|
|
||||||||


* Department of Internal Medicine, Division of Infectious Diseases, University of Cincinnati College of Medicine, and
Veterans Administration Medical Center, Cincinnati, OH 45267
| Abstract |
|---|
|
|
|---|
). In dendritic cells (DC), Hc is killed and fungal Ags are processed and presented to T cells. DC recognize Hc yeasts via the VLA-5 receptor, whereas M
recognize yeasts via CD18. To identify ligand(s) on Hc recognized by DC, VLA-5 was used to probe a Far Western blot of a yeast freeze/thaw extract (F/TE) that inhibited Hc binding to DC. VLA-5 recognized a 20-kDa protein, identified as cyclophilin A (CypA), and CypA was present on the surface of Hc yeasts. rCypA inhibited the attachment of Hc to DC, but not to M
. Silencing of Hc CypA by RNA interference reduced yeast binding to DC by 65–85%, but had no effect on binding to M
. However, F/TE from CypA-silenced yeasts still inhibited binding of wild-type Hc to DC, and F/TE from wild-type yeasts depleted of CypA also inhibited yeast binding to DC. rCypA did not further inhibit the binding of CypA-silenced yeasts to DC. Polystyrene beads coated with rCypA or fibronectin bound to DC and M
and to Chinese hamster ovary cells transfected with VLA-5. Binding of rCypA-coated beads, but not fibronectin-coated beads, was inhibited by rCypA. These data demonstrate that CypA serves as a ligand for DC VLA-5, that binding of CypA to VLA-5 is at a site different from FN, and that there is at least one other ligand on the surface of Hc yeasts that mediates binding of Hc to DC. | Introduction |
|---|
|
|
|---|
) and dendritic cells (DC) (1).
Human monocyte-derived M
avidly bind to Hc yeasts and conidia in an opsonin-independent fashion. Adhesion is mediated by the interaction between β2 integrins, LFA-1 (CD11a/CD18), complement receptor 3 (CD11b/CD18), and complement receptor 4 (CD11c/CD18) (2, 3) with the surface ligand heat shock protein 60 (HSP60) (4). As a consequence of this interaction, the fungus gains entrance to the M
endosome, which is a permissive environment for Hc survival and proliferation (5). M
migration into local lymph nodes, and eventually the blood stream, is thought to be the main mechanism for Hc dissemination into M
-rich organs such as the spleen, liver, and bone marrow (6). In immunocompetent hosts, infection with Hc is contained and eliminated by the development of Hc-specific T cell-mediated immunity. CD4 T cells recognize Hc-derived antigenic peptides in the context of MHC class II molecules displayed in the surface of professional APCs. Ag-specific T cells become activated, proliferate, and produce Th1 cytokines that in turn activate M
to exert fungistatic and fungicidal activity (6). Histologically, cell-mediated immunity is characterized by the development of granulomatous inflammation around foci infected with the fungus (7).
DC, the hosts primary APCs, are abundantly present in lung tissues within the airway epithelium, the submucosa, and on the alveolar surfaces (8). In vitro, DC avidly bind to and ingest Hc, but do not require cytokine activation to exert phagolysosomal fusion, intracellular killing, and degradation of the yeast (9, 10). The molecules involved in DC-Hc adhesion are different from the receptors used by M
. Despite the presence of CD18 integrins on the surface of DC (11), Hc binds to the fibronectin receptor VLA-5 (9). Moreover, surface HSP60 plays no role in DC recognition of Hc (4). In the experiments described herein, we sought to identify the Hc surface ligand(s) involved in the interaction between Hc and DC VLA-5. Freeze/thaw extracts (F/TE) of Hc yeasts probed with purified human VLA-5 in a Far Western blot identified a 20-kDa protein, cyclophilin A (CypA), as a major ligand involved in DC-Hc recognition. We hypothesize that Hc CypA may play an important role in fungal-DC interaction, innate immune recognition, and the initiation of cell-mediated immunity to Hc.
| Materials and Methods |
|---|
|
|
|---|
Hc strain G217B was maintained in yeast form by serial passage on brain-heart infusion agar as described previously (3). Yeasts were grown in Histoplasma M
medium (12) at 37°C with orbital shaking at 150 rpm. For binding assays, log-phase yeasts were heat-killed (HK) at 65°C for 1 h and stored at 4°C in PBS containing 0.05% sodium azide. HK yeasts were labeled with FITC, washed, and resuspended in HBSS containing 20 mM HEPES and 0.25% BSA (HBSA) as described previously (3).
Preparation of Hc F/TE
A F/TE enriched with Hc surface proteins was prepared as described previously (4). Hc yeasts were grown to log phase and harvested via centrifugation. The pellets were frozen and thawed twice over 48 h. Yeasts were removed by centrifugation, and the supernatant containing surface proteins was sterile filtered and stored at 4°C. Protein concentration was determined by the Bradford method (Bio-Rad).
Far Western blot analysis with purified VLA-5
Five hundred micrograms of purified human VLA-5 (Chemicon International) was biotin labeled using water-soluble sulfo-NHS-LC-biotin (Pierce) following the manufacturers instructions. For one-dimensional (1D) analysis, 20 µg of F/TE was electrophoresed in a 12% SDS-PAGE gel. For two-dimensional (2D) analysis, 50 µg of F/TE was electrofocused on 7-cm Immoboline isoelectric focusing strips, with a linear pH 4–9 (Amersham Pharmacia Biotech). After focusing was complete, the isoelectric focusing strips were electrophoresed in a 8–16% precast SDS-PAGE gel (Bio-Rad). For both one-dimensional and two-dimensional gels, separated proteins and molecular mass standards were electrotransferred to a nitrocellulose membrane (Bio-Rad) and blocked for 30 min in HBSS containing 1% BSA and 0.1% Tween 20. Membranes then were incubated for 2 h at room temperature with 20 µg/ml biotinylated VLA-5 dissolved in HBSS containing 1% BSA and 0.2% Tween 20. After extensive washing, membranes were developed by incubation with a 1/1000 dilution of alkaline-phosphatase conjugated anti-biotin mAb BN-34 (Sigma-Aldrich). Bands then were visualized by incubation with chromogenic NBT-5-bromo-4-chloro-3-indolyl phosphate (BCIP).
Identification, cloning, and expression of Hc CypA
Fifty milligrams of F/TE was resolved by preparative isoelectrofocusing using a Rotofor apparatus (Bio-Rad). Fractions were tested for the presence of VLA-5 ligand by running aliquots in 1D SDS-PAGE followed by Far Western blot analysis. Fractions containing the VLA-5-reactive band were pooled and resolved again by preparative isoelectrofocusing using the small cell system of the Rotofor. Positive fractions were resolved in a preparative 12% SDS-PAGE gel and electroblotted onto polyvinylidene difluoride (PVDF) membranes (Immobilon-P; Millipore). Protein bands were visualized with Coomassie brilliant blue, and the band with the appropriate MW was submitted for N-terminal Edman degradation sequencing (Midwest Analytical).
To obtain internal sequence information, PVDF- immobilized protein was chemically cleaved with cyanogen bromide. Peptide fragments were eluted from the membrane by organic extraction with acetonitrile, and resolved in a 10–20% Tris-Tricine SDS-PAGE, followed by electroblotting and Edman degradation sequencing as described above. Readable sequence was used in BLAST-X searches of GenBank and SwissProt databases and revealed homology to the amino-terminal sequences of CypA proteins from several fungal species. The typical molecular mass of cyclophilins, 18–22 kDa, was consistent with the protein identified on Far Western blots. A search of the Hc genome project identified a putative-coding sequence in contig_11286 HCG217B. The sequence was analyzed with the SoftBerry GeneFinder on-line server (http://www.softberry.com/berry.phtml) that correctly identified the Hc CypA coding sequence, the presence of three introns, and predicted a 181-aa protein with a molecular mass of 19 kDa and a pI of 7.83. The molecular identity of the original band recognized by VLA-5 was confirmed by in gel trypsin digestion and MALDI-TOF mass spectroscopy (Voyager DE-PRO; Applied Biosystems).
CypA cDNA was prepared by RT-PCR using Pfu Ultra High Fidelity DNA polymerase (Stratagene). The sense primer was GTGGTCATATGACGAGAACTTTCTTCGAG corresponding to the amino-terminal sequence of mature Hc CypA and introducing a NdeI site to facilitate cloning. The antisense primer was GGTGGTTGCTCTTCCGCAAAAAACCTGACCACAGTTGACGATC, corresponding to the carboxyl terminus of the gene and introducing a SapI site to facilitate cloning. cDNA was cloned between the NdeI and SapI sites of the pTWIN vector (New England Biolabs). In this expression format, the CypA sequence is fused in frame with the Mxe GyrA intein, which catalyzes cleavage of the recombinant product in the presence of thiol reagents, followed by a chitin-binding protein, which is used for purification of the recombinant protein. The recombinant construct was expressed in Escherichia coli and affinity purified on chitin resin columns according to the manufacturers instructions. rCypA differs from the native sequence by having an extra phenylalanine residue at its carboxyl terminus that was introduced to enhance intein-mediated cleavage.
Antibodies
Rabbit polyclonal anti-Toxoplasma CypA was a gift from Dr. J. Aliberti (National Institute of Allergy and Infectious Diseases, Bethesda, MD). Rabbit polyclonal anti-Hc-CypA was prepared commercially by Antibodies by two immunization injections with 100 µg of rCypA. Specific anti-CypA Abs were affinity purified from rabbit antiserum by passage through a column of rCypA immobilized on Sepharose, followed by elution of the bound protein at pH 3.0. The specificity of the polyclonal Ab was tested by probing a F/TE and total protein extract of Hc on Western blots. In both cases, only a single band of 20 kDa was observed (data not shown). For flow cytometry experiments, preimmune rabbit serum was used as a negative control. The natural Abs present in rabbit serum against common fungal cell wall polysaccharides were removed by two absorptions with 2 x 106 viable Saccharomyces cerevisiae (Sc) yeasts (4). As an additional control, the anti-CypA Abs in immune rabbit serum were removed by absorption with rCypA immobilized on Sepharose.
CypA- and fibronectin (FN)-coated polystyrene beads
One x 109 of 2-µm fluorescent polystyrene beads (Sigma-Aldrich) were washed in pH 6.0 phosphate buffer and then incubated with 1 mg/ml rCypA or FN (Sigma-Aldrich) in the same buffer for 12 h at room temperature. Approximately 30% of rCypA or FN was bound to the surface of the beads. Subsequently, the beads were blocked and washed five times in 10 mg/ml BSA in PBS. Control beads were coated with BSA using the same procedure. The presence of surface-bound rCypA was confirmed by flow cytometry.
Preparation of CypA-depleted F/TE
F/TE (500 µl) was incubated twice with 100 µl of rabbit anti-CypA immobilized on Sepharose to deplete the CypA. As a control, F/TE was incubated with rabbit IgG-Sepharose. The effectiveness of the depletion was ascertained by Western blot analysis of the FT/E supernatants.
Silencing of CypA expression in Hc
The uracil auxotrophic Hc strain UC7 was provided by Dr. G. Smulian (University of Cincinnati, Cincinnati, OH). The CypA-silencing construct was constructed in the telomeric plasmid pCR83 provided by Dr. W. Goldman (Washington University School of Medicine, St. Louis, MO). This plasmid contains telomeric sequences and the complementation marker URA5 from Podospora anserina. A 600-bp inverted repeat encompassing all of the CypA-coding region was placed in front of the P-CBP1 promoter and terminator. The plasmid then was introduced into UC7 by electroporation and transformants were allowed to grow in minimal medium. A total of 30 colonies was expanded and further analyzed. The effectiveness of the silencing was verified by quantitative RT-PCR using primers specific for CypA sequences and by Western blot using the rabbit anti-CypA polyclonal Ab.
Biotinylation and precipitation of surface proteins on Hc yeasts
Log-phase Hc yeasts (2 x 108) were suspended in 1 ml of PBS or PBS containing 10 mg/ml EZ-link sulfo-NHS-LC-biotin (Pierce) for 2 h at 4°C. The yeasts then were washed with TBS to quench unreacted NHS-biotin. Surface proteins were extracted by two freeze thaw cycles as described above. From the resulting F/TE, CypA was immunoprecipitated using 50 µl of rabbit anti-CypA immobilized on Sepharose. F/TE and immunoprecipitated material then were electrophoresed on a 12% SDS-PAGE gel, electroblotted, and the presence of covalently bound biotin was detected by Western blot analysis using alkaline phosphatase-labeled anti-biotin mAb BN-34 (Sigma-Aldrich).
Detection of CypA on the surface of Hc yeasts by flow cytometry
Log-phase Hc yeasts (5 x 105) were suspended in staining buffer (PBS containing 2% BSA and 0.1 M sodium azide) and incubated with equivalent concentrations of the following Abs: preimmune rabbit IgG absorbed with viable Sc, anti-CypA IgG absorbed with Sc, anti-CypA IgG absorbed with Sc and rCypA-Sepharose, and anti-CypA IgG absorbed with Sc and BSA-Sepharose. PBS was used as a negative control. After 1 h at 4°C, the yeasts were washed five times with PBS and then were incubated with PE-labeled goat anti-rabbit IgG (BD Biosciences Pharmingen) for an additional hour. After further washing, the yeasts were fixed in 1% paraformaldehyde. All samples were analyzed by flow cytometry on a FACSCalibur flow cytometer (BD Biosciences) and the acquired data were analyzed with FCS Express (De Novo Software).
Preparation of human M
and DC
Human monocytes were purified from blood obtained from the Hoxworth Blood Center (Cincinnati, OH). After partial purification via dextran sedimentation and Ficoll-Hypaque centrifugation, monocytes were separated from lymphocytes by positive selection with anti-CD14 and EasySep magnetic nanoparticles (StemCell Technologies) according to the manufacturers instructions. M
were obtained by culture of monocytes at 1 x 106/ml in Teflon beakers in RPMI 1640 containing 15% human serum, 100 U/ml penicillin, and 100 µg/ml streptomycin (Sigma-Aldrich) for 5–7 days (3). DC were obtained by culture of the monocytes in 6-well tissue culture plates (Corning-Costar) at 6.5 x 105/ml in RPMI 1640 containing 200 mM glutamine, 50 µM 2-ME (Sigma-Aldrich), 10% heat-inactivated FCS (Life Technologies), 50 ng/ml kanamycin (Sigma-Aldrich), 1% nonessential amino acids (BioWhittaker), and 1% pyruvate (BioWhittaker). Human rGM-CSF (115 ng/ml; PeproTech) and human rIL-4 (50 ng/ml; PeproTech) also were added to each well and DC were studied after 6–8 days of culture (9). The acquisition and use of human blood cells for these studies has been approved by the Internal Review Board of the University of Cincinnati College of Medicine.
Chinese hamster ovary cells (CHO) transfected with VLA-5 (CHO VLA-5)
CHO VLA-5 cells and nontransfected CHO cells (a gift from Dr. R. Juliano, University of North Carolina, Chapel Hill, NC) were cultured in
MEM medium (Life Technologies) containing 10% FBS and 10 µg/ml gentamicin. Five hundred micrograms of geneticin/ml (G418; Life Technologies) was included with the CHO VLA-5 cells to maintain the transfection. Cells were harvested by scraping after reaching 80% confluence and were passaged or used in binding experiments with Hc yeasts or polystyrene beads.
Binding of Hc yeasts and polystyrene beads to DC, M
, and CHO VLA-5 cells
DC, M
, or CHO VLA-5 cells were suspended to 2.5 x 105 cells/ml in HBSA containing 2% aprotinin and 5 µl of cells were allowed to adhere in the wells of a Terasaki culture plate (Miles) that had been coated with 1% human serum albumin. Nonadherent cells were removed by washing and 5 µl of test proteins or HBSA as a control then were added to each well. After 30 min of incubation at 37°C, 5 µl of FITC-labeled HK Hc yeasts (5 x 106/ml) or 5 µl of protein-coated polystyrene beads (2 x 107/ml) in HBSA were added to the wells and incubated at 37°C for 30 min. Nonadherent yeasts or beads were removed by washing with HBSS and the monolayers were fixed with 1% paraformaldehyde overnight. Cell-bound yeasts or beads were quantified by phase-contrast and fluorescent microscopy on an inverted microscope (Diaphot; Nikon) (4). The results are expressed as the attachment index (AI), the total number of yeasts or beads bound to 100 cells, or the percent inhibition of binding (1 – experimental AI/control AI x 100). All experiments were performed in duplicate or triplicate.
| Results |
|---|
|
|
|---|
Previously, we demonstrated that adherence of Hc yeasts to DC is inhibited by preincubation of the DC with a Hc F/TE or a Hc F/TE immunodepleted of HSP60 (4). These findings indicated that the F/TE contains one or more moieties that are involved in the binding of Hc yeasts to DC VLA-5 that is distinct from HSP60. To identify these ligands, we applied the same approach that we had used successfully to identify HSP60 as a Hc ligand for M
CD18 (4). VLA-5 was covalently tagged with biotin and used to probe 1D and 2D Far Western blots of Hc F/TE. Fig. 1 shows a 20-kDa protein with a pI of
8.0 as a major VLA-5-binding protein present in F/TE. The presence of 5 mM EDTA appropriately abrogated recognition of the band, as the binding of Hc yeasts to DC VLA-5 is calcium dependent (9) (data not shown).
|
A search of the Hc genome project identified a putative-coding sequence in contig_11286 HCG217B. The sequence ANAGPNTNGS also was contained in the coding sequence, but is interrupted by an intron. The contig was analyzed using the SoftBerry GeneFinder on-line server (http://www.softberry.com/berry.phtml), which correctly identified the open reading frame, the presence of three introns, and a 181-aa protein with a molecular mass of 19 kDa and a pI of 7.83 (supplemental Fig. 1).4 The location of the introns and the transcription start site of the gene were confirmed by RT- PCR and 5' RACE analysis (data not shown).
The identity of the 20-kDa band as CypA was confirmed by two additional methods. Given that human CypA has 61% identity with the Hc protein, aliquots of F/TE were run in 1D SDS-PAGE gels and probed with either VLA-5 by Far Western blot or with a commercial polyclonal rabbit anti-human CypA (US Biologicals). Fig. 2 shows that both probes recognize a band of identical molecular mass in the F/TE. We performed in silico digestion of the predicted Hc CypA using Protein Prospector MS-Digest (http://prospector.ucsf.edu/ucsfhtml4.0/msdigest.htm) and compared the predicted masses with the spectrum obtained by trypsin digestion/MALDI-TOF spectroscopy. Sequence coverage of 25% was observed, indicating a positive identification (data not shown).
|
Although identification of CypA in F/TE of Hc yeasts suggests that this molecule must be present on the yeasts surface, we sought to confirm this localization in two additional experiments. In the experiment shown in Fig. 3, Hc surface proteins were labeled with NHS-biotin that is impermeant to cell membranes. The labeled proteins were released by two freeze-thaw cycles and visualized with alkaline phosphatase-labeled anti-biotin mAb. Nonbiotinylated Hc yeasts were used as a negative control (Fig. 3, lane A: nonbiotinylated F/TE extract; lane B: nonbiotinylated F/TE extract immunoprecipitated with anti-CypA), demonstrating that no protein in Hc F/TE is naturally biotinylated. A complex mixture of Hc surface proteins was revealed on the biotinylated yeasts (Fig. 3, lane C). CypA then was specifically immunoprecipitated from the mixture and the biotin tag was visualized by colorimetric assay (Fig. 3, lane D).
|
|
To determine whether rCypA inhibited the binding of Hc yeasts to DC, DC were preincubated for 30 min with varying concentrations of rCypA. F/TE was used as a positive control and rHSP60 was used as a negative control. FITC-labeled HK Hc yeasts then were incubated with the DC for an additional 30 min. As shown in Fig. 5, rCypA inhibited the binding of Hc to DC in a concentration-dependent manner. In contrast, rCypA did not block the binding of Hc yeasts to M
(data not shown). As expected, rHSP60 did not inhibit Hc binding to DC.
|

Although VLA-5 only recognized a major single band on Far Western blots, this observation does not prove that CypA is the only possible Hc ligand for VLA-5. Therefore, to determine whether other surface moieties on Hc yeasts might mediate binding to DC, we used RNA interference to silence CypA gene expression. Silencing of CypA in several individual strains was confirmed via Western blotting of F/TE for the expressed protein (Fig. 6A). As an additional control, we also tested the F/TE from WT and CypA-silenced strains for the expression of HSP60. The intensity of the HSP60 bands was comparable between WT and silenced strains (supplemental Fig. 2).
|
compared with the wild-type (WT) strain of G217B and to the G217B ura5 (UC7), the progenitor strain for the silencing experiments. All five silenced strains tested showed significantly reduced binding (65–85%) to DC (Fig. 6B), but bound normally to M
(Fig. 6C). These data suggest that at least another moiety on the surface of Hc yeasts is present that mediates binding to DC. F/TE from CypA-silenced Hc yeasts or from WT yeasts depleted of CypA inhibit the binding of yeasts to DC
To confirm the idea that additional ligands play a role in the attachment of Hc yeasts to DC, two additional experiments were performed. In the first experiment, F/TE was prepared from three of the CypA-silenced strains and then tested for their capacity to inhibit the binding of WT yeasts to DC. As shown in Fig. 7, F/TE from WT and UC7 yeasts inhibited binding of yeasts to DC by
80%. The F/TE from the three CypA-silenced strains inhibited the binding of yeasts to DC by 50%.
|
|
Finally, we sought to determine whether rCypA would further inhibit the binding of CypA-silenced yeasts to DC. DC were preincubated with HBSA or rCypA for 30 min and then incubated for an additional 30 min with either WT yeasts or one of the CypA-silenced strains. In two independent experiments, rCypA inhibited the binding of WT yeasts to the same level of binding as the CypA-silenced yeasts, but rCypA did not further reduce the adherence of CypA-silenced Hc yeasts (Table I).
|
, and CHO VLA-5 cells
M
and DC possess both CD18 and VLA-5, and yet Hc yeasts bind to CD18 on M
(2) and to VLA-5 on DC (9). It also is known that CD18 receptor mobility is necessary for the attachment of Hc yeasts to M
(3). Therefore, it is possible that differences in receptor mobility on DC and M
account for the specific receptor usage by Hc yeasts. A second possible explanation for differential receptor usage is that specific receptor engagement is a function of ligand density on the surface of the yeasts. To explore the latter possibility, we prepared latex beads coated either with rCypA or with FN (another ligand for VLA-5) and quantified their attachment to DC, M
, and CHO VLA-5 cells. Based on the amount of protein bound to the beads, the beads contained an average 1.0 x 107 molecules of CypA/bead and 4.1 x 105 molecules of FN/bead.
DC and M
were incubated in HBSA or with rCypA for 30 min and then incubated with rCypA- or FN-coated beads for an additional 30 min. Both CypA- and FN-coated beads bound avidly to DC and M
, and binding was significantly greater than the attachment of BSA-coated beads that served as a control for background binding (Fig. 9). Furthermore, rCypA inhibited the binding of rCypA-coated beads, but not FN-coated coated beads, to DC and M
.
|
, rCypA inhibited the binding of the rCypA-coated beads but not FN-coated beads. Only minimal binding of the beads was observed with nontransfected CHO cells (data not shown). Most interesting was the fact that Hc yeasts did not bind to the CHO VLA-5 cells, even after coculture for up to 2 h (data not shown).
|
| Discussion |
|---|
|
|
|---|
, presumably in the absence of serum opsonins (1). The identity of the host cell receptors and corresponding fungal ligands involved in this interaction is pivotal to understanding the pathogenesis of Hc and the generation of the adaptive immune response. Original studies demonstrated that Hc yeasts are recognized by the CD11/CD18 β2 integrin receptors on human M
(2) and that these integrins recognize HSP60 on the surface of Hc yeasts (4). Attachment of Hc yeasts to the M
results in rapid ingestion and localization in a phagosome (3). Phagosome maturation is prevented by the fungus. permitting the yeasts to survive and proliferate (13).
In contrast to M
, Hc engulfed by human DC are killed and degraded, and then Hc-derived Ags are presented to T cells inducing them to proliferate (9). Thus, phagocytosis of Hc yeasts by DC is a crucial step in the development of T cell-mediated immunity. Although human DC contain CD18 integrins on their surface, Hc binds to the
5β1 integrin, VLA-5, a FN receptor (9). Because rHSP60 does not inhibit the attachment of Hc yeasts to human DC, at least one other molecule must be involved in DC-Hc interaction. The experiments described in this report provide several lines of evidence that one VLA-5 cognate ligand is Hc CypA.
CypA is a highly conserved, low molecular mass chaperone, which belongs to the general group of peptidyl-prolyl cis-trans isomerases (PPIases). Its purported function is to catalyze peptide chain conformation changes around proline residues. CypA also is the molecular target of the immunosuppressive antibiotic cyclosporin A, which inhibits its enzymatic activity (14). A second group of PPIases known as FK506-binding proteins, and generally termed immunophilins, are the receptors for the immunosuppressive drugs FK506 and rapamycin (15). Despite their ubiquitous presence in evolution, from bacteria to mammals, PPIases are dispensable for survival. For example, CypA-deficient mice are viable and immunocompetent, but are resistant to the immunosuppressive effects of cyclosporine (16).
It is noteworthy that rCypA inhibited the binding of Hc yeasts to DC but not to M
, but that CypA-coated polystyrene beads bound to both DC and M
, in sync with the fact that both of these innate immune cells contain equivalent amounts of VLA-5 on their surface (L. Gildea, unpublished observations). Furthermore, rCypA inhibited the binding of CypA-coated beads, but not FN-coated beads, to DC, M
, and CHO-VLA-5 cells, demonstrating that CypA and FN bind to different sites on the VLA-5 molecule. Provocatively, Hc yeasts did not bind to the CHO-VLA-5 cells, even after coculture for up to 2 h. This result may be explained by the following two facts. First, the amount of CypA on the surface of Hc yeasts is considerably less than the amount of CypA that was bound to the polystyrene beads. Second, FACS analysis demonstrated that the CHO-VLA-5 cells had a half log less VLA-5 on their surface than DC (supplemental Fig. 3).
Since DC and M
have equivalent amounts of VLA-5 on their surface, the basis for the differential receptor usage by DC and M
to bind Hc yeasts is unclear. One hypothesis supported by the data is that the differential receptor usage is due to reciprocal receptor mobility.
Another possible explanation for the differential receptor usage is the phenomenon "inside-out" regulation of integrin avidity for ligands. Intracellular signals in the phagocyte cytoplasm may change the phosphorylation status in the cytoplasmic tails of CD11/CD18, VLA-5 and other integrins, effectively switching them from a high-affinity state to a low-affinity state (or vice versa) for cognate ligands (17, 18). Thus, it is possible that M
and DC have the ability to choose which integrin to utilize in binding and ingesting a specific parasite, based on other as yet unidentified signals.
The demonstration that CypA plays a role in the pathogenicity of Hc is not unique. Legionella pneumophila expresses a surface virulence factor, M
infectivity potentiator (Mip), that is an 18-kDa immunophilin with PPIase activity that has a high affinity for the immunosuppressive drug FK506 (19). Legionella also possess a second cytoplasmic cyclophilin, cyclophilin 18. Mip protein is not necessary for the extracellular survival of Legionella, but disruption mutants are 10 times less invasive of Acanthamoeba castellani (20). Interestingly, the Hc CypA sequence is not homologous to L. pneumophila Mip, but shows a high degree of conservation with the cytoplasmic form cyclophilin 18. In extensive searches through the Hc genome, we did not find a Mip homolog or other sequence homologs to Hc CypA.
Trypanosoma cruzi secretes a Mip-like protein involved in cell invasion and virulence and its activity as an invasion factor is inhibited by FK506 (21). Several species of Plasmodia secrete low molecular mass FK506-binding PPIases that are necessary for intracellular invasion, and their inhibition by cyclosporine and FK506 explain the antiparasitic properties of these drugs (22, 23). Finally, Toxoplasma gondii secretes an 18-kDa protein, cyclophilin 18, that activates human DC through the chemokine receptor CCR5 and induces the secretion of IL-12 (24). Thus, PPIases from several microorganisms play a role in their pathogenesis.
VLA-5 is a heterodimeric β1 integrin receptor composed of the
5 chain (CD49e) and the β1 chain (CD29) (25) and is one of several integrin receptors for FN (26). It is expressed on a wide variety of cells including T cells, monocytes, M
and DC (27). VLA-5 and VLA-4 both play significant roles in the transendothelial migration of T cells, M
, and DC (28, 29, 30).
With regard to pathogen recognition, β1 integrins are utilized by T. cruzi to gain entrance into human M
(31), and the Yersinia membrane protein invasin mediates adhesion to human T cells via VLA-4 (32). In an apparent two step process, binding and cross-linking of monocyte VLA-5 by Bordetella pertussis enhances the binding activity of CD11b/CD18 (CR3), which, in turn, facilitates phagocytosis of the bacteria (33). Other intracellular pathogens, including L. pneumophila (34), Mycobacterium tuberculosis (35), and Leishmania major (36) utilize CD18 receptors to gain entrance into M
. Perhaps uniquely, human M
and DC use different receptors, CD18 and VLA-5, respectively, to mediate attachment of the same microorganism, Hc. Conversely, different Hc ligands are recognized by these receptors. This situation occurs despite the fact that M
and DC have both CD18 and VLA-5 receptors. We hypothesize that the specific receptor-ligand interaction of Hc yeasts with M
vs DC leads to the induction of unique signaling pathways that allow the yeasts to survive in M
, but leads to their demise in DC.
This mechanism of Hc attachment and invasion of mammalian host cells is shared by a wide array of prokaryotic and eukaryotic intracellular parasites, suggesting either a conserved ancestral mechanism of cell-cell interaction or a phenomenon of convergent evolution. Hc choice of ligands, HSP60 and CypA, bear remarkable parallels: Both molecules are evolutionary conserved molecular chaperones. When found in the cytoplasm, they are involved in the conformation and renaturation of nascent peptides. When found in the extracellular milieu, both molecules have stimulatory activity for the innate immune system and, in the case of HP60, an adaptive immunity inducer and a protective vaccine (37). This "moonlighting" multiplicity of functions attributable to a small number of proteins can, in part, be explained by these proteins promiscuous interaction with a wide variety of partners. In contrast, in their capacity as microbial ligands, each of these proteins apparently play quite specific roles in Hc pathogenesis: HSP60 involved in intracellular survival, proliferation, and dissemination, while CypA is involved in initiation of adaptive immune responses.
Finally, the data clearly demonstrate that CypA is not the only ligand on Hc yeasts that promotes binding to DC. Since rCypA almost completely blocks binding of yeasts to DC, the other ligand(s) probably is in close proximity to CypA on the yeasts surface, and, therefore, is unable to promote binding to DC under these circumstances. However, if CypA is removed from the surface of the yeasts, the yeasts still bind to DC. Furthermore, if CypA is removed from F/TE, the depleted F/TE still inhibits the binding of yeasts to DC. This interpretation of the data is supported by the fact that the 6.5 µg of rCypA that optimally inhibits Hc yeast attachment to DC is three to five times more than the amount of CypA that is in 5 µl of F/TE that also optimally inhibits Hc binding to DC (supplemental Fig. 4). Finally, in reviewing our initial Far Western blots, a second very feint band can be seen that binds VLA-5. Current efforts are directed to identifying this second ligand for DC VLA-5.
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by U.S. Public Health Service Grants AI49358 and AI061298 from the National Institutes of Allergy and Infectious Diseases. ![]()
2 Address correspondence and reprint requests to Dr. Francisco Gomez, Division of Infectious Diseases, University of Cincinnati College of Medicine, P.O. Box 670560, Cincinnati, OH 45267. E-mail address: francisco.gomez{at}uc.edu ![]()
3 Abbreviations used in this paper: Hc, Histoplasma capsulatum; M
, macrophage; DC, dendritic cell; CypA, cyclophilin A; F/TE, freeze/thaw extract; WT, wild type; FN, fibronectin; HK, heat killed; Sc, Saccharomyces cerevisiae; HSP60, heat shock protein 60; CHO, Chinese hamster ovary; 1D, one dimensional; 2D, two dimensional; AI, attachment index; PPIase, peptidyl-prolyl cis-trans isomerase; Mip, M
infectivity potentiator. ![]()
4 The online version of this article contains supplemental material. ![]()
Received for publication March 27, 2008. Accepted for publication September 9, 2008.
| References |
|---|
|
|
|---|
-helix. EMBO Rep. 3: 88-94. [Medline]
4β1 (VLA-4) and
5β1 (VLA-5) integrins. J. Immunol. 151: 149-158. [Abstract]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |