somatically mutated IgG involving {kappa} and {lambda} L chains. The authors propose that L chain revision and somatic hypermutation may both be involved in affinity maturation (37).

It is possible that IgL revision could occur in germinal centers of GALT because the high load of mutations in IgV generates non-functional or autoreactive variants. Ig{lambda} and receptor revision have been associated with autoimmunity, though this was not necessarily associated with mucosal surfaces, and may be a consequence of aberrant activity of a normal phenomenon described here.

The expression of RAG in secondary and tertiary lymphoid organs has been debated partly due to divergent findings (15, 16, 17, 18, 19, 38). Even among studies that have identified expression of RAGs in secondary lymphoid tissues, expression has been reported in Ig-negative cells, consistent with centroblasts as observed here (17), and also in centrocytes (38). Whether these contrasting data reflect differential expression in diverse sites or technical factors is unclear. We observed expression of RAGs in the cytoplasm and not in the nucleus, and our observations may not directly reflect rearrangement activity in centroblasts or in the epithelium, if the protein is partitioned. However, the presence of RAGs indicates that local activity is certainly possible. The expression of RAGs in cytoplasmic foci in centroblasts of the germinal center is consistent with re-expression of RAGs and potential for revision during a T cell-dependent B cell response. Interestingly, a recent study identified induction of RAG gene expression by IL-6, a factor associated with PC development (39).

In conclusion, we propose that revision of Ig{lambda} occurs during the development of intestinal IgA PCs and is an intrinsic component of the human IgA response that is likely to occur in germinal centers of GALT. We consider this to be an additional level of diversification of mucosal Ig in B cells that have proliferated extensively. Revision events may occur purely to diversify the repertoire, or to remove non-functional or autoreactive variants generated by a high load of somatic mutations. Whatever the initiating event, an increase in diversity is the likely outcome.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by the Wellcome Trust and the Biotechnology and Biological Sciences Research Council. Back

2 Address correspondence and reprint requests to Dr. Jo Spencer, Department of Immunobiology, Kings College London School of Medicine at Guy’s King’s College and St. Thomas’ Hospitals, Guy’s Campus, St. Thomas’ Street, London SE1 9RT, U.K. E-mail address: jo.spencer{at}kcl.ac.uk Back

3 Abbreviations used in this paper: PC, plasma cell; {kappa}, {kappa} L chain; {lambda}, {lambda} L chain; KDE, kappa-deleting element; REC, recombination excision circle; RSS, recombination signal sequence; AID, activation-induced deaminase. Back

Received for publication January 30, 2008. Accepted for publication May 13, 2008.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Conley, M. E., D. L. Delacroix. 1987. Intravascular and mucosal immunoglobulin A: two separate but related systems of immune defense?. Ann. Intern. Med. 106: 892-899. [Abstract/Free Full Text]
  2. Brandtzaeg, P., I. N. Farstad, F. E. Johansen, H. C. Morton, I. N. Norderhaug, T. Yamanaka. 1999. The B-cell system of human mucosae and exocrine glands. Immunol. Rev. 171: 45-87. [Medline]
  3. Fagarasan, S., M. Muramatsu, K. Suzuki, H. Nagaoka, H. Hiai, T. Honjo. 2002. Critical roles of activation-induced cytidine deaminase in the homeostasis of gut flora. Science 298: 1424-1427. [Abstract/Free Full Text]
  4. Holtmeier, W., A. Hennemann, W. F. Caspary. 2000. IgA and IgM V(H) repertoires in human colon: evidence for clonally expanded B cells that are widely disseminated. Gastroenterology 119: 1253-1266. [Medline]
  5. Boursier, L., J. N. Gordon, S. Thiagamoorthy, J. D. Edgeworth, J. Spencer. 2005. Human intestinal IgA response is generated in the organized gut-associated lymphoid tissue but not in the lamina propria: human intestinal IgA response is generated in the organized gut-associated lymphoid tissue but not in the lamina propria. Gastroenterology 128: 1879-1889. [Medline]
  6. Brauninger, A., T. Goossens, K. Rajewsky, R. Kuppers. 2001. Regulation of immunoglobulin light chain gene rearrangements during early B cell development in the human. Eur. J. Immunol. 31: 3631-3637. [Medline]
  7. Klein, F., N. Feldhahn, J. L. Mooster, M. Sprangers, W. K. Hofmann, P. Wernet, M. Wartenberg, M. Muschen. 2005. Tracing the pre-B to immature B cell transition in human leukemia cells reveals a coordinated sequence of primary and secondary IGK gene rearrangement, IGK deletion, and IGL gene rearrangement. J. Immunol. 174: 367-375. [Abstract/Free Full Text]
  8. Goossens, T., A. Brauninger, U. Klein, R. Kuppers, K. Rajewsky. 2001. Receptor revision plays no major role in shaping the receptor repertoire of human memory B cells after the onset of somatic hypermutation. Eur. J. Immunol. 31: 3638-3648. [Medline]
  9. Dunn-Walters, D. K., M. Hackett, L. Boursier, P. J. Ciclitira, P. Morgan, S. J. Challacombe, J. Spencer. 2000. Characteristics of human IgA and IgM genes used by plasma cells in the salivary gland resemble those used in duodenum but not those used in the spleen. J. Immunol. 164: 1595-1601. [Abstract/Free Full Text]
  10. Su, W., L. Boursier, A. Padala, J. D. Sanderson, J. Spencer. 2004. Biases in Ig lambda light chain rearrangements in human intestinal plasma cells. J. Immunol. 172: 2360-2366. [Abstract/Free Full Text]
  11. Banerjee, M., R. Mehr, A. Belelovsky, J. Spencer, D. K. Dunn-Walters. 2002. Age- and tissue-specific differences in human germinal center B cell selection revealed by analysis of IgVH gene hypermutation and lineage trees. Eur. J. Immunol. 32: 1947-1957. [Medline]
  12. González-Fernández, A., D. Gilmore, C. Milstein. 1994. Age-related decrease in the proportion of germinal center B cells from mouse Peyer’s patches is accompanied by an accumulation of somatic mutations in their immunoglobulin genes. Eur. J. Immunol. 24: 2918-2921. [Medline]
  13. Brandtzaeg, P., E. S. Baekkevold, H. C. Morton. 2001. From B to A the mucosal way. Nat. Immunol. 2: 1093-1094. [Medline]
  14. Casola, S., K. L. Otipoby, M. Alimzhanov, S. Humme, N. Uyttersprot, J. L. Kutok, M. C. Carroll, K. Rajewsky. 2004. B cell receptor signal strength determines B cell fate. Nat. Immunol. 5: 317-327. [Medline]
  15. Girschick, H. J., A. C. Grammer, T. Nanki, E. Vazquez, P. E. Lipsky. 2002. Expression of recombination activating genes 1 and 2 in peripheral B cells of patients with systemic lupus erythematosus. Arthritis Rheum. 46: 1255-1263. [Medline]
  16. Rosenquist, R., F. Menestrina, M. Lestani, R. Kuppers, M. L. Hansmann, A. Brauninger. 2004. Indications for peripheral light-chain revision and somatic hypermutation without a functional B-cell receptor in precursors of a composite diffuse large B-cell and Hodgkin’s lymphoma. Lab. Invest. 84: 253-262. [Medline]
  17. Giachino, C., E. Padovan, A. Lanzavecchia. 1998. Re-expression of RAG-1 and RAG-2 genes and evidence for secondary rearrangements in human germinal center B lymphocytes. Eur. J. Immunol. 28: 3506-3513. [Medline]
  18. Meru, N., A. Jung, I. Baumann, G. Niedobitek. 2002. Expression of the recombination-activating genes in extrafollicular lymphocytes but no apparent reinduction in germinal center reactions in human tonsils. Blood 99: 531-537. [Abstract/Free Full Text]
  19. Yu, W., H. Nagaoka, M. Jankovic, Z. Misulovin, H. Suh, A. Rolink, F. Melchers, E. Meffre, M. C. Nussenzweig. 1999. Continued RAG expression in late stages of B cell development and no apparent re-induction after immunization. Nature 400: 682-687. [Medline]
  20. Clarke, S. H., L. M. Staudt, J. Kavaler, D. Schwartz, W. U. Gerhard, M.G. Weigert. 1990. V region gene usage and somatic mutation in the primary and secondary responses to influenza virus hemagglutinin. J. Immunol. 144: 2795-2801. [Abstract]
  21. Kavaler, J., A. J. Caton, L. M. Staudt, W. A. Gerhard. 1991. B cell population that dominates the primary response to influenza virus hemagglutinin does not participate in the memory response. Eur. J. Immunol. 21: 2687-2695. [Medline]
  22. Shannon, M., R. Mehr. 1999. Reconciling repertoire shift with affinity maturation: the role of deleterious mutations. J. Immunol. 162: 3950-3956. [Abstract/Free Full Text]
  23. Kleinstein, S. H., Y. Louzoun, M. J. Shlomchik. 2003. Estimating hypermutation rates from clonal tree data. J. Immunol. 171: 4639-4649. [Abstract/Free Full Text]
  24. Reynaud, C. A., C. Garcia, W. R. Hein, J. C. Weill. 1995. Hypermutation generating the sheep immunoglobulin repertoire is an antigen-independent process. Cell 80: 115-125. [Medline]
  25. Mehr, R., H. Edelman, D. Sehgal, R. Mage. 2004. Analysis of mutational lineage trees from sites of primary and secondary Ig gene diversification in rabbits and chickens. J. Immunol. 172: 4790-4796. [Abstract/Free Full Text]
  26. Traggiai, E., S. Becker, K. Subbarao, L. Kolesnikova, Y. Uematsu, M. R. Gismondo, B. R. Murphy, R. Rappuoli, A. Lanzavecchia. 2004. An efficient method to make human monoclonal antibodies from memory B cells: potent neutralization of SARS coronavirus. Nat. Med. 10: 871-875. [Medline]
  27. Foster, S. J., H. P. Brezinsche, R. I. Brezinschek, P. E. Lipsky. 1997. Molecular mechanisms and selective influences that shape the {kappa} gene repertoire of IgM+ B cells. J. Clin. Invest. 99: 1614-6427. [Medline]
  28. Farner, N. L., T. Dorner, P. E. Lipsky. 1999. Molecular mechanisms and selection influence the generation of the human V {lambda} J {lambda} repertoire. J. Immunol. 162: 2137-2145. [Abstract/Free Full Text]
  29. Chothia, C., A. M. Lesk, E. Gherardi, I. M. Tomlinson, G. Walter, J. D. Marks, M. B. Llewelyn, G. Winter. 1992. Structural repertoire of the human VH segments. J. Mol. Biol. 227: 799-817. [Medline]
  30. Coker, H. A., S. R. Durham, H. J. Gould. 2003. Local somatic hypermutation and class switch recombination in the nasal mucosa of allergic rhinitis patients. J. Immunol. 171: 5602-5610. [Abstract/Free Full Text]
  31. Casellas, R., Q. Zhang, N. Y. Zheng, M. D. Mathias, K. Smith, P. C. Wilson. 2007. Ig{kappa} allelic inclusion is a consequence of receptor editing. J. Exp. Med. 204: 153-160. [Abstract/Free Full Text]
  32. Diss, T. C., H. Peng, A. C. Wotherspoon, P. G. Isaacson, L. Pan. 1993. Detection of monoclonality in low-grade B-cell lymphomas using the polymerase chain reaction is dependent on primer selection and lymphoma type. J. Pathol. 169: 291-295. [Medline]
  33. Nadel, B., A. Tang, A. J. Feeney. 1998. V(H) replacement is unlikely to contribute significantly to receptor editing due to an ineffectual embedded recombination signal sequence. Mol. Immunol. 35: 227-232. [Medline]
  34. Zhang, Z., X. Wu, B. H. Limbaugh, S. L. Bridges, Jr. 2001. Expression of recombination-activating genes and terminal deoxynucleotidyl transferase and secondary rearrangement of immunoglobulin {kappa} light chains in rheumatoid arthritis synovial tissue. Arthritis Rheum. 44: 2275-2284. [Medline]
  35. Allen, C. D., T. Okada, H. L. Tang, J. G. Cyster. Imaging of germinal center selection events during affinity maturation. Science 315: 528-531.
  36. Suzuki, K., Y. Akahori, Y. Asano, Y. Kurosawa, K. Shiraki. 2007. Isolation of therapeutic human monoclonal antibodies for varicella-zoster virus and the effect of light chains on the neutralizing activity. J. Med. Virol. 79: 852-862. [Medline]
  37. de Wildt, R. M., R. M. Hoet, W. J. van Venrooij, I. M. Tomlinson, G. Winter. 1999. Analysis of heavy and light chain pairings indicates that receptor editing shapes the human antibody repertoire. J. Mol. Biol. 285: 895-901. [Medline]
  38. Girschick, H. J., A. C. Grammer, T. Nanki, M. Mayo, P. E. Lipsky. 2001. RAG1 and RAG2 expression by B cell subsets from human tonsil and peripheral blood. J. Immunol. 166: 377-386. [Abstract/Free Full Text]
  39. Hillion, S., M. Dueymes, P. Youinou, C. Jamin. 2007. IL-6 contributes to the expression of RAGs in human mature B cells. J. Immunol. 179: 6790-6798. [Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Su, W.
Right arrow Articles by Spencer, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Su, W.
Right arrow Articles by Spencer, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS