|
|
||||||||




* Institute of Microbiology, Swiss Federal Institute of Technology, Zurich, Switzerland;
Department of Molecular Microbiology and Immunology, Oregon Health and Science University, Portland, OR 97239; and
Institute for Virology, Heinrich-Heine-University, Düsseldorf, Germany
| Abstract |
|---|
|
|
|---|
and TNF-
and to some extent IL-2, cytokines which are involved in protection from CMV disease. | Introduction |
|---|
|
|
|---|
170 open reading frames (ORFs) (1). Despite vigorous immune activation after primary infection, human CMV (HCMV) as well as MCMV persist in their host and establish latency.
NK cells play a major role in limiting viral replication and reducing viral load, especially at early time points during acute MCMV infection (2). Although primed B cells and T cells exert antiviral effects and are able to reduce viral replication after adoptive transfer in acutely infected recipient mice (2, 3), mice deprived of either CD8 T cell or B cell functions are able to control production of infectious virus with similar kinetics as their wild-type (wt) counterparts (2). However, in the absence of CD4 T cells, control of lytic virus is impaired in various organs, in particular in the salivary glands where shedding of infectious virus persists (2). It is believed that CD4 T cells inhibit MCMV replication at least to a certain extent by local secretion of TNF-
and IFN-
(2). However, the exact mechanisms of how CD4 T cells exert their protective functions remain elusive. Evidence that CD4 T cells are crucial to control of CMV infection also come from human studies; in HIV-1-infected patients, CMV end-organ disease correlates with the loss of HCMV-specific CD4 T cells (4). Furthermore, in transplant recipients, early expansion of HCMV-specific CD4 T cells protected from symptomatic disease (5) and impaired induction of HCMV-specific CD4 T cells in children is believed to be the cause of prolonged virus shedding (6). In humans, direct antiviral effects such as cytokine secretion and cytotoxicity (7) as well as helper functions (8) of CD4 T cells are proposed to contribute to control of viral replication.
Analysis of effector CD4 T cells during MCMV infection has been hampered because no virus-specific CD4 T cell epitopes have been described so far. Although HCMV-specific CD4 T cell epitopes were described previously (9), longitudinal analysis of CD4 T cell responses in humans is often limited to patients undergoing organ transplantation (5, 10), due to the fact that primary infection is clinically silent in healthy individuals and hence usually undiagnosed.
To assess the CD4 T cell response during acute and persistent MCMV infection, we first identified virus-specific CD4 T cell epitopes with the help of newly generated MCMV-specific CD4 T cell hybridomas. Using the identified MCMV-specific CD4 T cell epitopes, we were able to study for the first time long-term kinetics, organ distribution, and functional characteristics of MCMV-specific CD4 T cells.
| Materials and Methods |
|---|
|
|
|---|
C57BL/6 mice were kept under specific pathogen-free conditions and were infected i.v. with 107 PFU of MCMV. Animal experiments were performed according to the regulations of the cantonal veterinary office.
When indicated, mice were injected i.p. with 0.2 mg of purified anti-mouse CD4 YTS 191.1 mAb (11). For continuous depletion, mice were injected 3 and 1 days before immunization and then weekly. Depletion was analyzed by flow cytometry and was >95%.
The H-2Kb-restricted M45aa985–993 and M38aa316–323 peptides were purchased from NeoMPS. Overlapping peptides used to identify CD4 T cell epitopes recognized by MCMV-specific CD4 T cell hybridomas were 15-aa long with a 10-aa overlap and were purchased from EMC Microcollections.
Viruses
Recombinant MCMV-
m157 (lacking the m157 gene of MCMV) was generated according to a previously published procedure (12) using bacterial artificial chromosome (BAC) plasmid pSM3fr (13). Specifically, for construction of the
m157-MCMV mutant, a PCR fragment was generated from the contiguous primers AZ-M157-1 (5'-CAGGAGAATCTGAACCCCGATATTTGAGAAAGTGTACCCCGATATTCAGTACCTCTTGAC CCAGTGAATTCGAGCTCGGTAC-3') and AZ-M157-2 (5'-AGATCGTGACCATTATCACCAAGATAGTTCCCACCATAATTCCCATCGTCACTAGAGTCGGACCATGATTACGCCAAGCTCC-3') using the plasmid pSLFRTKn (14) as template DNA. The PCR fragment containing a kanamycin resistance gene (Knr) was inserted into pSM3fr by homologous recombination in Escherichia coli replacing the m157 gene region. The Knr was excised by FLP-mediated recombination (12) generating pSM3fr-
m157. Correct mutagenesis of the recombinant MCMV-BAC was confirmed by restriction analysis and sequencing of the m157 genome region (data not shown). Recombinant virus
m157-MCMV was reconstituted by transfection of mouse embryonic fibroblasts (MEF) using Superfect reagent (Qiagen). Residual BAC sequences were removed by sequential cell culture passages as described elsewhere (13).
BAC-derived MCMV MW97.01 was provided by Prof. U. H. Koszinowski (Max von Pettenkofer-Institute, Ludwig-Maximilions University, Munich, Germany) and is here referred to as MCMV.
MCMV was propagated on MEFs and viral titers were determined using plaque-forming assays as described previously (15).
Generation of CD4 T cell hybridomas
C57BL/6 mice were immunized s.c. with UV-inactivated MCMV (3 x 107 PFU) in IFA (Sigma-Aldrich) supplemented with 10 nmol of CpG oligonucleotide 1668 (5'-TCCATGACGTTCCTGAATAAT-3', PTO-bonds). At the earliest 2 wk later, mice were challenged with 107 live wt MCMV i.v. and, 7 days later, spleen cells were isolated and activated for 3 days with 10 µg/ml crude MCMV lysate before cells were fused with the BW5147
–β– cell line (provided by Dr. R. M. Zinkernagel, University Hospital, Zurich, Switzerland) according to the protocol described by Kruisbeek (16).
To test the specificity of CD4 T cell hybridomas, cells were stimulated with thioglycolate-induced peritoneal C57BL/6 macrophages that were pulsed with either crude MCMV lysate or overlapping peptides. Twenty-four hours later, IL-2 production by the hybridomas was evaluated by an IL-2 bioassay (incubating supernatant with the IL-2-sensitive cell line CTLL-2 (ATCC TIB-214)). Survival of CTTL-2 cells was determined the following day by microscopy or using the AlamarBlue cell viability assay (Lucerna Chem).
Cell transfection and lysate production
MCMV lysate production. Crude MCMV lysate production was adapted from Refs. 17 and 18 . MEFs were infected with MCMV and once cells started to round up, they were harvested, centrifuged, and the supernatant was discarded. A pellet of one 150-cm2 tissue culture flask was resuspended in 0.5 ml of glycine buffer (0.1 M glycine and 0.9% NaCl, pH 9.75). After an incubation period of 20 min at 4°C, the cell lysate was sonicated four times for 10 s.
Lysate production of MCMV protein expression library. HEK cells propagated in DMEM/10% FCS were transfected with individual plasmids of a MCMV ORF library (19) using JetPEI transfection reagent (Chemie Brunschwig) according to the manufacturers instructions. Two days later, transfected HEK cells were harvested and the cell lysate was prepared as described above.
Antibodies
The following mAbs were purchased from BD Pharmingen and used for stainings: anti-CD8 (FITC, PerCP, allophycocyanin), anti-CD4 (PE, PerCP), anti-IFN-
(allophycocyanin or FITC), anti-TNF-
(FITC), anti-IL-2 (allophyocyanin), anti-IL-4 (PE), anti-IL-10 (PE), anti-IL-17 (PE).
Cell stimulation, immunofluorescent staining, and analysis
Lymphocytes were isolated from spleen, lung, liver, and salivary glands as previously described (20) and single-cell suspensions were used for 6 h in in vitro restimulations. CD8 T cells were stimulated with 1 µg/ml peptide and CD4 T cells with 5 µg/ml peptides or with cell lysates. In case cell lysates were used for CD4 T cell stimulations, the isolated lymphocytes were first rested overnight at 37°C before CD4 T cells were purified by magnetic cell sorting according to the manufacturers instruction (Miltenyi Biotec). Purified cell fractions were stimulated in the presence of thioglycolate-elicited peritoneal macrophages that had been pulsed with 20 µg/ml cell lysate overnight before adding CD4 T cells. For the final 6 h of stimulation, monensin A or brefeldin A was added to the cultures. Cells were harvested and first stained at 4°C for 20 min for cell surface markers before fixation and permeabilization (using 500 µl of Fix/Perm Solution (FACSLyse; BD Biosciences) diluted to 2x concentration with H2O and 0.05% Tween 20 (Sigma-Aldrich)), followed by intracellular staining at room temperature for 20 min. Cells were washed and resuspended in PBS containing 1% paraformaldehyde (Sigma-Aldrich). Multiparameter flow cytometric analysis was performed using a FACS LSRII flow cytometer (BD Biosciences) with FACSDiva software (BD Biosciences). List mode data were analyzed using FlowJo software (Tree Star).
| Results |
|---|
|
|
|---|
With the aim to identify MCMV-derived CD4 T cell protein Ags and epitopes, we generated MCMV-specific CD4 T cell hybridomas. To this end, we immunized C57BL/6 (B6) mice with UV-inactivated MCMV (3 x 107 PFU) in IFA plus CpG oligonucleotide followed by infection with live MCMV. Spleen cells from these mice were fused with the BW
–β– lymphoma cell line and resulting CD4+TCRβ+ hybridoma clones were screened for MCMV specificity. We used lysates of MCMV-infected MEFs as Ags in combination with thioglycolate-induced macrophages from B6 mice to test for activation of the respective T cell hybridoma clones. Activation was assessed by measuring induced IL-2 secretion. Twenty-six CD4 T cell hybridomas tested positive for recognition of MCMV lysates. Next, we analyzed the MCMV protein specificity of these hybridomas. To this end, we used a recently published MCMV protein expression library which includes 170 ORFs of MCMV and hence most of the so far known viral ORFs (19). All 170 plasmids were individually transfected into 293 HEK cells and 2 days after transfection crude lysates were generated. These lysates were used individually as Ags for the stimulation of the 26 MCMV-specific CD4 T cell hybridomas. For 9 of the 26 MCMV-specific hybridomas, the MCMV protein recognized was identified (Table I). These nine hybridomas were specific for four different protein Ags. For the remaining 17 clones, the MCMV protein specificity could not be determined with this approach, either because the ORF they are specific for is not present in the library or the protein they are specific for is expressed poorly or unstable in the transfected HEK cells. Furthermore, not all Ags may be presented as well by thioglycolate-elicited macrophages.
|
Increased MCMV-specific CD4 T cell response after infection with the recombinant MCMV-
m157 strain compared with wt MCMV
Infection with wt MCMV induces modest frequencies of MCMV-specific CD4 T cells, assessed by IFN-
-secretion after stimulation with crude MCMV lysate (Fig. 1). With the aim of enhancing MCMV-specific CD4 T cell responses, we infected B6 mice with a recombinant MCMV that lacks the m157 gene (MCMV-
m157). The gene product of m157 encoded on the viral genome interacts with the NK-activating receptor Ly49H present on a subset of NK cells of B6 mice. Bubic et al. (21) showed that B6 mice infected with MCMV-
m157 have increased virus titers in various organs due to impaired viral activation of Ly49H+ NK cells. When we infected B6 mice with either MCMV or MCMV-
m157, MCMV-specific CD4 T cell responses were substantially increased in mice infected with MCMV-
m157 (Fig. 1). Accordingly, MCMV-specific CD8 T cells were present at higher frequencies after MCMV-
m157 compared with MCMV infection. Although the CD4 T cell response increased severalfold, the CD8 T cell response only increased slightly (data not shown). However, the overall kinetics of T cell responses were comparable after infection with both virus strains (data not shown). The increase of MCMV-specific T cell response is most likely due to the higher Ag burden seen after infection with MCMV-
m157 (Fig. 1B).
|
To verify that CD4 T cell responses against the MCMV proteins m14, M25, M112, and m142, recognized by at least one MCMV-specific CD4 T cell hybridoma, are indeed induced in vivo during MCMV infection, and to further characterize the overall specificities of the MCMV-specific CD4 T cell response, we incubated CD4 T cells from acutely infected mice (day 7) individually with the protein lysates of the MCMV expression library and assessed IFN-
production within CD4 T cells after short-term stimulation. Already in the absence of Ag exposure, 0.4% of CD4 T cells of acutely infected mice secreted IFN-
ex vivo (Fig. 2, medium), indicating that these cells were highly activated, most likely by exposure to MCMV Ag in vivo. Incubation with lysates from untransfected HEK cells (Fig. 2, mock) did not increase the IFN-
production above this level, indicating that the human origin of the HEK cell lysates was not perturbing our analysis. However, incubation of CD4 T cells from acutely infected mice with lysates from HEK cells that had been transfected with an irrelevant Ag (such as β-galactosidase) increased the background slightly to
0.9% IFN-
-producing CD4 T cells. The reason for this increase in unspecific IFN-
production remains unclear at the moment. Due to the high activation status of CD4 T cells at early stages of MCMV infection, we set a threshold at 1.2% IFN-
-secreting CD4 T cells (Fig. 2A, solid line) as the lower limit of a positive response toward the recombinantly expressed MCMV proteins in the HEK cell lysates. Using this threshold, we could verify that all of the MCMV proteins recognized by the CD4 T cell hybridomas (m14, M25, m112, m142) elicited CD4 T cell responses ex vivo above background levels (Fig. 2, red bars). Furthermore, we were able to identify additional 32 MCMV proteins (Fig. 2, yellow bars) that were recognized by CD4 T cells during acute virus infection. Interestingly, the M25 protein was clearly the immunodominant protein in our analysis with over 4% of CD4 T cells being specific for this protein. This nicely correlates with the high abundance of M25-specific CD4 T cell hybridomas in our panel of MCMV-specific CD4 T cell hybridomas (Table I). Aside from the M25 protein, CD4 T cells broadly target MCMV proteins but no other MCMV protein by itself reached values comparable to the overall MCMV-specific CD4 T cell response of 14% (Fig. 2, inset) or even comparable to the M25 protein (4%).
|
|
During latent MCMV infection, CD8 T cells specific for some epitopes such as M38aa316–323 accumulate over time, whereas frequencies of CD8 T cells specific for other epitopes such as M45aa985–993 stay stable over long periods of time. To directly compare CD4 and CD8 T cell kinetics during MCMV infection, overall MCMV-specific CD4 T cell responses, CD8 T cell responses against the epitopes M45aa985–993 and M38aa316–323, representing major CD8 T cell epitopes in B6 mice (22), as well as viral titers were measured at various time points after MCMV infection. MCMV-specific CD4 T cell responses and MCMV-specific CD8 T cell responses were determined using intracellular IFN-
staining after short-term ex vivo stimulation with crude MCMV lysate (Fig. 4, solid line) or MCMV-specific CD8 T cell epitopes M45aa985–993 (
) and M38aa316–323 (
), respectively. In addition to lymphoid organs such as the spleen, we included also peripheral tissues where virus replicates for extended periods of time (Fig. 4). During acute infection, MCMV-specific CD4 T cells and MCMV-specific CD8 T cell responses greatly expanded during the first 5–6 days after infection, peaking at day 8 after infection and sharply contracting thereafter. At day 14 after infection, MCMV-specific CD4 T cells were already at very low levels, although virus replication had not ceased in most of the organs analyzed. Interestingly, the kinetics of MCMV-specific CD4 T cell responses were delayed in the salivary glands, reaching detectable levels only at day 7 after infection and peaking of the response was at day 10. These delayed kinetics might reflect the lag period in appearance of MCMV replication in this tissue, suggesting that activated T cells are only recruited to infected organs secondary to expansion in secondary lymphoid organs. Expansion, contraction, and early memory CD4 T cell responses to lysates of MCMV-infected MEFs were similar to responses directed against the identified CD4 T cell epitopes (Fig. 3). Intriguingly, overall MCMV-specific CD4 T cell responses as well as CD4 T cell responses specific for the identified epitopes did not accumulate over time, although a subpopulation of their CD8 T cell counterparts did accumulate in the spleen, lung, and liver.
|
MCMV-specific CD4 T cells are required for control of MCMV-
m157 infection
Jonjic et al. (24) showed that CD4 T cells are crucial in BALB/c mice to control infectious virus production after MCMV wt infection, especially in the salivary glands. We showed in Fig. 4A that MCMV-specific CD4 T cell responses peak early and contract sharply to very low levels during acute infection in B6 mice. Within 2 wk of infection, CD4 T cells specific for MCMV are barely detectable anymore even though virus replication persists in various organs. To demonstrate that MCMV-specific CD4 T cells, despite their low level, are crucial to control viremia in B6 after MCMV-
m157 infection, we depleted CD4 T cells during the course of infection by administration of CD4-depleting Abs. Indeed, in the absence of CD4 T cells, control of virus replication was impaired, especially in the salivary glands but also in other organs such as the lung (Fig. 4C). This demonstrates that although present at low numbers 2 wk after MCMV infection, virus-specific CD4 T cells exert antiviral effector functions that are essential for viral control.
Cytokine profile of MCMV-specific CD4 T cells
To get deeper insight into how MCMV-specific CD4 T cells protect the host from infectious virus replication, we analyzed the cytokine profile of virus-specific CD4 T cells during acute infection. Effector CD4 T cells can broadly be divided into three lineages: the Th1, Th2, and Th17 lineages. CD4 T cells of the Th1 lineage secrete high amounts of IFN-
and are important for control of many intracellular pathogens, whereas Th2 effector CD4 T cells preferentially produce IL-4, IL-5, IL-13, and IL-25 and play a role in control of helminth infections. The more recently described Th17 lineage produces as its key cytokine IL-17 and is involved in protection against certain extracellular pathogens and fungi (25). To investigate the cytokine profile of MCMV-specific CD4 T cells during acute MCMV infection, CD4 T cells were isolated from different organs, restimulated with lysate from MCMV-infected MEFs, and production of IFN-
, TNF-
, IL-4, and IL-17 was analyzed (Fig. 5). The MCMV-specific CD4 T cell response was dominated by the Th1 lineage, demonstrated by high frequencies of IFN-
and TNF-
double-producing CD4 T cells. Significant frequencies of neither IL-4- nor IL-17- producing CD4 T cells were detected at any time point or organ analyzed. Effector CD4 T cells can also secrete IL-2 and IL-10 in response to certain pathogens. During MCMV infection, IL-2- secreting CD4 T cells were only detectable at later time points after (between days 8 and 14) infection (Fig. 5B) and were consistently double positive for IL-2 and IFN-
(Fig. 5B). IL-10- secreting CD4 T cells were only detected at very low frequencies, which varied between experiments. However, in the experiments in which we were able to detect a small population of IL-10-producing MCMV-specific CD4 T cells (only seen at days 8–10 postinfection), they concomitantly secreted IFN-
.
|
| Discussion |
|---|
|
|
|---|
When we analyzed the overall MCMV protein specificities of CD4 T cells after acute MCMV infection, we identified 32 MCMV proteins which were able to stimulate IFN-
production (Fig. 2). The functions and cellular localization of these viral proteins were also diverse, as was found for the proteins recognized by the CD4 T cell hybridomas: 16 proteins are present in the virion (31, 32), 5 proteins are members of the endoplasmic reticulum-Golgi network (1, 33), 1 protein is present mainly in the nucleus of infected cells (30), and for the remaining 14 proteins the function and cellular localization is unknown. This finding in murine CMV infection is reminiscent of HCMV infection, since also during HCMV infection the specificities of CD4 T cell responses are broad and diverse: 40 of the 213 examined ORFs were recognized by CD4 T cells of seropositive individuals ex vivo (9). In summary, many MCMV proteins independent of their expression kinetics or function are Ags for CD4 T cells at the early stage of MCMV infection.
B6 mice infected with MCMV-
m157 exhibit a decreased NK cell response (data not shown and Ref. 21) and consequently increased viral titers in various organs. MCMV-specific CD4 as well as CD8 T cell responses were enhanced in B6 mice infected with recombinant MCMV-
m157 compared with mice infected with wt MCMV (Fig. 1 and data not shown), most likely due to the increased Ag burden. However, it is also conceivable that MCMV-
m157-infected APCs that do not express m157 on their cell surface are not recognized and killed by NK cells, which would result in higher numbers of APCs. Hence, Ag presentation and priming of virus-specific CD4 and CD8 T cells would be facilitated in the absence of the m157 gene which might lead to increased induction of MCMV-specific T cell responses. Interestingly, the enhanced adaptive immune response seen after MCMV-
m157 cannot compensate for the decreased NK cell activation because viral burdens remain higher after MCMV-
m157 infection compared with wt MCMV infection even at later time points when virus-specific CD4 and CD8 T cells are substantially augmented.
The long-term kinetics of MCMV-specific CD8 T cell responses are very peculiar, as the dynamics of MCMV-specific CD8 T cells differ substantially depending on the epitope specificity. The overall MCMV-specific CD8 T cell response can be subdivided into four different dynamic patterns in B6 mice (22). Although CD8 T cells specific for certain epitopes such as M45aa985–993 stabilize in frequencies and numbers during the latent phase of infection, CD8 T cell subsets for other epitopes such as M38aa316–323 increase over the course of infection (memory inflation). Similar divergent kinetics of CD8 T cells were also described in BALB/c mice (34) as well as in HCMV infection where HCMV-specific CD8 T cell frequencies are highly increased in elderly compared with young individuals (35, 36). With respect to CMV-specific CD4 T cell dynamics, data from human as well as rhesus macaque studies also indicated an "inflationary" behavior of CMV-specific CD4 T cells in seropositive individuals during latent stages of infection (37, 38).
Interestingly, overall MCMV-specific CD4 T cell frequencies stayed at stable low levels during the course of latent infection. However, at this point, we cannot exclude that there is some degree of accumulation of CD4 T cells specific for certain MCMV epitopes over time as our analysis might have missed small accumulations of CD4 T cells specific for individual epitopes. However, we can clearly show that there is no significant overall accumulation of MCMV-specific CD4 T cells over time in all organs analyzed. Furthermore, our studies were limited to the assessment of IFN-
-secreting CD4 T cells after short-term ex vivo restimulation. It is possible that CD4 T cells are driven into partial exhaustion during the latent phase of MCMV infection and, although still present at the physical level, might not be able to secrete cytokines such as IFN-
after in vitro stimulation, as was proposed for HCMV infection (39). With our present analysis, we cannot exclude such a scenario of induction of unresponsiveness; however, this seems unlikely because the Ag loads during latent infection will be considerably lower compared with acute viremic infection. The finding that overall MCMV-specific CD4 T cells do not substantially inflate during MCMV latency stands in contrast to studies with HCMV where it was shown that elderly people have higher frequencies of HCMV-specific CD4 T cell populations (37).
The discrepancy in kinetics of CD4 vs CD8 T cell responses may be explained by different requirements of these T cell subsets for priming and memory formation. CD4 T cells require a longer Ag exposure, are more dependent on costimulatory signals, proliferate less vigorously after Ag encounter, and need different cytokine environments for expansion (40). Furthermore, MHC class II molecules are present on fewer cells in the body than MHC class I molecules. During latency, when Ag is limiting, these factors may play a major role for the accumulation of MCMV-specific CD8 T cell responses in comparison to MCMV-specific CD4 T cell responses. Furthermore, it is also possible that immunosuppressive functions exerted by MCMV impair the CD4 T cell responses considerably more than the MCMV-specific CD8 T cell responses.
The MCMV-specific CD4 T cell response was dominated by the Th1 lineage demonstrated by high frequencies of IFN-
and TNF-
double producing but no IL-4- or IL-17-secreting CD4 T cells. This phenotype reflects the cytokine profile of CD4 T cells seen during HCMV infection in humans (5, 7) and is most common during viral infections. The functional role of IFN-
- and TNF-
-secreting CD4 T cells in control of MCMV infection is demonstrated by the observation that in vivo neutralization of IFN-
as well as TNF-
reduced the antiviral effects of CD4 T cells during MCMV infection (2). Between days 8 and 14, a subset of virus-specific CD4 T cells secreted IL-2. This cytokine is crucial for T cell growth and differentiation but also for maintaining peripheral tolerance. Since IL-2R signaling was shown to be crucial for the continuous expansion of MCMV-specific CD8 T cell populations over time (41), it is tempting to hypothesize that CD4 T cells are the source of IL-2 required for the memory CD8 T cell inflation. At days 8 and 10 after infection, low frequencies of IL-10-secreting MCMV-specific CD4 T cells could be detected in some experiments. IL-10 is an anti-inflammatory cytokine that can be produced by a wide range of immune cells. Interestingly, in vivo blocking of IL-10 signaling during MCMV infection increased numbers of CD4 T cells which could be triggered to produce IFN-
after unspecific TCR stimulation. This was associated with reduced virus titers in the salivary glands but also with increased immunopathology (27, 42).
In summary, we identified five MCMV-specific CD4 T cell epitopes, including the immunodominant epitope M25aa411–425. During acute infection, MCMV-specific CD4 T cell expansion peaked between days 7 and 8 and thereafter T cell frequencies rapidly declined. A longitudinal analysis of MCMV-specific CD4 T cell frequencies clearly argues against a marked accumulation of MCMV-specific CD4 T cells during latent infection in any organ examined. This stands in clear contrast to the accumulation of certain MCMV-specific CD8 T cell populations over time and to observations in humans where aged seropositive individuals had a significantly increased HCMV-specific CD4 T cell population compared with a younger control group.
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by the Roche Research Fund for Biology, the Eidgenössiche Technische Hochschule Zurich, Deutsche Forschungsgemeinschaft He 2526/7-1, the Swiss National Science Foundation, the Roche Research Foundation, the Vontobel Foundation, and the European Molecular Biology Organization Young Investigator Programme. ![]()
2 Address correspondence and reprint requests to Dr. Annette Oxenius, Swiss Federal Institute of Technology, Institute for Microbiology, Eidgenössische Technische Hochschule Zurich, Wolfgang-Pauli-Strasse 10, HCI G401, 8093 Zurich, Switzerland. E-mail address: oxenius{at}micro.biol.ethz.ch ![]()
3 Abbreviations used in this paper: MCMV, mouse CMV; ORF, open reading frame; HCMV, human CMV; BAC, bacterial artificial chromosome; MEF, mouse embryonic fibroblast; wt, wild type; FLP, protein encoded by the FLP gene of the 2-micron plasmid of yeast. ![]()
Received for publication February 25, 2008. Accepted for publication May 8, 2008.
| References |
|---|
|
|
|---|
-producing CD4+ T cells in protection against CMV disease. Blood 101: 2686-2692.
receptor homologs. J. Virol. 76: 8596-8608. This article has been cited by other articles:
![]() |
C. M. Snyder, A. Loewendorf, E. L. Bonnett, M. Croft, C. A. Benedict, and A. B. Hill CD4+ T Cell Help Has an Epitope-Dependent Impact on CD8+ T Cell Memory Inflation during Murine Cytomegalovirus Infection J. Immunol., September 15, 2009; 183(6): 3932 - 3941. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. B. Gombos, V. Wolan, K. McDonald, and D. G. Hemmings Impaired vascular function in mice with an active cytomegalovirus infection Am J Physiol Heart Circ Physiol, April 1, 2009; 296(4): H937 - H945. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |