|
|
||||||||
th R. Turnquist*


* Thomas E. Starzl Transplantation Institute and Department of Surgery, University of Pittsburgh, Pittsburgh, PA 15213;
Department of Microbiology and Molecular Genetics, University of Pittsburgh, Pittsburgh, PA 15213;
Division of Immunology, Infection and Inflammation, Glasgow Biomedical Research Centre, University of Glasgow, Glasgow, United Kingdom; and
Department of Immunology, University of Pittsburgh, Pittsburgh, PA 15213
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The inhibitory activity of RAPA on Ag-stimulated T lymphocytes is believed to result from its capacity to permit the transmission of signals from the TCR, and to inhibit signals through receptors that characteristically activate mTOR, such as CD28, and cytokine/growth factor receptors (9, 10). Accordingly, in the presence of RAPA, Ag-stimulated T cells undergo apoptosis or become anergic, even in the presence of costimulation or proinflammatory cytokines (4, 10). However, human and mouse regulatory T cells (Treg; both naturally occurring CD4+CD25+Foxp3+ and Treg type 1 cells) are comparatively insensitive to RAPA, as there is evidence for their induction, expansion, and function in the presence of RAPA (11, 12).
Dendritic cells (DC) are critical regulators of immune reactivity (13, 14). Recently, we and others have shown, both in vitro and in vivo, that RAPA profoundly alters murine and human DC generation, maturation, and T cell stimulatory function (15, 16, 17, 18). Specifically, myeloid DC (mDC) generated in clinically relevant concentrations of RAPA (RAPA-DC) are phenotypically immature, with weak ability to produce IL-12, and markedly inhibited T cell allostimulatory capacity (17, 18). Relatedly, both in vitro-generated RAPA-DC and DC from RAPA-treated mice show impaired responses to TLR4 and CD40 ligation (15, 17, 18). Although poor stimulators of allogeneic CD4+ effector T cells, RAPA-DC enrich for potent alloantigen-specific Treg (18). This contrasts with control (CTR) mDC that favor non-Treg activation/expansion, especially when matured (18). Moreover, when pulsed with alloantigen and infused systemically, RAPA-DC, but not CTR-DC render alloantigen-specific T cells hyporesponsive to donor and promote indefinite organ allograft survival (18, 19). Thus, in part by instilling maturation resistance, RAPA enables DC to act as "negative cellular vaccines" with tolerogenic potential (20, 21). However, the mechanisms underlying the resistance of RAPA-DC to inflammatory stimuli have not been defined.
In the course of studies to elucidate the molecular basis of the resistance of RAPA-DC to maturation, we have found that RAPA promotes the de novo production of IL-1β by otherwise phenotypically immature DC. This production of IL-1β drives the expression the transmembrane form of ST2, or ST2L (also known as IL-1R-like 1), on the surface of RAPA-DC. In addition to being the recently identified T cell surface receptor for IL-33, a cytokine that stimulates CD4+ Th2 responses (22), ST2L is expressed on LPS-stimulated macrophages and is a potent negative regulator of TLR signaling, critical for endotoxin tolerance, i.e., the down-regulation of endotoxin-driven responses by APC after prior endotoxin exposure (23). Consistent with this regulatory capacity, IL-1β exposure and consequent increased ST2L expression inhibits the phenotypic and functional maturation of RAPA-DC to CpG and CD40 ligation. Thus, by inducing IL-1β production and up-regulating ST2L expression, RAPA renders DC resistant to proinflammatory, maturation-inducing conditions, allowing them to retain their tolerogenic potential.
| Materials and Methods |
|---|
|
|
|---|
Male C57BL/10 (B10; H2Kb), C3H/HeJ (C3H; H2Kk), and BALB/c (H2Kd) mice were obtained from The Jackson Laboratory and maintained in a specific pathogen-free facility at the University of Pittsburgh School of Medicine until use at 8–12 wk of age. Experiments were conducted under an institutional animal care and use committee-approved protocol in accordance with National Institutes of Health guidelines. ST2-deficient IL1rl1–/–) BALB/c mice used as a source of bone marrow cells were housed at the University of Glasgow, under conditions approved by the Home Office (London, U.K.).
DC generation and stimulation
mDC were propagated from bone marrow (BM) cells for 7 days in GM-CSF and IL-4, as described (24). RAPA (10 ng/ml; Sigma-Aldrich) was added to cultures 2 days after initial plating. Every 2 days, 80% of the culture supernatant was replaced with fresh cytokine-containing medium (with or without RAPA). On day 4, nonadherent cells were removed. Some cultures also received IL-1R antagonist (IL-1Ra) (75 ng/ml; R&D Systems) on day 6. In all experiments, nonadherent cells were harvested on day 7 and CD11c+ DC were positively selected (purity >97%) using anti-CD11c immunomagnetic beads (Miltenyi Biotec). Where indicated, DC were incubated for 18–22 h (0.5–1 x 106 cells/ml) with LPS (0.02–20 µg/ml; Salmonella enteritidis; Sigma-Aldrich), CpG-oligodeoxynucleotide (0.02–20 µg/ml; ODN 1826: TCCATGACGTTCCTGACGTT; Invivogen), or agonistic anti-murine CD40 mAb (HM40-3; 0.5–20 µg/ml; BD Pharmingen).
DC mobilization in vivo and splenic DC isolation
B10 DCs were mobilized by i.p. administration of recombinant human fms-like tyrosine kinase-3 ligand (Flt3L; Amgen; 10 µg/day) for 10 days (days 1–10) as described (15). Groups of animals also received RAPA (0.5 mg/kg/day i.p.; days 3–10) in a vehicle of 51% polyethylene glycol 300, 5% polysorbate 80, and 5% ethanol (all obtained from Sigma-Aldrich) (15). On day 11, DC were isolated from collagenase-treated spleen preparations by density gradient centrifugation (16% w/v Histodenz; Sigma-Aldrich), then positively selected as described above.
Flow cytometry
Cell surface and intracellular Ag expression by DC was analyzed as described (24). Fluorophore-conjugated mAbs (clone designation) were used to detect expression of CD11c (N418), CD40 (3/23), CD86 (GL1), TLR2 (6C2; eBioscience), TLR4 (MTS510), TLR9 (M9.D6; eBioscience), I-Ak (11-5.2), I-Ab (AF6-120.1), I-E (14-4-4S; eBioscience), or T1/ST2 (DJ8; MD Biosciences). Appropriately conjugated, isotype-matched IgGs served as controls. All reagents were obtained from BD Pharmingen, unless specified. Data were acquired with a LSR II flow cytometer (BD Immunocytometry Systems) and analyzed using FlowJo 8.1.1 (Tree Star).
Microarrays
The University of Pittsburgh Genomics and Proteomics Core Laboratories conducted sample preparation and array hybridization. Total RNA, isolated using a total RNA isolation kit (BD Biosciences) from highly purified, CD11c+ RAPA- and CTR-DC was processed to generate duplicates of biotinylated cRNA. Following cRNA hybridization to Affymetrix Mouse Genome 430A 2.0 GeneChips (Affymetrix), the microarrays were scanned using a GeneArray 3000 scanner and signal intensities were extracted with Microarray Analysis Suite (MAS) 5.0 (Affymetrix). Differentially expressed genes were identified via the web-based gene expression analysis software, caGEDA, implementing J5 analysis of data (data log2 and median normalization; threshold of 4; http://bioinformatics.upmc.edu/GE2/GEDA.html (25)).
RNase protection assay (RPA)
RPA with [32P]UTP-labeled antisense RNA probes to IL-1β, IL-1Ra, and GAPDH was performed as described in detail (26). Briefly, RNA was isolated from snap-frozen, purified DCs using a total RNA Isolation kit (BD Pharmingen). RPA was performed using the RiboQuant MultiProbe RPA System (BD Pharmingen) and cDNAs encoding mouse IL-1β, IL-1Ra, and the housekeeping gene GAPDH were used as templates. Quantification of bands was performed by densitometric assessment of scanned autoradiographs using Scion Image version 1.63 software (National Institutes of Health, Bethesda, MD). The signals from specific mRNA were normalized to the signals from housekeeping genes run on each lane to adjust for loading differences.
Quantitative RT-PCR (qRT-PCR)
DC RNA was extracted using TriReagent (Molecular Resource Center, Cincinnati, OH). and reversed transcribed using the iScript cDNA Synthesis kit (Bio-Rad). Replicate PCR were performed using SYBR Green PCR Master Mix (Applied Biosystems), primers for ST2L—the membrane-bound form of ST2 (SuperArray) and IL-1β, IL-12p40, TLR9, and β-actin (designed by Primer Express Software; Applied Biosystems), then amplified on an ABI PRISM 7000 Sequence Detection System. Data were plotted using the manufacturers software as the
Rn fluorescence signal vs cycle number. The cycle threshold number was determined as the cycle number at which the
Rn crosses this threshold. Relative gene expression was determined by comparing to control, then normalized to β-actin mRNA using the comparative cycle threshold method (27).
ELISA
IL-1β concentrations in DC culture supernatants were quantified using the ELISA Ready-SET-Go! kit (eBioscience).
Immunoblots
DC were lysed in 10 mM Tris-HCl (pH 7.6), 158 mM NaCl, 5 mM EDTA (pH 8.0), 1% sodium deoxycholate, 0.1% SDS, 1% Triton X-100, and the protease inhibitors PMSF (1 mM), leupeptin (5 µg/ml), aprotinin (5 µg/ml), and sodium orthovanadate (1 mM). All reagents were obtained from Sigma-Aldrich. Debris was removed by centrifugation at 13,100 x g, and 10–20 µg of protein was separated on 10% SDS-PAGE gels and transferred to polyvinylidene fluoride membranes (Millipore). Immunoblotting was done by incubation with primary Abs, including rabbit polyclonal anti-ST2 (1:1500; Abcam), polyclonal anti-phosphorylated ERK, p38, and JNK (1:1000; Cell Signaling Technology), polyclonal anti-total ERK, p38, and JNK (1:1000; Santa Cruz Biotechnology), and mAb anti-GAPDH (Novus Biologicals), followed by appropriate HRP-conjugated secondary Abs (Jackson ImmunoResearch Laboratories). Visualization was conducted with Western Lighting (PerkinElmer), or in the case of the MAPK Abs, Super Signal West Pico (Pierce) chemiluminescent kits, and exposure to film. Densitometric assessment of bands was completed with Scion Image 1.63 (National Institutes of Health).
EMSA
NF-
B and AP-1 DNA-binding activity was measured as described (28), with [
-32P]-labeled probes (NF-
B consensus; Promega; AP-1 consensus and NF-
B and AP-1 mutants; Santa Cruz Biotechnology) and nuclear extracts from purified DC, following their stimulation with LPS, CpG, or anti-CD40 for 20 min. Supershifts were completed with Abs to JunB and p50 (Santa Cruz Biotechnology).
Mixed leukocyte reaction
Splenic T cells were purified by negative selection of non-T cells using anti-CD11b, -TER-119, -Gr-1, -I-A/I-E, -B220, and -Gr-1 mAbs (BD Pharmingen) and removal via Mouse Depletion Dynabeads (Dynal Biotech). MLR were performed as described (15) using graded numbers of gamma-irradiated (20 Gy) DC as stimulators. For the final 16–18 h, individual wells were pulse-labeled with 1 µCi [3H]thymidine. Radioisotope incorporation was determined using a β scintillation counter. Results are expressed as mean cpm ± 1 SEM calculated from triplicate wells.
Statistical analysis
Results are expressed as means ± 1 SEM or ± 1 SD, as indicated. The significance of differences between means was determined using the JMP IN 4.04 Statistical Package (SAS Institute) performing the Student "t" or two-way ANOVA test. A value of p < 0.05 was considered significant.
| Results |
|---|
|
|
|---|
As reported previously (18), RAPA-DC propagated in vitro are a homogenous population of reduced size compared with CTR-DC (Fig. 1A), consistent with the importance of mTOR in regulating cell size (7). When compared with CTR-DC, RAPA-DC also displayed lower levels of surface MHC class II and CD86, but did not differ significantly from controls in surface expression of TLR2, TLR4, and CD40 (Fig. 1B). RAPA-DC also expressed TLR9 (by flow cytometry (intracellular; Fig. 1B) and qRT-PCR; data not shown), although at slightly reduced levels compared with CTR-DC.
|
|
To compare gene expression between CTR- and RAPA-DC, and to identify negative regulators of DC maturation, total mRNA was isolated from purified DC and used to label Mouse Genome 430A 2.0 GeneChips (Affymetrix). Following extraction of signal intensities with Microarray Analysis Suite 5.0 (Affymetrix), 586 genes were determined to be differentially expressed between RAPA- and CTR-DC (data not shown), based on J5 analysis completed by the gene expression analysis software, caGEDA (25). Among the differentially regulated genes overexpressed in RAPA-DC was ST2L (J5 score = 4.17), an IL-1R family member (il1rl; Entrez Gene ID: 17082; also know as T1/ST2, Fit-1, St2). In both rodents and humans, the ST2 gene encodes two isoforms of the ST2 protein, a soluble secreted form, soluble ST2 (sST2), and ST2L, a longer, transmembrane form (29, 30, 31). In addition to acting as the receptor for IL-33 (22), ST2L is a negative regulator of TLR4 signaling in macrophages (23). Relatedly, sST2 has also been shown to temper inflammatory responses (32).
qRT-PCR (Fig. 3A), Western blotting (Fig. 3B), and flow cytometry (Fig. 3C) confirmed modified expression of ST2 by RAPA-DC. The transmembrane form of ST2 (ST2L) was up-regulated significantly in BM-derived RAPA-DC from several mouse strains (B10, C3H, and BALB/c; Fig. 3 and data not shown). The alternative isoform, sST2, was not expressed differently from CTR-DC in Western blots (Fig. 3B).
|
Previously, we showed that splenic DC from RAPA-treated mice displayed impaired phenotypic maturation, proinflammatory cytokine production, T cell stimulatory capacity, and resistance to maturation after exposure to LPS (15). In the present studies, increased mRNA, protein, and surface expression of ST2 (ST2L) were observed for splenic DC isolated from RAPA-treated animals (Fig. 4). Specifically, when RAPA administration (1 mg/kg/day; days 3–10) was combined with DC expansion/mobilization using Flt3L (10 µg/day; days 0–10), ST2L was overexpressed significantly (Fig. 4, A and B) and up-regulated on the surface of purified splenic DC (Fig. 4C), compared with DC isolated from vehicle-treated animals. Thus, both in vitro and in vivo, DC exposure/generation in the presence of RAPA leads to increased expression of the transmembrane form of ST2 (ST2L).
|
Early work showed that Fos/AP-1 activity regulates the expression of the ST2 gene in mouse NIH/3T3 fibroblasts (29). It has also been observed that exposure of the human lung fibroblast cell line WI-26 to RAPA results in rapid activation of JNK and activation of AP-1 (33). Relatedly, it is recognized that the ligation of DC receptors, including CD40, TLRs, or IL-1R, culminates in nuclear translocation of the transcription factor, NF-
B, or activation of MAPK pathways that can activate AP-1 (34, 35). Activation of MAPKs, including JNK, ERK, and p38, as well as NF-
B and AP-1 are inhibited by RAPA in coronary artery smooth muscle cells (36). Furthermore, Brint et al. (23) established that ST2 overexpression negatively regulates NF-
B DNA-binding activity downstream of IL-1R and TLR4. Thus, to determine the status of MAPK, AP-1, and NF-
B activation in RAPA-DC, we assessed the level of MAPK phosphorylation in DC lysates and performed EMSA to assess AP-1 and NF-
B DNA-binding activity by isolated nuclear proteins.
Similar to observations on RAPA-treated human lung fibroblasts (33), Western blot analysis of MAPK activation revealed that RAPA-DC, either unstimulated or following 20 min exposure to LPS, CpG, or CD40 ligation had reduced phosphorylation of ERK and p38 (Fig. 5A). Unstimulated RAPA-DC had similar levels to CTR-DC of JNK phosphorylation, but exhibited slightly inhibited JNK phosphorylation following exposure to inflammatory stimuli (Fig. 5A). Consistent with our finding of reduced phenotypic and functional responses of RAPA-DC to danger signals/proinflammatory agents (Fig. 2) and the central role of NF-
B as a regulator of DC maturation and cellular inflammatory responses (37), little NF-
B DNA-binding activity was detected in unstimulated RAPA-DC or after their exposure to LPS, CpG, or CD40 ligation (Fig. 5B). Conversely, when compared with CTR-DC, RAPA-DC showed increased activation of AP-1, both before and after their stimulation with LPS, CpG, or anti-CD40 (Fig. 5C). These observations are in accordance with an ability of RAPA to promote AP-1 activation in other cells (33). As such, activation of AP-1 would be expected to facilitate ST2 expression (29). Likewise, our observation of suppressed NF-
B activation in RAPA-DC following their exposure to inflammatory stimuli is consistent with their maturation resistance, and correlates with the previously demonstrated ability of ST2 to negatively impact NF-
B activity downstream of TLR signaling (23).
|
Inflammatory stimuli have been implicated in the induction of ST2 expression by various cell types. Leishmania major infection causes an increase in ST2L+ CD4+ T lymphocytes (Th2) at the site of infection (38). Likewise, LPS induces rapid surface expression of ST2L on peritoneal macrophages (23). Another proinflammatory stimulus known to both activate AP-1 (39) and to induce expression of ST2 in fibroblasts and macrophages is IL-1β (40, 41). Thus, we examined the possibility that RAPA increases the expression/production of IL-1β by DC. RAPA has not been reported previously to induce IL-1β, and is typically associated with reduced systemic or local inflammatory cytokines in transplant recipients or in autoimmune disease (42, 43). Surprisingly, based on these reports, and given the low CD86 expression and poor allostimulatory capacity of RAPA-DC (Figs. 1 and 2), we found that RAPA-DC expressed increased IL-1β message (Fig. 6, A and B) and secreted significantly higher levels of IL-1β than CTR-DC, regardless of exposure to inflammatory stimuli (Fig. 6D). Likewise, splenic DC from RAPA-treated animals also had significantly increased expression of IL-1β by qRT-PCR (Fig. 6C).
|
and IL-1β by competitive high-avidity binding to the IL-1R. As shown in Fig. 7, inhibiting the activity of secreted IL-1β reduced the overall expression of ST2L (Fig. 7A) and the level displayed on the surface of RAPA-DC compared with CTR-DC (Fig. 7B). In addition, IL-1Ra treatment also reduced IL-1β mRNA in RAPA-DC, while increasing that for IL-12p40 (Fig. 7, C and D), consistent with IL-12 reduction in IL-1β-exposed DC (44). In total, these data suggest that RAPA-induced IL-1β drives autocrine/paracrine IL-1β production by RAPA-DC, and enhanced expression of ST2L on the cell surface.
|
Comparison of RAPA-DC propagated from ST2-deficient BM compared with those propagated from wild-type mice revealed higher levels of expression of CD86 on the former cells (Fig. 8). This was evident for unstimulated ST2–/– RAPA-DC and for LPS, CpG, or anti-CD40-stimulated ST2–/– RAPA-DC. These data provide a causal link between up-regulated ST2L expression on RAPA-DC and inhibition of CD86 expression.
|
Given the observed marked resistance of RAPA-DC to TLR and CD40 ligation, and the demonstrated role of ST2L as a negative regulator of TLR signaling (23), we assessed the influence of decreased ST2L by IL-1Ra treatment on RAPA-DC function. Following overnight exposure to LPS, CpG, or anti-CD40, IL-1Ra-treated RAPA-DC showed increased maturity, both phenotypically and functionally. Specifically, we found that inhibition of IL-1β activity resulted in increased CD86 expression following TLR9 or CD40 ligation (Fig. 9A), and significantly increased T cell stimulatory ability (Fig. 9B). IL-1Ra-treated RAPA-DC exposed to LPS also displayed increased CD86 expression and allostimulatory capacity (data not shown), although the increase in alloreactivity did not reach statistical significance. Also, none of the inflammatory stimuli induced equivalent maturation of IL-1Ra-treated RAPA-DC compared with that of CTR-DC, suggesting that additional, negative regulators of DC function or deficiencies in inflammatory signaling exist in RAPA-DC. Nevertheless, these findings support the ability of IL-1β-induced ST2 to impede inflammatory signaling in RAPA-DC.
|
| Discussion |
|---|
|
|
|---|
B activation (45, 46, 47), few reports have addressed the molecular basis of maturation resistance in pharmacologically modified DC. In this study, we have extended previous observations on the maturation resistance and tolerogenic properties of RAPA-conditioned DC (15, 16, 18, 48). Our findings reveal that, both in vitro and in vivo, exposure of murine myeloid DC to RAPA increases their expression of the transmembrane form of Toll/IL-1R superfamily member ST2, a recognized negative regulator of TLR signaling in endotoxin-stimulated macrophages (23, 49). The observation that up-regulation of transmembrane ST2 (ST2L) is associated with an enhanced production of IL-1β by RAPA-DC, and that inhibition of IL-1β activity reduces ST2L expression, implicates IL-1β as a negative regulator of the maturation of these cells. This role of IL-1β is consistent with a recent report of the ability of IL-1β to markedly impair DC maturation by an unknown mechanism (44).
To our knowledge, there have been no previous investigations of ST2 expression by freshly isolated or cultured DC. ST2 is highly homologous to the IL-1R. As discussed, it exists in both soluble and membrane-bound forms, with ST2L expressed primarily by hematopoietic cells and sST2 predominantly by fibroblasts (50). In addition to macrophages, ST2L mRNA expression has been demonstrated in T and B lymphocytes, mast cells, and erythroid and BM stem cells (29). ST2L is expressed preferentially on Th2 cells (51, 52) and plays a functional role in the generation of important Th2 effector functions (53, 54). Recently, a ligand for ST2 has been described. The IL-1 family member IL-33 has been shown to drive production of Th2 cytokines by in vitro-polarized Th2 cells following ligation of the ST2 receptor (22). Preliminary experiments that we have conducted with IL-33 show that, in response to this ST2 ligand, RAPA-DC signal through NF-
B and MAPKs, and up-regulate the message for IL-1β (data not shown).
Our attention was drawn to the potential role of ST2 as a negative regulator of RAPA-DC maturation following gene expression (microarray) profiling of highly purified cells in which ST2L was consistently and significantly up-regulated. Most members of the Toll/IL-1R superfamily initiate immunity via activation of NF-
B, leading in turn to production of proinflammatory cytokines. By contrast, ST2 inhibits NF-
B activation through IL-1R and TLR2, 4, and 9. The present findings are consistent with those of Brint et al. (23) who defined the ability of overexpressed ST2 in murine macrophages to sequester the critical TLR signaling adapters MyD88 and MyD88-like (Mal) and, consequently, to negatively regulate TLR4 and TLR9 signaling. The physiological relevance of this negative regulation was emphasized by the findings that ST2-deficient macrophages produced increased IL-12 in response to CpG stimulation, and that ST2 was necessary for endotoxin tolerance.
An ability of ST2 to modulate CD40 signaling, suggested by our findings, has not been described previously, and leads us to speculate that TNFR-associated factor-6, an important common signaling adapter between TLR and CD40 signaling (55), may also be sequestrated in RAPA-DC. Based on the present observations, it may also be suggested that the inhibitory effect of IL-1β on DC maturation and function described by Makino et al. (44) may be the result of IL-1β-induced up-regulation of ST2L. An inhibitory effect of IL-1β on IL-12 production, as observed in the present studies, and its ability to induce ST2, would be consistent with the importance of ST2 in favoring Th2 responses (23, 54).
The RAPA-induced increase in IL-1β, overexpression of ST2L, and IL-1β-dependent resistance to TLR- and CD40 ligation-induced maturation that we observed was confirmed using LPS-resistant C3H/HeJ RAPA-DC, ruling out any possibility that LPS contamination of administered RAPA or rIL-1Ra facilitated the observed ST2L up-regulation or altered DC responses.
Inflammatory activation of cells of the innate immune system, including DC, is often described as a double-edged sword (56), with the potential to facilitate effective removal of pathogens, or, if not tempered, to promote chronic inflammatory states. These risks are offset by mechanisms that tightly regulate TLR and other inflammatory signals (49). Proinflammatory stimuli, such as LPS, act in a regulatory loop, in which initial activation of the TLR also causes the induction of negative regulators. Thus, in addition to up-regulation of ST2L, LPS stimulation of TLR4 drives the expression/production of MyD88s, suppressors of cytokine signaling and other regulators (49). A novel aspect of the current findings is that although RAPA-DC produce IL-1β, inducing ST2L, they never mature into CD86high, potent allostimulatory cells. Thus, DC conditioning with RAPA and the consequent induction of ST2L, establishes a barrier to functional maturation of the cells, preserving their tolerogenic phenotype (20). This might be expected to decrease/minimize any potential risk of host sensitization using RAPA-DC as negative cellular vaccines. The findings support continued evaluation of RAPA as a tolerance spring/promoting immunosuppressant and the further assessment of maturation-resistant DCs as tolerogenic vectors (18, 57, 58, 59) in immune-mediated inflammatory conditions.
In total, evidence has accumulated that the immunosuppressant RAPA can modify the properties of DC and T cells toward conditions that may favor tolerance induction. This is typically accounted for by its ability to impede directly Ag-stimulated T cells and to facilitate the induction of anergy or apoptosis of effector T cells, while apparently preserving the expansion/induction/function of Treg. Nonetheless, we have demonstrated in previous (15) and the present studies that, both in vitro and in vivo, RAPA reduces the T cell stimulatory function of DC and confers marked resistance to DC maturation following their exposure to inflammatory conditions. We now identify a novel mechanism through which RAPA inhibits DC stimulatory capacity and provide insight into the previously reported intriguing capability of IL-1β to reduce DC maturation and their T cell stimulatory function.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by National Institutes of Health (NIH) Grants R01AI41011 and R01AI60994 (to A.W.T.). H.R.T. was supported by nonconcurrent fellowships from the American Society of Transplantation and the NIH (T32CA082084 and F32AI072940). T.L.S. was supported by an NIH Research Training Fellowship (T32CA082084). ![]()
2 Address correspondence and reprint requests to Dr. Angus W. Thomson, Thomas E. Starzl Transplantation Institute, Department of Surgery, School of Medicine, University of Pittsburgh, 200 Lothrop Street, Biomedical Science Tower, W1540, Pittsburgh, PA 15213. E-mail address: thomsonaw{at}upmc.edu ![]()
3 Abbreviations used in this paper: RAPA, rapamycin; mTOR, mammalian target of rapamycin; Treg, regulatory T cell; DC, dendritic cell; mDC, myeloid DC; CTR, control; BM, bone marrow; IL-1Ra, IL-1 receptor antagonist; RPA, RNase protection assay; qRT-PCR, quantitative RT-PCR; sST2, soluble ST2; MFI, mean fluorescence intensity. ![]()
Received for publication December 19, 2007. Accepted for publication April 17, 2008.
| References |
|---|
|
|
|---|
B
which can be prevented by the immunosuppressant rapamycin. J. Biol. Chem. 269: 30077-30080.
B-dependent pathway. J. Virol. 74: 9617-9628.
B regulation in the immune system. Nat. Rev. Immunol. 2: 725-734. [Medline]
. Oncogene 16: 575-586. [Medline]
B. Transplantation 68: 1255-1263. [Medline]This article has been cited by other articles:
![]() |
M. Noris, P. Cassis, N. Azzollini, R. Cavinato, D. Cugini, F. Casiraghi, S. Aiello, S. Solini, L. Cassis, M. Mister, et al. The Toll-IL-1R Member Tir8/SIGIRR Negatively Regulates Adaptive Immunity against Kidney Grafts J. Immunol., October 1, 2009; 183(7): 4249 - 4260. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. B. Ganesh, D. M. Cheatem, J. R. Sheng, C. Vasu, and B. S. Prabhakar GM-CSF-induced CD11c+CD8a--dendritic cells facilitate Foxp3+ and IL-10+ regulatory T cell expansion resulting in suppression of autoimmune thyroiditis Int. Immunol., March 1, 2009; 21(3): 269 - 282. [Abstract] [Full Text] [PDF] |
||||
![]() |
A W Thomson and P D Robbins Tolerogenic dendritic cells for autoimmune disease and transplantation Ann Rheum Dis, December 1, 2008; 67(Suppl_3): iii90 - iii96. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |