The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

The Journal of Immunology, 2008, 181, 6770 -6778
Copyright © 2008 by The American Association of Immunologists, Inc.
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stojakovic, M.
Right arrow Articles by Vukmanovic, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stojakovic, M.
Right arrow Articles by Vukmanovic, S.

Adaptable TCR Avidity Thresholds for Negative Selection1

Milica Stojakovic*, Laura I. Salazar-Fontana*, Zohreh Tatari-Calderone*, Vladimir P. Badovinac{dagger}, Fabio R. Santori2,§, Damian Kovalovsky, Derek Sant'Angelo, John T. Harty{ddagger} and Stanislav Vukmanovic3,*,§

* Center for Cancer and Immunology Research, Children’s Research Institute, Children’s National Medical Center, Washington, DC 20010; {dagger} Department of Pathology, Carver College of Medicine and {ddagger} Department of Microbiology, University of Iowa, Iowa City, IA 52242; § Department of Pathology, Michael Heidelberger Division of Immunology, and New York University Cancer Center, New York University School of Medicine, New York, NY 10016; and Laboratory of T Cell Immunobiology, Immunology Program, Memorial Sloan-Kettering Cancer Center, New York, NY 10021


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Central tolerance plays a significant role in preventing autoimmune diseases by eliminating T cells with high and intermediate avidity for self. To determine the manner of setting the threshold for deletion, we created a unique transgenic mouse strain with a diverse T cell population and globally increased TCR avidity for self-peptide/MHC complexes. Despite the adaptations aimed at reducing T cell reactivity (reduced TCR levels and increased levels of TCR signaling inhibitor CD5), transgenic mice displayed more severe experimental allergic encephalomyelitis and lupus. The numbers and activity of natural (CD4+CD25+) regulatory T cells were not altered. These findings demonstrate that the threshold for deletion is adaptable, allowing survival of T cells with higher avidity when TCR avidity is globally increased.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
T cells capable of causing autoimmune diseases are present in the circulation of apparently healthy individuals. The current thought on the topic is that the mechanisms of central tolerance eliminate most of the T cells with the potential to induce autoimmunity, sparing only those with relatively low avidity for self-peptide/MHC complexes (1). Functional adaptation of autoreactive T cells and their regulation by specialized T cell subpopulations prevent the induction of autoimmunity (2, 3). How is the threshold for T cell elimination in the thymus determined? One possibility is that the threshold is relative, designed to allow maturation of a given fraction of thymocytes irrespective of the actual TCR avidities for self. An alternative is that an absolute threshold is established whereby any T cell with an avidity that is over that threshold is eliminated, irrespective of the avidity range of T cells petitioning for negative selection. Although TCR- transgenic mice were instrumental for studying many aspects of negative selection in the thymus, the need to address the outstanding questions using the polyclonal TCR repertoire of TCRβ-transgenic mice has recently been recognized (4, 5). We have recently described a TCRβ-transgenic mouse, designated MTB, that displayed stronger reactivity against alloantigens (6). The stronger reactivity was observed against the original alloantigen recognized by the parental T cells, as well as against an irrelevant alloantigen, suggesting that the transgenic TCRβ chain displays an increased reactivity to nonpolymorphic portions of MHC molecules. We here show that T cells from MTB mice display increased functional reactivity with self-peptide/MHC complexes leading to more severe autoimmunity, despite attempts to reduce T cell activation via CD3 down-modulation and/or CD5 up-regulation.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Mice and in vivo manipulations

C57BL/6 and β2-microglobulin (β2m)4/Abβ double-deficient mice were purchased from Taconic Farms. BXSB mice were obtained from The Jackson Laboratory. The generation of MTB TCRβ-transgenic mice has previously been described (6). MBPβ and 2B4β TCRβ-transgenic mice were obtained from Drs. J. Goverman (University of Washington, Seattle, WA) and L. Berg (University of Massachusetts, Worcester, MA), respectively. The D011β was purchased from Taconic Farms while the HYβ TCRβ-transgenic mouse was made in Dr. D. Sant'Angelo’s laboratory using the original HY cosmid (7). To induce syngeneic responses to lymphocytic choriomeningitis virus (LCMV), 15 x 106 of each C57BL/6.PLJ (Thy1.1+) and the MTB (Thy1.2+) spleen cells were coinjected i.v. into RAG-2-deficient hosts. The recipient mice were immunized within 48 h with 2 x 105 PFU/mouse of LCMV (Armstrong strain). Seven days later, spleen cells from recipient mice were stimulated in vitro with a CD4+ T cell epitope LCMV gp61–80 or with a mixture of the following CD8+ T cell epitopes gp33–41, NP396–404, gp276–286, and NP205–212 and stained for cell surface CD4, CD8, Thy1.1, and Thy1.2 and intracellular IFN-{gamma} content as previously described (8). All experiments using laboratory animals have been approved by the Institutional Animal Care and Use Committees of New York University School of Medicine, Children’s Research Institute, Sloan-Kettering Institute, and the University of Iowa.

For induction of experimental allergic encephalomyelitis (EAE), five mice per group were injected with an emulsion of MOG38–50 peptide (9) solution in CFA containing Mycobacterium tuberculosis, as previously described (10). Mice also received 500 ng of pertussis toxin on days 0 and 2 relative to the encephalitogenic challenge. Mice were followed daily for clinical signs of the disease and were graded on the following basis: 0, no clinical signs; 1, flaccid tail; 2, hind limb paresis or partial paralysis; 3, total hind limb paralysis; 4, hind and front limb paralysis; and 5, moribund state or death. EAE was reinduced on day 35 following the first injection in an identical manner, except for the use of IFA instead of the CFA (11).

Induction and evaluation of lupus erythematosus

Male BXSB males were bred with MTB females and the MTB transgene was inherited in approximately one-half of the offsprings. Male F1 mice were followed for the development of proteinuria and autoantibodies to dsDNA. Urine protein concentrations were measured using QuickVue UrinChek 10+ SG strips (Quidel). Strips were coated with fresh urine and immediately assigned a score according to the change of color: grade 1, >30 mg/dl; 2, >100 mg/dl; and 3, >500 mg/dl. Anti dsDNA Abs were detected in a 1/100 dilution of plasma (in PBS) using an anti-dsDNA Abs ELISA kit (Alpha Diagnostic International) according to the manufacturer’s instructions.

Quantitative PCR

Total RNA was isolated from cells using TRIzol (Invitrogen) followed by RNase clean-up and treatment with DNase I (Qiagen). Total RNA was reverse transcribed using the Superscript II RT kit and random hexamers as primers (Invitrogen). All PCR were done in triplicates using an Applied Biosystems Prism 7700 Sequence Detector. TCRβ, FoxP3, and 18S rRNA were amplified using TaqMan Universal PCR master mix (Applied Biosystems). The average threshold cycles of the triplicates was used to compare the relative abundance of the mRNA. Threshold cycles of 18S rRNA were used to normalize all samples. TCRβ and FoxP3 primers were designed to amplify the sequence derived from two distinct adjoining exons, to avoid amplification of genomic DNA. This was not possible for 18S rRNA, which is an intronless gene. The DNA contamination in these samples was excluded by amplifying control samples treated identically with the exception of the reverse transcriptase step. All primers and TaqMan probes were purchased from Applied Biosystems. The sequences of TCRβ-specific primers were 5'-tcacccaaacctgtcacacaga (forward), 5'- ctcatagaggatggttgcagaca (reverse), and 5'-agcagactgtggaatc (probe), whereas those of FoxP3 and 18S rRNA were reported previously (12, 13). Hybridization probes were labeled with FAM (FoxP3 and TCRβ) or VIC (18S rRNA) reporter fluorescent dyes and TAMRA quencher fluorescent dye (all probes).

Flow cytometry

Direct immunofluorescence staining was performed using the following reagents: FITC-conjugated anti-Vβ2, FITC-, or allophycocyanin-conjugated anti-CD5, FITC-, or allophycocyanin-conjugated anti-CD4, PerCP-conjugated anti-CD3, PE-conjugated anti-mouse CD8{alpha}, and PE-conjugated anti-CD25 (all supplied by BD Pharmingen). Intracellular staining for FoxP3 was performed using an anti-mouse/rat FoxP3 staining kit from eBioscience.

Cell purification

Spleen cells were purified using CD8{alpha}, pan T cell, or regulatory T cell kits (Miltenyi Biotec). Microbead-labeled cells were positively and/or negatively, as per the manufacturer instructions, selected on magnetic cell separation (MACS) columns (Miltenyi Biotec). Cell purity was generally 92–97%, as determined by flow cytometry.

In vitro stimulation assays

Thymocytes from wild-type (WT) or MTB mice (2 x 105/well) were incubated for 72 h in flat-bottom 96-well plates in the presence of various concentrations of purified anti-CD3 mAb. Irradiated (2500 rad) WT spleen cells served as APCs in cultures (5 x 105/well). For testing the inhibition by regulatory T cells, WT CD8+ T cells, WT CD4+CD25+, and MTB CD4+CD25+ splenocytes were purified by magnetic beads and added each at 5 x 104/well to the cultures, as indicated. Irradiated WT APCs (1.5 x 105/well) and the anti-CD3 mAb (1 µg/ml) were added to all cultures. During the last 8–16 h of culture, cells were pulsed with 0.5 µCi of [3H]thymidine (ICN Biomedicals) and thymidine incorporation was subsequently measured using a 1450 MicroBeta beta scintillation counter (Wallac). For generation of CTLs, 25 x 106 spleen cells from WT or MTB mice were cultured for 5 days with the same number of irradiated (2500 rad) BALB/c spleen cells. Cytotoxic T cell activity against various targets was measured using the chromium release assay as previously described (6, 14).

Statistical analysis

Statistical significance of differences in the mean fluorescence intensities of CD5 and CD3 staining was calculated using the Wilcoxon-matched pairs test performed using GraphPad Prism software, version 5.0a.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
Increased levels of CD5 in preselection thymocytes of MTB mice

To determine the relative avidity for self-peptide/MHC complexes brought about by the transgenic TCRβ, we compared cell surface expression of CD5 in MTB and WT CD4+CD8+ thymocytes. CD5 levels in these cells are directly proportional to the avidity of the interaction of TCR with self-peptide/MHC complexes (15, 16). The levels of CD5 were higher in MTB than in the WT CD4+CD8+ thymocytes (Fig. 1A and Table I), and this was a consequence of interactions of TCR with self-peptide/MHC complexes, as suggested by two sets of data. First, CD5 levels in MTB and WT mice with homozygous disruption of both Abβ and β2m (lacking both MHC class I and class II molecules) were low and indistinguishable (Fig. 1B). Second, TCR expression by MTB CD4+CD8+ thymocytes was required for high levels of CD5 expression, since CD5low cells were also TCRlow (Fig. 1C). The high CD5 levels were not due to simply fixing the TCRβ chain, since CD5 levels were not significantly higher in the four transgenic strains expressing TCRβ chains from T cells of the β2m+/+ origin (Fig. 1D and data not shown).


Figure 1
View larger version (36K):
[in this window]
[in a new window]

  		FIGURE 1. Increased levels of CD5 by MTB CD4+CD8+ thymocytes. A, Thymocytes were stained with anti-CD4-PE, anti-CD8-PerCP, and anti-CD5-FITC Abs and analyzed by flow cytometry. Shown are overlay histograms of CD5 expression in WT (plain line) and MTB (bold line) by gated CD4+CD8+ thymocytes from a representative of five experiments. B, MTB mice were bred to the β2m/Aβ (MHC class I and class II)-double deficient background and thymocytes from F1 and F2 generations with indicated genotypes were analyzed as in A. Shown are mean fluorescence intensities of anti-CD5 by gated CD4+CD8+ thymocytes from a representative of three experiments. C, MTB thymocytes were stained as in A with addition of anti-TCRβ-allophycocyanin. Shown are dot plots displaying TCRβ and CD5 levels in gated CD4+CD8+ thymocytes. D, Thymocytes from WT (plain line), HYβ (bold line), or JGβ (dotted line) mice were stained and analyzed as in A. Similar results were obtained with two other TCRβ-transgenic strains (2B4β and DO11β; data not shown).

 

View this table:
[in this window]
[in a new window]

  		Table I. Summary of CD3 and CD5 levels in peripheral T cells and thymocytes of MTB and WT mice

 
Even though up-regulation of CD5 was initially described as a signature of CD4+CD8+ thymocytes undergoing positive selection (17), subsequent experiments have demonstrated that it can occur independent of positive selection (16). Similarly to the latter example, most CD5high MTB thymocytes clearly did not express CD69 (Fig. 2A), another marker of auditioning of CD4+CD8+ thymocytes for positive selection (18). Furthermore, the numbers of combined CD4+CD8– and CD4–CD8+ thymocytes were not significantly different in MTB and WT mice (Fig. 2, B and C). Despite the CD8+ T cell origin of the transgenic TCRβ chain, the ratio of mature T cell subsets in MTB mice favored CD4+CD8– thymocytes (Fig. 2B), consistent with the notion that stronger and/or more protracted TCR signaling leads to preferential commitment of CD4+CD8+ thymocytes to the CD4+CD8– lineage (19).


Figure 2
View larger version (41K):
[in this window]
[in a new window]

  		FIGURE 2. Positive selection of MTB thymocytes. A, WT and MTB thymocytes were stained with anti-CD5-allophycocyanin, anti-CD4-FITC, anti-CD8-PerCP, and anti-CD69-PE Abs and analyzed by flow cytometry. Shown are dot blots displaying CD5 and CD69 levels on gated CD4+CD8+ thymocytes. B, WT or MTB thymocytes were stained with anti-CD4-FITC, anti-CD8-PE, and anti-CD3-PerCP Abs. Shown are representative dot plots displaying CD4 and CD8 expression in gated CD3high thymocytes. C, Bar graph displaying total numbers of CD3highCD4+CD8– and CD3highCD4–CD8+ thymocytes in MTB and WT mice (five each). Similar numbers were obtained when the CD24low gate was used instead of the CD3high (data not shown). D, Spleen cells and thymocytes of MTB/TAP1–/–, TAP1–/–, MTB/TAP1+/+, or TAP1+/+ mice were stained with CD4– and CD8– specific Abs. Shown are the mean and SDs of the percent CD8+ T cells found in four individual mice of each genotype.

 
Another way to test the avidity of the MTB thymocytes was to breed them to the TAP-1-deficient background. TAP-1-deficient cells have drastically reduced levels of MHC class I molecules due to disrupted transport of cytosolic peptides to endoplasmic reticulum where MHC class I assembly occurs (20, 21). In the absence of cytosol-derived peptides, a drastically smaller set of peptides derived from various alternative Ag-processing pathways bind to the nascent MHC class I molecules (22). CD8+ T cells were more abundant than WT in both the thymus and the peripheral lymphoid tissues of TAP-1–/– mice, although the numbers were not completely restored to the levels seen in TAP-1+/+ mice (Fig. 2D). This experiment demonstrates that a greater portion of TCRs in MTB than in the WT thymus are capable of functionally interacting with MHC class I expressed at low levels. Taken together, increased levels of CD5 on CD4+CD8+ thymocytes, skewing of thymic selection in favor of CD4+CD8– lineage, and more efficient selection of CD8+ T cells in the TAP-1-deficient background in MTB relative to the WT mice suggest higher avidity of interactions with self-peptide/MHC complexes in MTB CD4+CD8+ thymocytes.

Adaptation of postselection T cells in MTB mice

In mature T cells, CD5 levels are also maintained by TCR interactions with self-peptide/MHC complexes (23). However, the ratio of CD5 and TCR/CD3 expression is a better predictor of the relative TCR avidity than CD5 levels alone (24). To test the effects of thymic selection on CD5 expression in MTB mice, CD5 levels were determined in mature thymocytes as well as in peripheral T cells. Similar to CD4+CD8+ thymocytes, CD5 levels in mature CD4+CD8– and CD4–CD8+ MTB thymocytes were higher than in equivalent WT cells (Fig. 3A and Table I). Although the difference was not as pronounced as in CD4+CD8+ thymocytes, it should be noted that the higher levels of CD5 in mature MTB T cells were achieved with fewer cell surface TCR/CD3 than in the WT mice. The difference in the TCR/CD3 expression was seen in mature (TCRhigh) but not immature (TCRlow) thymocytes (Fig. 3B and Table I), suggesting that the TCR/CD3 down-modulation in mature MTB thymocytes is an adaptation to environmental cues. Similar findings of increased CD5 and reduced TCR/CD3 were also consistently observed in peripheral T cells (Fig. 3 and Table I).


Figure 3
View larger version (33K):
[in this window]
[in a new window]

  		FIGURE 3. Adaptation of postselection MTB thymocytes and peripheral T cells. WT or MTB thymocytes or spleen cells, as indicated, were stained with anti-CD4-FITC, anti-CD8-PE, anti-CD5-allophycocyanin, and anti-CD3-PerCP Abs and analyzed by flow cytometry. A, Shown are overlay histograms of CD5 expression in WT (plain line) and MTB (bold line) CD4+CD8– and CD4–CD8+ cells. The numbers indicate mean fluorescence intensities. B, Shown are overlay histograms of CD3 expression in total thymocytes or CD8+ spleen cells from WT (plain line) or MTB (bold line) mice.

 
To test whether TCR/CD3 down-modulation may be functionally significant, we compared thymocyte proliferation in response to anti-CD3 stimulation, which was lower in MTB than in the WT mice (Fig. 4A), despite the similar numbers of activated CD4–CD8+ (Fig. 4B) or CD4+CD8– thymocytes (data not shown). This could be due to altered expression or activation of a signaling protein, adhesion/costimulatory molecule, or a transcription factor caused by distinct thymic selection process or a random transgene insertion. However, alloreactive activity of MTB thymocytes was in fact significantly stronger than that of the WT cells (Fig. 4C), despite a relatively equal proportion of WT and MTB CD4–CD8+ thymocytes up-regulating CD69 following stimulation with alloantigens (Fig. 4D). These findings suggest that the avidity for TCR ligands overcompensates for the lower levels of cell surface TCR and the higher expression of CD5, that is an inhibitor of TCR signaling (25). This finding excludes defects in adhesion/signaling in MTB T cells.


Figure 4
View larger version (33K):
[in this window]
[in a new window]

  		FIGURE 4. Functional characteristics of mature MTB thymocytes. A, Anti-CD3-induced proliferation of thymocytes from 6-wk-old WT or MTB mice was determined by tritiated thymidine incorporation. Irradiated WT spleen cells were added as APCs. Shown are means and SDs of triplicate cultures. The p values were 0.01353, 0.01183, 0.006186, and 0.01109 for cultures stimulated with 2.5, 0.5, 0.1, and 0.02 µg/ml anti-CD3, respectively. B, After overnight incubation with anti-CD3 Ab, MTB or WT thymocytes were stained with anti-CD4-allophycocyanin, anti-CD8-FITC, and anti-CD69-PE. Displayed is the percentage of CD69+ cells in gated CD4–CD8+ thymocytes reduced by the value obtained in unstimulated control thymocytes. C, Lysis of allogeneic (P815) and syngeneic (EL4) targets by thymocytes and spleen cells from 14-wk-old WT or MTB mice stimulated with irradiated BALB/c spleen cells. D, After overnight incubation with irradiated P815 cells, MTB or WT thymocytes were stained with anti-CD4-allophycocyanin, anti-CD8-FITC, and anti-CD69-PE. Displayed are the histograms of CD69 staining in gated CD4–CD8+ in stimulated (bold lines) or control (plain lines) thymocytes. The numbers indicate the percentage of cells with induced CD69 expression.

 
More severe EAE and lupus in MTB mice

Given the increased autoreactivity of MTB T cells, we wondered whether MTB mice are more prone to development of autoimmune diseases. MTB mice did not develop overt spontaneous autoimmune diseases on the C57BL/6 background. To test the impact of the MTB transgene on development of induced autoimmune diseases, EAE was induced in MTB or WT mice by immunization with MOG38–50 peptide. MTB mice developed a more severe form of the disease with an earlier onset and a later recovery than the WT mice (Fig. 5A). Furthermore, resistance to reinduction of EAE that experimental animals normally develop (11) was not complete in MTB mice, as they developed a blunted form of the disease following reimmunization with the MOG38–50 peptide.


Figure 5
View larger version (20K):
[in this window]
[in a new window]

  		FIGURE 5. Increased severity of EAE and lupus in MTB mice. A, Mean clinical scores of EAE in MTB and WT mice (five each) immunized at 8 wk of age with MOG38–50 peptide. On day 35, EAE was reinduced in recovered mice (arrow). Data shown are representative of three performed experiments. B, Average proteinuria scores (and SEs) in groups of six (MTB x BXSB)F1 and five (WT x BXSB)F1 male mice. The difference at 18 wk of age is statistically significant as determined by Wilcoxon’s rank test (p = 0.02574). C, Means (and SEs) of OD readings of ELISA detecting anti-dsDNA Abs in the plasma of 15-wk-old (MTB x BXSB)F1 and (WT x BXSB)F1 mice. The difference is statistically significant as determined by the Student t test (p = 0.04152).

 
We next crossed the MTB mice with the BXSB strain that spontaneously develops lupus erythematosus and F1 males were followed for development of proteinuria. The BXSB model of lupus was chosen for two reasons. First, genetic determinants of the disease located on chromosome 1 (26) are inherited dominantly, so that F1 offsprings of BXSB males and females of other strains also develop lupus (27). Second, normal T cells (from nonlupus prone animals) can reconstitute the disease in the lupus prone strain devoid of its own T cells (28), suggesting that no specific reactivity is required for T cells to induce lupus in this model. The levels of proteinuria were not different between (MTB x BXSB)F1 and (WT x BXSB)F1 mice at 6 wk of age (Fig. 5B). However, with further age, proteinuria increased to a greater degree in (MTB x BXSB)F1 than in (WT x BXSB)F1 mice. The most significant difference was noted in 18-wk-old mice (Fig. 5B). The levels of anti-dsDNA Abs immediately before this proteinuria peek were also significantly higher in (MTB x BXSB)F1 mice (Fig. 5C). Collectively, both EAE and lupus appear to be more severe in MTB mice, despite phenotypic and functional decreases in TCR/CD3 levels. Therefore, it would appear that at least some TCRs with a stronger than the WT potential to cause autoimmune diseases are spared from mechanisms of central tolerance in MTB mice.

Unaltered frequency of MTB T cells responding to foreign Ags

We have already shown that increased frequency of specific T cells is not the basis of increased alloreactive T cell responses in MTB mice (Fig. 4C). To address the same question in responses to foreign Ags presented by self-MHC, we assessed primary T cell responses to LCMV infection. To assure completely equal immunization conditions, RAG1-deficient hosts were coinjected with WT (Thy1.1+) and MTB (Thy1.2+) spleen cells and immunized with LCMV. Seven days after immunization, the frequency of IFN-{gamma}-producing CD4+ T cells in response to LCMV gp61–80 presented by H-2Ab to and gp33–41 or CD8+ T cells in response to the mixture of gp33–41, NP396–404, and gp276–286 presented by H-2Db, and NP205–212 presented by H-2Kb to (29) was determined by intracellular immunofluorescence staining. Overall, the frequency of the responding MTB CD4+ or CD8+ T cells was not higher than that found in the equivalent WT T cell subsets (Fig. 6). It is of interest to note that Vβ2 is one of the few Vβ families that do not participate in LCMV response in WT mice (30), yet MTB T cells are capable of raising a full response. We therefore conclude that frequency of MTB T cells responding to a foreign Ag does not exceed that seen in WT mice.


Figure 6
View larger version (23K):
[in this window]
[in a new window]

  		FIGURE 6. Characterization of T cell responses to LCMV. MTB (Thy1.2+) and WT (Thy1.1+) spleen cells were cotransferred to RAG1–/– mice that were subsequently challenged with LCMV. Seven days later, spleen cells from recipient mice were stimulated with LCMV CD4+ or CD8+ T cell epitopes. Stimulated cells were stained for cell surface CD4, CD8, allelic Thy1 marker, and intracellular IFN-{gamma} content. A, Shown are representative CD4/8 dot plot (left) and Thy1.1 plot in gated CD4+ T cells (right). B and C, Shown are histograms of IFN-{gamma} intracellular staining in gated CD4+ (B) or CD8+ (C) T cells, with the numbers indicating percentage of positive cells.

 
Similar numbers and activity of natural regulatory T cells in WT and MTB mice

The higher intensity of autoimmunity in MTB mice could be explained by reduced numbers or less potent activity of CD4+CD25+FoxP3+ regulatory T cells, even though the high avidity for self-peptide/MHC complexes was proposed to increase commitment of these cells (31, 32). The numbers of CD4+CD25+ or FoxP3+ cells, as well as the levels of FoxP3 mRNA in the spleen, thymus, or purified CD4+CD25+ cells, were comparable in MTB and WT mice (Fig. 7, A–D). Finally, inhibition of anti-CD3-induced proliferation of CD8+ T cells by purified WT or MTB CD4+CD25+ T cells was indistinguishable (Fig. 7E). Collectively, these findings suggest that the CD4+CD25+ regulatory T cell compartment in MTB mice is not significantly altered.


Figure 7
View larger version (42K):
[in this window]
[in a new window]

  		FIGURE 7. Unaltered natural regulatory T cell compartment in MTB mice. A, Spleen cells from MTB or WT mice were stained using CD4– and CD25-specific mAbs and analyzed by flow cytometry. B, Spleen cells from MTB (bold) or WT (plain) mice were permeabilized and stained using FoxP3-specific Ab. C, Detection of FoxP3 mRNA by quantitative PCR from total cellular RNA isolated from the spleens or thymus of MTB and WT mice. D, Detection of FoxP3 mRNA by quantitative PCR from total cellular RNA isolated from purified splenic CD4+CD25+ or CD4+CD25– T cells. E, Purified WT CD8+, WT CD4+CD25+ cells, or MTB CD4+CD25+ T cells were added, as indicated, to irradiated unseparated WT spleen cells that served as APCs in all wells. The cell mixtures were cultured in the presence of anti-CD3 mAb (1 µg/ml), as indicated, and proliferation was determined by tritiated thymidine incorporation. Shown are the mean and SEs of quadruplicate cultures.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
Our findings demonstrate that a single TCR chain can impose globally stronger T cell autoreactivity, evident by high levels of CD5 expression in MTB CD4+CD8+ thymocytes, skewed commitment toward CD4+CD8– lineage, and more efficient selection of CD8+ cells in the TAP-1-deficient background. Furthermore, the phenotypic and functional adaptation of mature T cells and more severe autoimmune diseases in MTB mice suggest that T cells with reactivity to self stronger than in the WT mice escape the process of negative selection.

CD5 levels increase in CD4+CD8+ thymocytes in response to TCR interactions with self-peptide/MHC complexes (15, 16). The same is true in the MTB model, since higher levels of CD5 were observed only on TCR-positive CD4+CD8+ thymocytes and reduction of MHC levels led to diminished CD5 expression. The MTB-transgenic mouse is clearly a unique strain in this respect as the four other TCRβ transgenic strains displayed CD5 levels comparable to WT mice. In addition, the MTB mice are different from other TCRβ- transgenic mice with respect to the transfer of original Ag specificity of their respective donor T cells. T cells from most TCRβ-transgenic mice displayed selectively enhanced responses and/or precursor frequencies specific for the original Ag (4, 33, 34, 35, 36, 37). In contrast, MTB T cells displayed increased reactivity against the original alloantigen (H-2Kd devoid of TAP-dependent peptides), as well as the irrelevant (H-2Ld) alloantigen not recognized by the original T cell line (6). Therefore, it appears that the MTB transgene from the original cell line transferred the avidity for MHC molecules rather than peptide specificity. In fact, both the original cell line (14) and the transgenic T cells (6) displayed reduced reactivity with peptides, suggesting that stronger functional impact derives from enhanced interaction with nonpolymorphic regions of MHC molecules. The compensatory increase in interactions of endogenous TCR{alpha} chains with peptides, as seen in the case of OVA257–264 recognition (6), ensures peptide specificity of MTB T cells.

The stronger reactivity of MTB T cells for both MHC class I and class II molecules may be unexpected. However, MHC class I and class II molecules are structurally very similar (38). Furthermore, relative numbers of CD4+CD8– and CD4–CD8+ thymocytes are similar in all TCRβ-transgenic mice irrespective of whether original TCR was reactive with MHC class I or MHC class II. These findings suggest that individual TCRβ chains can functionally interact with both MHC class I and class II molecules, in contrast to some TCR{alpha} chains that demonstrate preference in this respect (39). In all TCR-peptide/MHC interactions resolved to date, TCR contacts with the backbones of MHC class I and class II molecules were focused on few residues with equivalent positions in MHC class I and MHC class II molecules. These corresponding residues averaging around 10 contacts are 65 and 155 in the MHC class I {alpha}-chain and {alpha}57 and β70 of the MHC class II, respectively (38). Another interesting point is that the TCR residues forming the contacts with these two MHC class I or class II residues are diverse in individual TCRs, suggesting a high degree of plasticity in TCR-peptide/MHC interactions. Some of this plasticity is likely contributed by conformational changes of the TCR induced by its binding to the ligand (40). Taken together, stronger reactivity of MTB T cells for both MHC class I and class II molecules may not be so surprising.

It is apparent that at least some T cells with stronger autoreactivity than can be found in the WT TCR repertoire have escaped negative selection in MTB mice. This conclusion is supported by the phenotype of mature thymocytes and the stronger autoimmune responses found in MTB mice that occurred despite the compensatory decrease in the T cell activation potential. The higher avidity for self-peptide/MHC complexes may have occurred only in a fraction of mature T cells or, alternatively, the avidity of most MTB TCR repertoire may have shifted. In both of these models, limited niches for negative selection allow some T cells to survive in MTB and not in WT mice. In the former model, higher avidity T cells would randomly sift through the thymic cellular network that induces negative selection, while in the latter, the thymus would remove the highest avidity T cells while sparing only those with avidity barely higher than in the WT mice. The phenotype of mature thymocytes (higher CD5 and lower CD3 levels), displaying a modest but complete shift in expression, suggests that the reactivity for self-peptide/MHC complexes may be uniformly increased, thus favoring the latter possibility. In either case, the results of the present study support the notion of a positive correlation between TCR avidity and severity of autoimmune diseases found in most experimental models: increased avidity leads to more potent autoimmune responses and thus more severe diseases (41, 42, 43, 44).

More severe autoimmune diseases in MTB mice cannot be explained by a reduction in the numbers and/or function of CD4+CD25+ T cells. In fact, high-avidity interactions of TCRs with self-peptide/MHC complexes in the thymus were suggested to promote the development of CD4+CD25+ T cells (31, 32). However, subsequent studies suggested that differentiation of CD4+CD25+ T cells was similar in the presence or absence of high-avidity ligands for the TCR (45) and that CD4+CD25+ cells are not intrinsically specific to self-peptide/MHC complexes (46). Our findings of unaltered numbers, functional activity and FoxP3 expression of CD4+CD25+ cells in MTB mice are consistent with the latter view.


   Acknowledgments
 
We thank Alison Vollmer for technical assistance.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
Fabio R. Santori and Stanislav Vukmanovic have filed a patent application (status pending) with regard to the transgene described in this manuscript.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by the National Institutes of Health Grants AI48837 and AI41573 (to S.V.) and AI42767 (to J.T.H.). Back

2 Current address: Department of Pathology, Skirball Institute for Molecular Medicine and New York University Cancer Center, New York University School of Medicine, 550 First Avenue, New York, NY 10016. Back

3 Address correspondence and reprint requests to Dr. Stanislav Vukmanovic, Center for Cancer and Immunology Research, Children’s Research Institute, Children’s National Medical Center, 111 Michigan Avenue NW, Washington, DC 20010-2970. E-mail address: svukmano{at}cnmc.org Back

4 Abbreviations used in this paper: β2m, β2-microglobulin; EAE, experimental allergic encephalomyelitis; MOG, myelin oligodendrocyte glycoprotein; NP, nuclear protein; WT, wild type. Back

Received for publication May 27, 2008. Accepted for publication September 6, 2008.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Hogquist, K. A., T. A. Baldwin, S. C. Jameson. 2005. Central tolerance: learning self-control in the thymus. Nat. Rev. Immunol. 5: 772-778. [Medline]
  2. Anderton, S. M., D. C. Wraith. 2002. Selection and fine-tuning of the autoimmune T-cell repertoire. Nat. Rev. Immunol. 2: 487-498. [Medline]
  3. Chatenoud, L., B. Salomon, J. A. Bleustone. 2001. Suppressor T cells: they’re back and critical for regulation of autoimmunity. Immunol. Rev. 182: 149-163. [Medline]
  4. Bouneaud, C., P. Kourilsky, P. Bousso. 2000. Impact of negative selection on the T cell repertoire reactive to a self-peptide: a large fraction of T cell clones escapes clonal deletion. Immunity 13: 829-840. [Medline]
  5. Zehn, D., M. J. Bevan. 2006. T cells with low avidity for a tissue-restricted antigen routinely evade central and peripheral tolerance and cause autoimmunity. Immunity 25: 261-270. [Medline]
  6. Santori, F. R., Z. Popmihajlov, V. P. Badovinac, C. Smith, S. Radoja, J. T. Harty, S. Vukmanovic. 2007. TCRβ chain that forms peptide-independent alloreactive TCR transfers reduced reactivity with irrelevant peptide/MHC complex. J. Immunol. 178: 6109-6114. [Abstract/Free Full Text]
  7. Kisielow, P., H. Bluthmann, U. D. Stearz, M. Steimetz, H. von Boehmer. 1988. Tolerance in T-cell-receptor transgenic mice involves deletion of nonmature CD4+8+ thymocytes. Nature 333: 742-746. [Medline]
  8. Badovinac, V. P., J. T. Harty. 2000. Intracellular staining for TNF and IFN-{gamma} detects different frequencies of antigen-specific CD8+ T cells. J. Immunol. Methods 238: 107-117. [Medline]
  9. Hilliard, B., E. B. Samoilova, T. S. Liu, A. Rostami, Y. Chen. 1999. Experimental autoimmune encephalomyelitis in NF-{kappa}B-deficient mice: roles of NF-{kappa}B in the activation and differentiation of autoreactive T cells. J. Immunol. 163: 2937-2943. [Abstract/Free Full Text]
  10. Oliver, A. R., G. M. Lyon, N. H. Ruddle. 2003. Rat and human myelin oligodendrocyte glycoproteins induce experimental autoimmune encephalomyelitis by different mechanisms in C57BL/6 mice. J. Immunol. 171: 462-468. [Abstract/Free Full Text]
  11. McGeachy, M. J., L. A. Stephens, S. M. Anderton. 2005. Natural recovery and protection from autoimmune encephalomyelitis: contribution of CD4+CD25+ regulatory cells within the central nervous system. J. Immunol. 175: 3025-3032. [Abstract/Free Full Text]
  12. Khattry, R., T. Cox, S. A. Yasayko, F. Ramsdell. 2003. An essential role for Scurfin in CD4+CD25+ T regulatory cells. Nat. Immunol. 4: 337-342. [Medline]
  13. Bickerstaff, A. A., D. Xia, R. P. Pelletier, C. G. Orosz. 2000. Mechanisms of graft acceptance: evidence that plasminogen activator controls donor-reactive delayed-type hypersensitivity responses in cardiac allograft acceptor mice. J. Immunol. 164: 5132-5139. [Abstract/Free Full Text]
  14. Nesic, D., M. Maric, F. R. Santori, S. Vukmanovic. 2002. Factors influencing the patterns of T lymphocyte allorecognition. Transplant 73: 797-803. [Medline]
  15. Azzam, H. S., A. Grinberg, K. Lui, H. Shen, E. W. Shores, P. E. Love. 1998. CD5 expression is developmentally regulated by T cell receptor (TCR) signals and TCR avidity. J. Exp. Med. 188: 2301-2311. [Abstract/Free Full Text]
  16. Wong, P., G. M. Barton, K. A. Forbush, A. Y. Rudensky. 2001. Dynamic tuning of T cell reactivity by self-peptide-major histocompatibility complex ligands. J. Exp. Med. 193: 1179-1187. [Abstract/Free Full Text]
  17. Kearse, K. P., Y. Takahama, J. A. Punt, S. O. Sharrow, A. Singer. 1995. Early molecular events induced by T cell receptor (TCR) signaling in immature CD4+ CD8+ thymocytes: increased synthesis of TCR-{alpha} protein is an early response to TCR signaling that compensates for TCR-{alpha} instability, improves TCR assembly, and parallels other indicators of positive selection. J. Exp. Med. 181: 193-202. [Abstract/Free Full Text]
  18. Yamashita, I., T. Nagata, T. Tada, T. Nakayama. 1993. CD69 cell surface expression identifies developing thymocytes which audition for T cell antigen receptor-mediated positive selection. Int. Immunol. 5: 1139-1150. [Abstract/Free Full Text]
  19. Laky, K., B. J. Fowlkes. 2005. Receptor signals and nuclear events in CD4 and CD8 T cell lineage commitment. Curr. Opin. Immunol. 17: 116-121. [Medline]
  20. Van Kaer, L., P. G. Ashton-Rickardt, H. L. Ploegh, S. Tonegawa. 1992. TAP1 mutant mice are deficient in antigen presentation, surface class I molecules, and CD4–8+ T cells. Cell 71: 1205-1214. [Medline]
  21. Shepherd, J. C., T. N. M. Schumacher, P. G. Ashton-Rickardt, S. Imaeda, H. L. Ploegh, C. A. Janeway, S. Tonegawa. 1993. TAP1-dependent peptide translocation in vitro is ATP-dependent and peptide selective. Cell 74: 577-584. [Medline]
  22. Lautscham, G., A. Rickinson, N. Blake. 2003. TAP-independent antigen presentation on MHC class I molecules: lessons from Epstein-Barr virus. Microbes Infect. 5: 291-299. [Medline]
  23. Smith, K., B. Seddon, M. A. Purbhoo, R. Zamoyska, A. G. Fisher, M. Merkenschlager. 2001. Sensory adaptation in naive peripheral CD4 T cells. J. Exp. Med. 194: 1253-1261. [Abstract/Free Full Text]
  24. Kassiotis, G., R. Zamoyska, B. Stockinger. 2003. Involvement of avidity for major histocompatibility complex in homeostasis of naive and memory T cells. J. Exp. Med. 197: 1007-1016. [Abstract/Free Full Text]
  25. Perez-Villar, J. J., G. S. Whitney, M. A. Bowen, D. H. Hewgill, A. A. Aruffo, S. B. Kanner. 1999. CD5 negatively regulates the T-cell antigen receptor signal transduction pathway: involvement of SH2-containing phosphotyrosine phosphatase SHP-1. Mol. Cell. Biol. 19: 2903-2912. [Abstract/Free Full Text]
  26. Haywood, M. E., N. J. Rogers, S. J. Rose, J. Boyle, A. McDermott, J. M. Rankin, V. Thiruudaian, M. R. Lewis, L. Fossati-Jimack, S. Izui, et al 2004. Dissection of BXSB lupus phenotype using mice congenic for chromosome 1 demonstrates that separate intervals direct different aspects of disease. J. Immunol. 173: 4277-4285. [Abstract/Free Full Text]
  27. Yoh, K., K. Shibuya, N. Morito, T. Nakano, K. Ishizaki, H. Shimohata, M. Nose, S. Izui, A. Shibuya, A. Koyama, et al 2003. Transgenic overexpression of GATA-3 in T lymphocytes improves autoimmune glomerulonephritis in mice with a BXSB/MpJ-Yaa genetic background. J. Am. Soc. Nephrol. 14: 2494-2502. [Abstract/Free Full Text]
  28. Lawson, B. R., S. I. Koundouris, M. Barnhouse, W. Dummer, R. Baccala, D. H. Kono, A. N. Theofilopoulos. 2001. The role of {alpha}β+ T cells and homeostatic T cell proliferation in Y-chromosome-associated murine lupus. J. Immunol. 167: 2354-2360. [Abstract/Free Full Text]
  29. van der Most, R. G., K. Murali-Krishna, J. L. Whitton, C. Oseroff, J. Alexander, S. Southwood, J. Sidney, R. W. Chesnut, A. Sette, R. Ahmed. 1998. Identification of Db- and Kb-restricted subdominant cytotoxic T-cell responses in lymphocytic choriomeningitis virus-infected mice. J. Virol. 240: 158-167.
  30. Blattman, J. N., D. J. Sourdive, K. Murali-Krishna, R. Ahmed, J. D. Altman. 2000. Evolution of the T cell repertoire during primary, memory, and recall responses to viral infection. J. Immunol. 165: 6081-6090. [Abstract/Free Full Text]
  31. Jordan, M. S., A. Boesteanu, A. J. Reed, A. L. Petrone, A. E. Holenbeck, M. A. Lerman, A. Naji, A. J. Caton. 2001. Thymic selection of CD4+CD25+ regulatory T cells induced by an agonist self-peptide. Nat. Immunol. 2: 301-306. [Medline]
  32. Apostolou, I., A. Sarukhan, L. Klein, H. von Boehmer. 2002. Origin of regulatory T cells with known specificity for antigen. Nat. Immunol. 3: 756-763. [Medline]
  33. Dillon, S. R., S. C. Jameson, P. J. Fink. 1994. V β 5+ T cell receptors skew toward OVA+H-2Kb recognition. J. Immunol. 152: 1790-1801. [Abstract]
  34. Verdaguer, J., J. W. Yoon, B. Anderson, N. Averill, T. Utsugi, B. J. Park, P. Santamaria. 1996. Acceleration of spontaneous diabetes in TCR-β-transgenic nonobese diabetic mice by β-cell cytotoxic CD8+ T cells expressing identical endogenous TCR-{alpha} chains. J. Immunol. 157: 4726-4735. [Abstract]
  35. Gutgemann, I., A. M. Fahrer, J. D. Altman, M. M. Davis, Y. H. Chien. 1998. Induction of rapid T cell activation and tolerance by systemic presentation of an orally administered antigen. Immunity 8: 667-673. [Medline]
  36. Sant'Angelo, D. B., B. Lucas, P. G. Waterbury, B. Cohen, T. Brabb, J. Goverman, R. N. Germain, C. A. J. Janeway. 1998. A molecular map of T cell development. Immunity 9: 179-186. [Medline]
  37. Baldwin, K. K., B. P. Trenchak, J. D. Altman, M. M. Davis. 1999. Negative selection of T cells occurs throughout thymic development. J. Immunol. 163: 689-698. [Abstract/Free Full Text]
  38. Rudolph, M. G., R. L. Stanfield, I. A. Wilson. 2006. How TCRs bind MHCs, peptides, and coreceptors. Annu. Rev. Immunol. 24: 419-466. [Medline]
  39. Sim, B. C., L. Zerva, M. I. Greene, N. R. J. Gascoigne. 1996. Control of MHC restriction by TCR V{alpha} CDR1 and CDR2. Science 273: 963-966. [Abstract]
  40. Kjer-Nielsen, L., C. S. Clements, A. W. Purcell, A. G. Brooks, J. C. Whisstock, S. R. Burrows, J. McCluskey, J. Rossjohn. 2003. A structural basis for the selection of dominant ab T cell receptors in antiviral immunity. Immunity 18: 53-64. [Medline]
  41. Amrani, A., J. Verdaguer, P. Serra, S. Tafuro, R. Tan, P. Santamaria. 2000. Progression of autoimmune diabetes driven by avidity maturation of a T-cell population. Nature 406: 739-742. [Medline]
  42. Garcia, K. C., C. G. Radu, J. Ho, R. J. Ober, E. S. Ward. 2001. Kinetics and thermodynamics of T cell receptor- autoantigen interactions in murine experimental autoimmune encephalomyelitis. Proc. Nat. Acad. Sci. USA 98: 6818-6823. [Abstract/Free Full Text]
  43. Gronski, M. A., J. M. Boulter, D. Moskophidis, L. T. Nguyen, K. Holmberg, A. R. Elford, E. K. Deenick, H. O. Kim, J. M. Penninger, B. Odermatt, et al 2004. TCR affinity and negative regulation limit autoimmunity. Nat. Med. 10: 1234-1239. [Medline]
  44. Han, B., P. Serra, J. Yamanouchi, A. Amrani, J. Elliott, P. Dickie, T. Dilorenzo, P. Santamaria. 2005. Developmental control of CD8 T cell-avidity maturation in autoimmune diabetes. J. Clin. Invest. 115: 1879-1887. [Medline]
  45. van Santen, H. M., C. Benoist, D. Mathis. 2004. Number of T reg cells that differentiate does not increase upon encounter of agonist ligand on thymic epithelial cells. J. Exp. Med. 200: 1221-1230. [Abstract/Free Full Text]
  46. Pacholczyk, R., J. Kern, N. Singh, M. Iwashima, P. Kraj, L. Ignatowicz. 2007. Nonself-antigens are the cognate specificities of Foxp3+ regulatory T cells. Immunity 27: 493-504. [Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stojakovic, M.
Right arrow Articles by Vukmanovic, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stojakovic, M.
Right arrow Articles by Vukmanovic, S.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS