|
|
||||||||
Induces Transcription of Hypoxia-Inducible Factor-1
to Inhibit Proliferation of Human Endothelial Cells1Interdepartmental Program in Vascular Biology and Therapeutics and Department of Immunobiology, School of Medicine, Yale University, New Haven, CT 06509
| Abstract |
|---|
|
|
|---|
, a transcription factor subunit increased by protein stabilization in response to hypoxia, is increased in human endothelial cells (ECs) by IFN-
under normoxic conditions. IFN-
increases HIF-1
transcript levels within 2 h by up to 50% and doubles HIF-1
protein expression. Based on pharmacological inhibition studies, the increase in HIF-1
mRNA involves new transcription, is independent of new protein synthesis, and requires JAK signaling. Protein knockdown by small interfering RNA confirms the involvement of JAK1 and TYK2, as well of IFN-stimulated gene factor 3 (ISGF3). IFN-
does not significantly induce HIF-1
mRNA, but increases the magnitude and duration of the IFN-
effect. IFN-
-induced HIF-1
protein translocates to the nucleus and can bind to hypoxia response elements in DNA. However, IFN-
treatment fails to induce transcription of several prototypic HIF-responsive genes (VEGF-A, PPAR
, and prostacyclin synthase) due to an insufficient increase in HIF-1
protein levels. Although certain other HIF-responsive genes (PHD3 and VEGF-C) are induced following IFN-
and/or IFN-
treatment, these responses are not inhibited by siRNA knockdown of HIF-1
. Additionally, IFN-
induction of ISGF3-dependent genes involved in innate immunity (viperin, OAS2, and CXCL10) are also unaffected by knockdown of HIF-1
. Interestingly, knockdown of HIF-1
significantly reduces the capacity of IFN-
to inhibit endothelial cell proliferation. We conclude that IFN-
induces the transcription of HIF-1
in human endothelial cells though a JAK-ISGF3 pathway under normoxic conditions, and that this response contributes to the antiproliferative activity of this cytokine. | Introduction |
|---|
|
|
|---|
and HIF-1β, which are constitutively transcribed in normoxic and hypoxic conditions (3, 4). HIF-1
protein expression, and consequently HIF-1 formation, is suppressed under normoxic conditions principally via a pathway initiated by hydroxylation of proline residues by oxygen-sensing prolyl hydroxylase domain (PHD) enzymes. This modification allows binding of the von Hippel-Lindau complex, which targets HIF-1
for ubiquitination and proteasomal degradation (5, 6, 7, 8). Hypoxia promotes HIF-1
protein accumulation by inhibiting PHD-mediated proline hydroxylation, allowing HIF-1
to escape degradation, enter the nucleus, and dimerize with HIF-1β to form HIF-1. HIF-1 then binds to hypoxia-response elements (HREs) on DNA and initiates expression of HIF-1 target genes. A similar response may be mediated in some cell types by hypoxia-mediated stabilization of HIF-2
, which also pairs with HIF-1β to form a functional heterodimeric transcription factor (9, 10). Among HIF-1 target genes are several that control blood vessel growth and survival, such as VEGF-A, VEGF-C, angiopoietin-like factor 4 (ANGPTL4), as well as genes related to anaerobic metabolism (1, 9, 10, 11, 12). HIF-1 also inhibits cell proliferation, a change that may be independent of HIF-1-induced gene expression and is thought to reduce further metabolic demand in settings of hypoxia (13, 14, 15). Vascular endothelial cells (ECs) respond to many proteins induced by HIF-1, and are themselves a HIF-responsive cell type (1, 10, 16, 17).
Although the importance of HIF-1
is well described in the context of hypoxia, recent data suggest that it may also play a role in innate immunity (18). Several reports have described effects of HIF-1 during inflammation (18, 19). Conditional HIF-1
knockout mice with a targeted deletion in myeloid cells demonstrated an impairment of leukocyte motility, invasiveness, and bacterial killing; these defects result from reduced cellular ATP pools caused by an inability to regulate glycolysis (20). Several inflammatory cytokines, such as IL-1, TNF, IL-4, and TGF-β, have been shown to induce HIF-1
in multiple cell types during normoxic conditions, but the mechanism controlling this induction may differ from that used by hypoxia (21, 22, 23, 24, 25, 26, 27, 28). Induced HIF-1
may specifically play a role in the innate immune response to viral infection. Infection with Epstein-Barr or hepatitis B virus can induce HIF-1
(29, 30, 31). Furthermore, HIF-1 stabilization enhances cellular resistance to vesicular stomatitis virus by promoting the expression of various antiviral genes (32). These reports did not specifically examine the effects of type I IFN-s (IFN-
or IFN-β), the principal mediators of the innate immune response to viral infection, on HIF-1
expression or function. Because vascular ECs are important targets of viral infection and targets of IFN-
-mediated responses (33, 34, 35, 36), we investigated whether type I IFNs could mediate the induction of HIF-1
in human ECs.
The type I IFN-signaling pathway is initiated by binding of a cytokine to a receptor composed of two subunits, IFN-AR1 and IFN-AR2. IFN-
-binding activates two JAKs, JAK1 and TYK2, that are constitutively associated with the intracellular domains of the heterodimeric receptor (37, 38). These enzymes phosphorylate specific tyrosine residues in the cytosolic portions of the receptor, thereby creating sites that recruit STAT1 and STAT2. The receptor-associated JAKs then phosphorylate tyrosine residues in the bound STAT1 and STAT2 proteins, which dissociate from the receptor, heterodimerize with each other, and then associate with IFN-regulatory factor-9 (IRF9) protein to form the heterotrimeric transcription factor IFN-stimulated gene factor 3 (ISGF3). The ISGF3 complex enters the nucleus and initiates transcription of target genes by binding to IFN-stimulated response elements (ISREs) present within the enhancers of these genes.
In addition to its specific activity to promote both adaptive and innate immunity, type I IFNs induce antiproliferative effects on many cell types, including ECs (39, 40, 41, 42, 43, 44). The cellular mechanisms that mediate these antiproliferative properties are not fully understood. In this study, we report that the type I IFN-signaling pathway induces transcription of HIF-1
following IFN-
stimulation of human ECs. Although IFN-
-induced HIF-1
translocates to the nucleus and is able to bind to hypoxia response element (HRE)-containing oligonucleotides, it generally fails to induce HIF-1-dependent gene expression during normoxia. However, induction of HIF-1 by IFN-
appears to function as an inhibitor of cell growth, contributing significantly to the antiproliferative properties of IFN-
.
| Materials and Methods |
|---|
|
|
|---|
All human cell populations were obtained using protocols approved by the Yale University Human Investigation Committee. HUVECs, human dermal microvascular ECs (HDMECs), the EaHy.926 cell line, human aortic smooth muscle cells (SMCs), human cord blood-derived ECs (HCBECs), and CD4+ T cells were isolated and cultured as previously described (45, 46, 47, 48, 49). All experiments using HUVECs were performed using subculture two or three cells that are free of contaminating CD45+ leukocytes.
Cytokines, Abs, and reagents
Recombinant human IFN-
2a, TNF, and IL-6 were purchased from R&D Systems. Recombinant human IFN-
was purchased from Invitrogen Life Technologies. rIL-1
was purchased from PeproTech. Cycloheximide (CHX), 5,6-dichloro-1-β-D-ribofuranosylbenzimidazole (DRB), MG132, desferroxamine (DFO), and mouse anti-human β-actin were purchased from Sigma-Aldrich. JAK inhibitor 1 was purchased from Calbiochem. Rabbit anti-human pSTAT1 (Tyr701), STAT1, and IRF9 were purchased from Santa Cruz Biotechnology. Rabbit anti-human STAT2 was purchased from Cell Signaling Technologies. Mouse anti-human viperin Ab was a gift from P. Cresswell (Yale University, New Haven, CT).
HIF-1
quantitation
Semiconfluent cultures in 35-, 60-, or 100-mm tissue-culture-treated polystyrene plates (BD Biosciences) were placed on ice and the media were removed. The cells were washed one time with ice-cold HBSS (Invitrogen Life Technologies). Lysis buffer (50 mM Tris (pH 7.4), 300 mM NaCl, 10% glycerol, 3 mM EDTA, 1 mM MgCl2, 20 mM β-glycerophosphate, 25 mM NaF, 1% Triton X-100, 25 µg/ml leupeptin, 25 µg/ml pepstatin, and 3 µg/ml aprotinin) was immediately added directly to plates and the lysates were collected using a cell scraper (BD Biosciences) into prechilled 1.5-ml Eppendorf tubes (USA Scientific). Samples were vortexed and centrifuged for 10 min at 4°C to remove debris. Where indicated, lysates were fractionated into cytoplasmic or nuclear fractions using a BioVision cell fractionation kit according to the manufacturers protocol.
Lysates were analyzed by sandwich ELISA for total HIF-1
according to the manufacturers protocol (R&D Systems). Data are presented either as HIF-1
protein concentration (picograms per milliliter) or converted to fold increase over control. Such normalization allowed pooling of data among multiple experiments. Active HIF-1
was measured according to the manufacturers protocol (R&D Systems) using a modified ELISA that assesses the ability of HIF-1
to bind DNA. Briefly, 30–50 µg of nuclear extracts was incubated with a biotinylated double-stranded oligonucleotide containing a consensus HIF-1
-binding site and subsequently captured in a 96-well plate (BD Biosciences) by an immobilized Ab specific for HIF-1
. Streptavidin-HRP was used to detect bound HIF-1
/oligonucleotide complexes, and absorbance was determined. Data are presented as OD x 1000. Specificity was determined by competing away the signal using an excess of unlabeled double-stranded oligonucleotide. All samples used in the total and active HIF-1
ELISAs were standardized to total protein as determined by a Bio-Rad protein assay kit.
Pharmacologic inhibitors (CHX, JAK inhibitor 1, DRB, and MG132) or vehicle control (EC media for CHX; DMSO for the others) were added to cultures at the indicated concentrations 30 min before the addition of cytokine or vehicle control. Protein lysates (or mRNA) were isolated and analyzed at the indicated times as described for various experiments.
mRNA isolation and real-time quantitative RT-PCR
Total RNA was isolated using an RNeasy minikit (Qiagen) according to the manufacturers protocol and quantified by a spectrophotometer. First-strand cDNA was synthesized using equal amounts of input RNA and TaqMan reverse transcriptase reagents using oligo(dT)16 primers (Applied Biosystems) according to the manufacturers instructions. Real-time quantitative RT-PCR (qRT-PCR) was performed on 5 µl of cDNA template using nested primers designed to span introns, and SYBR Green (Bio-Rad) master mix equaling a total volume of 25 µl. TaqMan primer/probe sets and master mix (Applied Biosystems) were used to quantify PPAR
and prostacyclin synthase transcripts according to the manufacturers protocol. Conditions for amplification were provided by the individual manufacturer and were optimized based on primer sets. Samples were run on an Icycler IQ5 real-time PCR detection system (Bio-Rad). All data were normalized using GAPDH as reference values and expressed as relative fold increases over control. Primer sequences used in this study are listed in Table I.
|
Cell lysates were prepared as described above. Twenty to 30 µg of total protein were loaded per lane, subjected to SDS-PAGE, and immunoblotted as previously described (50).
Small interfering RNA (siRNA) treatment of cells
siRNAs against various proteins were purchased from Qiagen and Santa Cruz Biotechnology. Predetermined amounts of siRNA complexes were delivered to cells either via electroporation (3 µg/106 cells) or oligofectamine (Invitrogen) (20 nM/5 x 105 cells) according to the manufacturers protocol. Briefly, cells were exposed to one round of electroporation using a HUVEC Nucleofector kit (Amaxa) with either siRNA of a nonbinding sequence (Qiagen), or siRNA against HIF-1
(target sequence: AACTGATGACCAGCAACTTGA and second target sequence: AACGACACAGAAACTGATGAC; Qiagen), and assayed for knockdown or used experimentally 15–24 h later. The two separate siRNA sequences targeted against HIF-1
have been previously described (16). For all other siRNAs, two rounds of oligofectamine transfection separated by 24 h were performed, followed by 24 h of rest. Cell lysates or mRNA were then isolated as described above at the indicated times. Knockdown specificity for the desired protein was examined by testing two to three different siRNA complexes directed against the protein of interest, with similar outcomes resulting each time. Knockdown of IRF9 was accomplished using siRNA from Santa Cruz Biotechnology (sequence proprietary, catalog no. sc-38013), and specificity was confirmed using two separate sequences from Qiagen (target sequence: CAACAAGAGTTCTGAATTTAA, catalog no. SI00084371 and target sequence: CACGATTGACCTGTCCTCTTT, catalog no. SI00084364). siRNA against JAK1, TYK2, and STAT2 were purchased from Qiagen (validated sequences proprietary; JAK1 catalog no. SI00605514 and SI00605521; TYK2 catalog no. SI02223221 and SI02659559; STAT2 catalog no. SI2662331).
HRE-GFP reporter assay
We assessed HIF-1 transcriptional activity using a promoter-reporter plasmid (5HRE-hCMV-d2EGFP; a gift from T. Foster, University of Rochester, Rochester, NY) containing five tandem HRE consensus sequences and a human CMV minimal promoter upstream of a destabilized enhanced GFP (EGFP) reporter gene that has been previously described (51, 52). HUVECs were electroporated with 1 µg of plasmid and a stable line of HRE-GFP-expressing ECs was selected for in 200 µg/ml G418 for 1 wk. HRE-GFP cells were stimulated with cytokine or DFO for the indicated amount of time. Nontransfected cells served as a negative control. GFP expression was determined by flow cytometry using the LSR II system (BD Biosystems) and expressed as a percent of control (vehicle alone).
Induction of hypoxic conditions
HUVECs were grown on fibronectin (10 µg/ml)-coated glass plates and exposed to hypoxic conditions (<0.5% O2) in a carbon dioxide anaerobic chamber or a ProOxC nitrogen-induced hypoxia system (BioSpherix) for the indicated times before lysis.
BrdU incorporation
HUVECs were electroporated with siRNA against a control sequence or HIF-1
as described above, and 1 x 105 cells were plated per well in a 24-well culture plate (BD Biosciences) and let rest for 8 h. BrdU (10 µM) or PBS (Invitrogen Life Technologies) control, along with different amounts of IFN-
or vehicle control, were simultaneously added directly to the appropriate wells. Fifteen hours later, the supernatant and corresponding cells, which were removed by trypsin, were combined and processed for flow cytometric analysis to determine percent BrdU incorporation according to the manufacturers instructions (FITC BrdU Flow kit; BD Biosciences). Data were collected using the LSR II system and analyzed by FlowJo software (Tree Star). BrdU labeling was calculated by first gating on live cells (based on forward vs side scatter dot plots) to exclude debris from analysis and then determining the percentage of BrdU-positive cells when compared with cells that received the identical treatment but no BrdU.
Statistical analysis
Data are presented as mean ± SE from a minimum of three replicates, unless otherwise specified. Statistical analysis was performed using ANOVA for single and repeated measures with the Bonferroni, Dunnett, or Tukey multiple comparisons post-hoc test for comparisons of groups greater than two. Paired t tests were used when appropriate.
| Results |
|---|
|
|
|---|
induces HIF-1
in ECs
We examined the effect of various mediators of innate immunity on HIF-1
expression in HUVECs. ECs were treated with concentrations of TNF (20 ng/ml), IL-1
(10 ng/ml), IL-6 (20 ng/ml), IFN-
(50 ng/ml), and IFN-
(100 ng/ml) that are optimal for known responses of HUVECs to these agents (Fig. 1A). Total cell lysate was collected at 4 and 24 h and protein levels of HIF-1
, which is the predominate isoform of HIF in HUVECs (10, 16), were determined by ELISA. Of the cytokines tested, TNF, IL-1
, and IFN-
induced HIF-1
to levels that are statistically significant above vehicle control at 4 h, with the greatest magnitude of induction elicited by IFN-
treatment. By 24 h, HIF-1
levels induced by TNF and IL-1
had returned to baseline, while IFN-
-treated ECs continued to show augmented HIF-1
protein levels. As expected, IFN-β produced similar responses to that elicited by IFN-
(S. A. Gerber, unpublished observations). In all subsequent experiments, we focused our analysis on the effects of IFN-
. IFN-
also produced an increase in HIF-2
, but not of HIF-1β, as detected by immunoblotting (S. A. Gerber, unpublished observations). The levels of HIF-2
in HUVECs appeared to be much lower than those of HIF-1
, and this response was not further investigated.
|
could induce HIF-1
in several other human cell types. As shown in Fig. 1B, HUVECs, HDMECs, HCBECs, the EaHy.926 cell line, CD4+ T cells, and SMC were treated with IFN-
for 4 h and levels of HIF-1
were examined. Although the basal levels of HIF-1
differed among cell types, IFN-
was able to induce this transcription factor to some extent in all cell types tested. HUVECs consistently demonstrated the greatest induction in response to IFN-
stimulation compared with other EC types tested, so we concentrated our further analysis of IFN-
responses on HUVECs. HIF-1
protein was induced in a dose- (Fig. 1C) and time- (Fig. 1D) dependent manner by IFN-
with little to no induction occurring until 2 h following cytokine stimulation, after which levels of protein remained constant for up to 36 h.
To assess whether IFN-
-induced HIF-1
protein enters the nucleus, we separated HUVECs treated with IFN-
or vehicle control into cytoplasmic and nuclear fractions and determined HIF-1
protein levels in each. Nuclear fractions from IFN-
-stimulated cells contained significant increases of HIF-1
protein (Fig. 1E), while changes in cytoplasmic levels failed to reach significance. Additionally, we tested whether IFN-
-induced HIF-1
was able to bind a labeled HRE oligonucleotide sequence using a modified ELISA. Cells treated with IFN-
demonstrated an increased capacity to bind HRE-DNA (Fig. 1F) when compared with vehicle control. We were able to compete out labeled binding with an excess of unlabeled oligonucleotide (data not shown), demonstrating specificity. Corresponding nuclear protein levels of HIF-1
are also shown on Fig. 1F and illustrate that increases of HIF-1
protein by IFN-
correlate with the ability of HIF-1
to bind HRE-DNA. HUVECs exposed to hypoxia (<0.5% O2) for 5 h were used as a positive control for HIF-1
protein induction, and elicited a much larger response than IFN-
. Thus, the response to IFN-
, although highly reproducible, appears modest compared with that produced by hypoxia.
IFN-
induces HIF-1
mRNA as an immediate early response
During hypoxia, the predominant mechanism by which HIF-1
protein is increased is protein stabilization (7), as mRNA levels of HIF-1
often remain unchanged or fall, with increases in transcripts occurring only rarely (3, 9). Under normoxic conditions, the pathways that govern expression levels of HIF-1
gene expression are not as well understood. We investigated whether HIF-1
mRNA was directly up-regulated in ECs treated with IFN-
by performing a time course experiment, examining the HIF-1
mRNA levels by qRT-PCR (Fig. 2A). A statistically significant increase in the levels of HIF-1
mRNA was induced within 2 h of IFN-
stimulation and remained elevated above vehicle control for up to 8 h. This effect was blocked by the transcription inhibitor DRB (50 µM) (Fig. 2B). A positive control for DRB activity was inhibition of the IFN-
induced transcript viperin, which was suppressed by over 90% (data not shown). Pretreatment with DRB also prevented the subsequent rise in HIF-1
protein consistent with the hypothesis that the increase of HIF-1
mRNA is responsible for elevated protein levels (Fig. 2C). Additionally, HIF-1
mRNA stability was assessed and found to be unaltered in cells treated with IFN-
or vehicle control for 4 h followed by the addition of DRB (data not shown). CHX pretreatment (10 µg/ml) did not inhibit the increase of HIF-1
mRNA (Fig. 2D) indicating that new protein synthesis was not required for IFN-
-induced HIF-1
transcription.
|
could increase the stability of HIF-1
protein. Although we did see a small effect in several experiments, the levels of HIF-1
protein in normoxic cells were simply too low to determine an accurate half-life (data not shown). To address whether HIF-1
protein stabilization was required for the IFN-
effects on HIF-1
protein level, HUVECs were pretreated with the proteasome inhibitor MG132 (10 µM) followed by the addition of IFN-
or vehicle control, and HIF-1
protein levels were measured at 4 h. IFN-
induced a 1.3-fold increase of HIF-1
protein in cells treated with MG132, a degree of change that did not reach statistical significance (data not shown). This increase is proportionally less than that observed in untreated ECs following IFN-
stimulation. Cumulatively, these data suggest that the increase of HIF-1
protein arise, at least in part, from IFN-
-induced transcription of HIF-1
mRNA, which behaves as an immediate early gene whose transcription is independent of new protein synthesis, and that this response may or may not be augmented by additional mechanisms such as protein stabilization.
JAK1, TYK2, and ISGF3 are essential for IFN-
induction of HIF-1
The JAK-STAT-signaling pathway is the principal pathway through which immediate early genes are transcribed following type I IFN stimulation. To determine whether HIF-1
was induced via this mechanism, HUVECs were treated with various concentrations of JAK inhibitor 1, a broad pharmacologic inhibitor of JAK enzymes including JAK1 and TYK2, before the addition of IFN-
. The activity of the inhibitor was assessed by its ability to inhibit IFN-
-induced tyrosine phosphorylation of STAT1 (Fig. 3A). The induction of HIF-1
protein by IFN-
was consistently reduced by this agent (Fig. 3B). In a parallel approach, HUVECs were transfected with siRNA against JAK1, TYK2, or both molecules at the same time. Knockdown and specificity of the effect were determined by measuring mRNA levels of the specific enzymes using qRT-PCR (Fig. 3C). Knockdown of either JAK1 or TYK2 reduced HIF-1
induction following IFN-
treatment, and greater inhibition resulted when both JAK kinases were knocked down simultaneously (Fig. 3D). Taken in combination, the pharmacologic inhibitor and the siRNA approach clearly show that JAK1 and TYK2 are essential to the IFN-
induction of HIF-1
protein.
|
, we used siRNA against various components of this transcription factor. siRNA was first used to knockdown IRF9 as assessed by immunoblotting (Fig. 4A). As a positive control, we examined mRNA transcript and protein levels of viperin, a known protein induced by IFN-
through the ISGF3 complex (53), in cells treated with siRNA against IRF9 or control in the presence or absence of IFN-
. Both protein (Fig. 4A), and mRNA (Fig. 4B) levels of viperin were markedly reduced when IRF9 was no longer present. Similarly, the IFN-
induction of HIF-1
mRNA (Fig. 4C) and protein (Fig. 4D) were significantly reduced following IRF9 knockdown. STAT2 knockdown resulted in a similar reduction in both viperin and HIF-1
protein levels following IFN-
stimulation (data not shown). Surprisingly, STAT1 knockdown by 90% did not inhibit either viperin or HIF-1
induction (data not shown), suggesting that the residual quantities of STAT1 remaining following siRNA knockdown are sufficient to allow ISGF3 formation. Despite the limited effects of STAT1 knockdown, we conclude, based on our observations of the effects of IRF9 and STAT2 knockdown, that the ISGF3 complex is the transcription factor responsible for the induction of HIF-1
in IFN-
-stimulated ECs.
|
priming enhances IFN-
-induced HIF-1
IRF9 levels are often limiting for ISGF3 formation and therefore may regulate the response of cells to IFN-
. Expression of this protein may be increased by pretreatment with IFN-
, leading to more robust responses to IFN-
, a phenomenon known as "priming" (54, 55, 56). The enhanced response is evident at both early and later times as transcripts of IFN-
-stimulated genes (ISGs) are augmented early and sustained in primed cells. To assess whether this effect influences HIF-1
levels, cells were primed with IFN-
or vehicle control for 12 h, followed by the addition of IFN-
or vehicle control to the primed cells for various time periods. HIF-1
mRNA levels were significantly increased at each time point tested in both IFN-
-primed plus IFN-
and vehicle plus IFN-
-treated cells when compared with control treated cells (Fig. 5A). However, despite differences of HIF-1
mRNA levels between these two groups, the values failed to reach statistical significance. As in previous experiments, IFN-
treatment alone induced a statistically significant 2-fold increase of HIF-1
protein 2 h after stimulation when compared with vehicle control treated cells (Fig. 5B). Priming with IFN-
followed by the addition of IFN-
produced a larger response at 2 h that was sustained for longer times. This increase was statistically significant when compared with all groups at the 4-h time point. Nuclear translocation of HIF-1
was found to be significantly augmented 5-fold in IFN-
alone treated cells and 16-fold in IFN-
primed plus IFN-
-stimulated cells when compared with vehicle control (Fig. 5C). The increases in nuclear HIF-1
protein levels found in IFN-
-primed plus IFN-
-treated HUVECs were statistically significant when compared with all groups. DNA-binding activity of HIF-1
to labeled HRE oligonucleotides was increased to similar levels as those increases observed in nuclear protein levels of HIF-1
(data not shown). These data demonstrate that IFN-
priming does enhance the IFN-
induction of HIF-1
, consistent with our conclusion that HIF-1
is an ISGF3-inducible gene.
|
-induced HIF-1
does not regulate expression of HIF-1-dependent or IFN-
-stimulated genes in normoxic conditions
We first examined whether several candidate HIF-1-dependent genes were activated by IFN-
. In these experiments, we tested both IFN-
-primed and unprimed cells followed by the addition of IFN-
or vehicle control, but focused on primed cells so as to more easily detect IFN-
effects. We measured six genes whose HIF-1-dependent induction are among the largest in HUVEC (1). As shown in Table II (siCon column), IFN-
priming alone or IFN-
priming followed by IFN-
stimulation induced the expression of PHD3 and VEGF-C, while reducing the expression of PPAR
, prostacyclin synthase, and VEGF-A. Similarly, IFN-
specifically induced VEGF-C, but reduced the expression of PPAR
and prostacyclin synthase. No consistent change was observed in ANGPL4. To test whether the induction or reduction of these genes is dependent on HIF-1
, cells were pretreated with either control siRNA (siCon), or siRNA against HIF-1
(siHIF-1
) to knockdown expression of this protein. Fig. 6A illustrates both the induction of HIF-1
in control siRNA-treated cells after treatment with IFN-
for 5–7 h, along with a further augmentation of HIF-1
in IFN-
-primed plus IFN-
-treated cells. The levels of HIF-1
were consistently reduced between 75 and 95% after HIF-1
siRNA treatment. This level of HIF-1
knockdown was effective in suppressing the induction of HIF-1-dependent genes using an optimal dose of a chemical mimetic of hypoxia, DFO, as a positive control for HIF-1
induction (Fig. 6A) and subsequent stimulation of hypoxic genes (Table II). Transcript levels of ANGPL4, PHD3, and VEGF-A were reduced
80% in DFO-stimulated cells (labeled as DFOhigh) treated with siRNA against HIF-1
. Furthermore, HIF-1
knockdown had no effect on the negative or positive responses of HIF-1-regulated genes following IFN-
stimulation (Table II, compare siCon column vs siHIF-1
column). To more directly examine HIF-1 effects on transcription, we stimulated ECs that contained a HRE-GFP promoter-reporter vector with the cytokines. Consistent with the target gene measurements, cytokine treatment was not able to activate the promoter-reporter plasmid, although DFO (100 µM) treatment strongly stimulated GFP expression (Fig. 6B). These data indicate that IFN-
-induced HIF-1
does not appear to activate HIF-1
-mediated transcription during normoxic conditions.
|
|
-induced HIF-1
to activate target gene transcription is that HIF-1
protein levels following cytokine stimulation are too low to drive transcription. To examine this possibility, we reduced the concentration of DFO to a level (2 µM) that induces HIF-1
protein levels comparable to that observed in vehicle plus IFN-
or IFN-
plus IFN-
-treated cells (Fig. 6A). An optimal dose of DFO (100 µM) was used as a positive control for HIF-1
protein induction and target gene activation was assessed by qRT-PCR. Strikingly, HUVECs treated with the lower dose of DFO failed to induce ANGPTL4, PHD3, and VEGF-A, whereas the higher dose of DFO strongly activated the transcription of these genes in a HIF-1-dependent manner (Table II). Similarly, low-dose DFO, similar to cytokine treatment, was unable to activate the HRE-GFP promoter-reporter plasmid (Fig. 6B). These data suggest that HIF-1 target gene expression depends upon the level of expression of HIF-1
, and the level of HIF-1
induced by IFN-
(or low dose of DFO) is not sufficient to stimulate HIF-1 target gene transcription.
To determine whether IFN-
-induced HIF-1
modulates the IFN-
response, we examined transcript levels of three known ISGs that contribute to resistance to viral infection (33) in HUVECs treated with control siRNA or siRNA against HIF-1
. As expected, viperin, 2',5'-oligoadenylate synthetase 2 (OAS2), and CXCL10 were all strongly induced following IFN-
stimulation (data not shown). Table III illustrates that knockdown of HIF-1
slightly decreased viperin and CXCL10 levels, while OAS2 mRNA levels were minimally increased. However, these changes are marginal and did not reach statistical significance. Cumulatively, these data indicate that an IFN-
-induced increase in HIF-1
protein does not generally induce hypoxia-regulated genes or affect expression of IFN-
-induced genes stimulated as part of the antiviral response.
|
-induced HIF-1
contributes to the antiproliferative effects of IFN-
In addition to its actions as a transcription factor, HIF-1 may influence cellular responses in a manner that depends on interactions with other cellular proteins (7). For example, some of the inhibitory actions of HIF-1 on cellular proliferation are thought to be mediated through interactions with c-myc (15). IFN-
also has antiproliferative effects (40). In a final series of experiments, we examined whether the antiproliferative activity of IFN-
could be mediated by the induction of HIF-1
. HUVECs treated with control siRNA or siRNA against HIF-1
were labeled with BrdU and stimulated with various doses of IFN-
or vehicle control. Fifteen hours later, the cells were harvested and cellular proliferation was determined by BrdU incorporation into nuclear DNA as measured by flow cytometry. We focused upon the short-term effects of IFN-
on proliferation because the siRNA knockdown of HIF-1
is only effective during the first 24 h following electroporation. Fig. 7 demonstrates that IFN-
inhibited EC proliferation in a dose-dependent manner. More importantly, the knockdown of HIF-1
antagonized the antiproliferative effects of IFN-
, resulting in a statistically significant increase in the number of BrdU-positive cells at each dose of IFN-
, but had only minimal effects on vehicle-treated cells (first data point of each line). These data suggest that IFN-
-induced HIF-1
contributes to the antiproliferative activity of IFN-
on ECs.
|
| Discussion |
|---|
|
|
|---|
protein, leading to HIF-1-dependent transcription. However, it is becoming increasingly apparent that factors other than hypoxia can also modulate HIF-1
(18, 19). We report here that IFN-
induces HIF-1
in human cells, especially in ECs, in normoxic conditions. Transformed mouse lung ECs stimulated with mouse IFN-
did not show increases in HIF-1
or HIF-2
, suggesting that the effects of type I IFN- on HIF-1
may be specific to human cells (S. A. Gerber, unpublished observations). Our finding is supported by a previous microarray analysis that identified HIF-1
as one of many genes induced by IFN-β in a human fibrosarcoma cell line (57). We demonstrate that gene transcription but not protein synthesis, the tyrosine kinases JAK1 and TYK2, and the predominate type I IFN transcription factor ISGF3, are required for IFN-
-induced HIF-1
protein increases. The data presented in this report appear to define HIF-1
as an immediate early ISG.
ISGF3 binds to ISRE DNA consensus sequences (5'-(A/G)NGAAANNGAAACT-3') often found in the 5' flanking promoter/enhancer regions of ISGs (37, 58). We investigated whether the HIF-1
gene (5' flanking promoter region, 13 exons and introns, and the 3' UTR) possessed ISRE sequences using computer software designed to scan for possible transcription factor binding sites in genes. Although we were not able to discern candidate ISRE sequences in the promoter of HIF-1
, our analysis did reveal 13 sequences of similar homology to ISREs in introns, with 7 of 13 residing within the first intron. Other genes, such as IRF7, mimecan, and estrogen-responsive finger protein (Efp), have also been shown to contain functional ISREs within the first intron (59, 60, 61). However, further investigation will be needed to determine whether any of these possible ISRE sequences within the HIF-1
gene are able to bind ISGF3 and serve as transcription initiation/enhancer sites.
Although several genes that are regulated by HIF-1
were increased or decreased following IFN-
(and/or IFN-
) stimulation in normoxic conditions, these changes appear to be independent of HIF-1
as shown by siRNA knockdown of HIF-1
. Based on these data, we concluded that IFN-
-induced increases in HIF-1
are unable to activate transcription of target genes. Several other cytokines that induce HIF-1
(TNF, IL-1
, and IFN-
) were similarly unable to stimulate HIF-1-dependent genes (S. A. Gerber, unpublished observations). These observations—coupled with the data showing that low doses of DFO, which induced comparable levels of HIF-1
to that of cytokine-stimulated ECs, also do not activate HIF-1-dependent genes—suggest that the quantity of HIF-1
induced by cytokines is simply insufficient to drive gene transcription. We cannot rule out the possibility that different structural forms of HIF-1
are induced by cytokines that may either enhance or inhibit the transcriptional potential of HIF-1
. Indeed, a number of posttranslational modifications have been shown to promote or inhibit the binding of coactivator proteins such as p300 or the CREB-binding protein to translational domains of HIF-1
thereby altering the transcriptional ability of this transcription factor (7, 9). However, when we examined whether IFN-
treatment induced some specific factors that render HIF-1
inactive, namely inhibitor Per/Arnt/Sim (62), CITED2/4 (63), and factor-inhibiting HIF (64), we found no changes in expression when compared with vehicle control (S. A. Gerber, unpublished data).
IFN-
is effective in the treatment of malignancies such as hairy cell leukemia, chronic myelogenous leukemia, and some solid tumors (40, 42). The efficacy of this therapy is partially attributed to the growth inhibitory properties elicited by type I IFNs upon tumor cells. Additionally, IFN-
inhibits proliferation of cells of EC origin; a characteristic that may contribute to the described antiangiogenic/antilymphangiogenic properties of IFN-
(39, 41, 44, 65, 66). However, the molecular mechanism that controls the antiproliferative effects of this pleiotropic cytokine is not well understood. Recent evidence has implicated IFN-
-inducible genes such as I-8U, IFI44, and RIG-G as possible candidates that specifically mediate the inhibition of cell growth, but this may vary with cell type (67, 68, 69). Our work demonstrates that IFN-
-induced HIF-1
is partially responsible for the antiproliferative effect of IFN-
on ECs. In an attempt to better understand the mechanism behind this antiproliferative effect, we analyzed the cell cycle in siCon- or siHIF-1
-transfected ECs stimulated with various doses of IFN-
. IFN-
treatment in siCon-transfected ECs resulted in more cells remaining in G1/G0 phase and correspondingly fewer from entering S phase. HIF-1
knockdown partially restored the progression of cells into S phase, although the magnitude of these changes did not reach statistical significance once cells killed by the electroporetic transfection technique were gated out (S. A. Gerber, unpublished observations). Further studies will be needed to identify the mechanism by which HIF-1
affects EC proliferation. The effect we observed under normoxic conditions is consistent with prior observations that hypoxia-induced HIF-1
suppresses cell cycle progression as a means of reducing metabolic demand during low oxygen conditions. The proposed mechanism involves HIF-1
interference with c-myc; a proto-oncogene that regulates the mitotic activity of cells through repression of cyclin-dependent kinase inhibitors p21 and p27, which prevent cellular progression through the G1/S phase checkpoint (15). This effect requires the interaction of HIF-1
and Sp1, which in turn displaces c-myc from Sp1 sites within the p21 promoter, allowing p21 expression and resulting in cell cycle arrest in G1 phase (14, 15). Interestingly, the antiproliferative effects of HIF-1
in this model appear to be independent of its transcriptional ability (15). This suggests that even in conditions that induce HIF-1
but fail to influence transcription (i.e., by IFN-
stimulation), HIF-1
may still maintain the ability to elicit growth inhibitory effects.
In summary, we report that IFN-
induces the transcription of HIF-1
, leading to increased HIF-1 levels, but fails to influence the transcription of genes associated with either hypoxia or innate immunity. Despite the lack of a role for IFN-
-induced HIF-1 as a transcription factor, we report a significant role of induced HIF-1
in the antiproliferative actions of this cytokine on vascular EC. It is interesting to note that of all the cytokines examined in our study, only IFN-
was able to cause sustained elevation of HIF-1
, suggesting that the antiproliferative effects of IFN-
-induced HIF-1
may also be sustained as long as the cytokine is present. These findings have particular relevance for the use of IFN-
therapy as an antiangiogenic agent.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by National Institutes of Health Grants RO1HL62188, T32-AR07107, and T32-AI007019. ![]()
2 Address correspondence and reprint requests to Dr. Jordan S. Pober, School of Medicine, Yale University, Room 401D, 10 Amistad Street, P.O. Box 208089, New Haven, CT 06520-8089. E-mail address: Jordan.Pober{at}yale.edu ![]()
3 Abbreviations used in this paper: HIF, hypoxia-inducible factor; PHD, prolyl hydroxylase domain; EC, endothelial cell; IRF, IFN-regulatory factor; ISGF, IFN-stimulated gene factor; ISRE, IFN-stimulated response element; HRE, hypoxia-response element; ISG, IFN-
-stimulated gene; OAS, 2',5'-oligoadenylate synthetase; HDMEC, human dermal microvascular EC; SMC, smooth muscle cell; HCBEC, human cord blood-derived EC; CHX, cycloheximide; DRB, 5,6-dichloro-1-β-D-ribofuranosylbenzimidazole; DFO, desferroxamine; qRT-PCR, quantitative RT-PCR; siRNA, small interfering RNA; siCon, control siRNA; siHIF, siRNA against HIF-1
. ![]()
Received for publication February 14, 2008. Accepted for publication May 14, 2008.
| References |
|---|
|
|
|---|
is regulated at the post-mRNA level. Kidney Int. 51: 560-563. [Medline]
targeted for VHL-mediated destruction by proline hydroxylation: implications for O2 sensing. Science 292: 464-468.
controls keratinocyte proliferation by up-regulating p21WAF1/Cip1. Biochim. Biophys. Acta 1783: 323-333. [Medline]
induces cell cycle arrest by functionally counteracting Myc. EMBO J. 23: 1949-1956. [Medline]
versus Hif-2
in regulation of the transcriptional response to hypoxia. Cancer Res. 63: 6130-6134.
in endothelial cells disrupts a hypoxia-driven VEGF autocrine loop necessary for tumorigenesis. Cancer Cell 6: 485-495. [Medline]
. Int. Immunopharmacol. 5: 461-483. [Medline]
is essential for myeloid cell-mediated inflammation. Cell 112: 645-657. [Medline]
-dependent regulation of HIF-1
. FEBS Lett. 505: 269-274. [Medline]
stimulate DNA binding of hypoxia-inducible factor-1. Blood 94: 1561-1567.
by insulin and interleukin-1β involves the phosphatidylinositol 3-kinase pathway. FEBS Lett. 512: 157-162. [Medline]
causes accumulation of a ubiquitinated form of hypoxia inducible factor-1
through a nuclear factor-
B-dependent pathway. Mol. Biol. Cell 14: 2216-2225.
protein levels in human transformed intestinal cells. FEBS Lett. 580: 6399-6404. [Medline]
through Siah1-mediated down-regulation of prolyl hydroxylases 1 and 3 in nasopharyngeal epithelial cells. Cancer Res. 66: 9870-9877.
. Mol. Cell. Biol. 24: 5223-5234.
. FEBS Lett. 577: 121-126. [Medline]
2b vs. IFN-β 1a: understanding the functional relationship between distinct type I interferons that act through a common receptor. J. Interferon Cytokine Res. 22: 173-188. [Medline]
. Proc. Natl. Acad. Sci. USA 91: 1198-1205.
prevents apoptosis of endothelial cells after short-term exposure but induces replicative senescence after continuous stimulation. Lab. Invest. 86: 997-1007. [Medline]
-interferons: 40th anniversary of the discovery of interferons. Cancer Res. 58: 2489-2499.
: regulatory effects on cell cycle and angiogenesis. Neuroendocrinology 80: (Suppl. 1):85-93. [Medline]
, β, and
a on the morphology, proliferation, and cell surface antigen expression of human dermal microvascular endothelial cells in vitro. J. Invest. Dermatol. 95: 693-699. [Medline]
induces human vascular smooth muscle cell proliferation and intimal expansion by phosphatidylinositol 3-kinase dependent mammalian target of rapamycin raptor complex 1 activation. Circ. Res. 101: 560-569.
and interferon-
through induced synthesis of one subunit of the transcription factor ISGF3. EMBO J. 9: 1105-1111. [Medline]
/β and the IFN-
signal-transduction pathways. Circ. Res. 83: 815-823.
priming up-regulates IFN-stimulated gene factor 3 (ISGF3) components, augmenting responsiveness of IFN-resistant melanoma cells to type I IFN-s. J. Immunol. 160: 5475-5484.
, β, or
using oligonucleotide arrays. Proc. Natl. Acad. Sci. USA 95: 15623-15628.
regulation of the human mimecan promoter. Mol. Vis. 9: 277-287. [Medline]
and IFN-
on lymphangiogenesis. J. Interferon Cytokine Res. 26: 568-574. [Medline]
-responsive and non-responsive cell lines. Cell. Mol. Life Sci. 60: 1235-1248. [Medline]
-inducible protein IFI44. J. Interferon Cytokine Res. 27: 675-680. [Medline]This article has been cited by other articles:
![]() |
S. A. Gerber, B. Yatsula, C. L. Maier, T. J. Sadler, L. W. Whittaker, and J. S. Pober Interferon-Gamma Induces Prolyl Hydroxylase (PHD)3 Through a STAT1-Dependent Mechanism in Human Endothelial Cells Arterioscler Thromb Vasc Biol, September 1, 2009; 29(9): 1363 - 1369. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |