The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


The Journal of Immunology, 2008, 181, 485-493
Copyright © 2008 by The American Association of Immunologists, Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thomas, L. R.
Right arrow Articles by Oltz, E. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thomas, L. R.
Right arrow Articles by Oltz, E. M.

Functional Analysis of Histone Methyltransferase G9a in B and T Lymphocytes1

Lance R. Thomas*, Hiroki Miyashita{dagger}, Robin Milley Cobb*, Steven Pierce*, Makoto Tachibana{dagger}, Elias Hobeika{ddagger}, Michael Reth{ddagger}, Yoichi Shinkai{dagger} and Eugene M. Oltz2,*

* Department of Microbiology and Immunology, Vanderbilt University, Nashville, TN 37232; {dagger} Experimental Research Center for Infectious Diseases, Institute for Virus Research, Department of Molecular and Cellular Biology, Graduate School of Biostudies, Kyoto University, Kyoto, Japan; and {ddagger} Faculty of Biology, University of Freiburg and Max-Planck Institute of Immunobiology, Freiburg, Germany


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Lymphocyte development is controlled by dynamic repression and activation of gene expression. These developmental programs include the ordered, tissue-specific assembly of Ag receptor genes by V(D)J recombination. Changes in gene expression and the targeting of V(D)J recombination are largely controlled by patterns of epigenetic modifications imprinted on histones and DNA, which alter chromatin accessibility to nuclear factors. An important component of this epigenetic code is methylation of histone H3 at lysine 9 (H3K9me), which is catalyzed by histone methyltransferases and generally leads to gene repression. However, the function and genetic targets of H3K9 methyltransferases during lymphocyte development remain unknown. To elucidate the in vivo function of H3K9me, we generated mice lacking G9a, a major H3K9 histone methyltransferase, in lymphocytes. Surprisingly, lymphocyte development is unperturbed in G9a-deficient mice despite a significant loss of H3K9me2 in precursor B cells. G9a deficiency is manifest as modest defects in the proliferative capacity of mature B cells and their differentiation into plasma cells following stimulation with LPS and IL-4. Precursor lymphocytes from the mutant mice retain tissue- and stage-specific control over V(D)J recombination. However, G9a deficiency results in reduced usage of Ig{lambda} L chains and a corresponding inhibition of Ig{lambda} gene assembly in bone marrow precursors. These findings indicate that the H3K9me2 epigenetic mark affects a highly restricted set of processes during lymphocyte development and activation.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Adaptive immunity relies on a temporal reprogramming of gene expression to guide the development of lymphocytes, their activation by Ags, and clonal expansion of effector cells. During lymphocyte development, large cohorts of genes are either activated or repressed to ensure proper transition between two cell types. These genetic programs include the process of V(D)J recombination, which is responsible for the tissue- and stage-specific assembly of Ag receptor genes (1). Coordination of the lymphocyte transcriptional program and V(D)J recombination is regulated by cis-acting elements that, in turn, alter the accessibility of chromatin to nuclear factors. A primary mechanism by which cis-elements modulate chromatin accessibility is the covalent modification of its components, histones and DNA. The specific pattern of epigenetic modifications serves as a code to recruit proteins that alter chromatin accessibility to DNA-binding factors, including V(D)J recombinase and the transcription machinery (1, 2, 3).

An important component of the mammalian epigenome is modification of histone H3 lysine 9 (H3K9),3 which is targeted by histone acetyltransferases and histone deacetylases. In general, acetylation of H3K9 leads to high-affinity interactions with bromodomains in other histone acetyltransferases or nucleosome-remodeling complexes, which further augment chromatin accessibility and induce transcription (3, 4, 5). In contrast, H3K9 methylation at promoters inhibits gene expression via recruitment of proteins that impair chromatin accessibility (6). The extent of methylation at H3K9 varies between types of repressive chromatin. Mono- and dimethylated forms of H3K9 (H3K9me1 and -me2) generally are found in euchromatin, suggesting a role for these modifications in dynamic mechanisms of repression (7). In contrast, trimethylated H3K9 (H3K9me3) is found predominantly at pericentric heterochromatin (8).

H3K9 methylation is catalyzed by one of six known histone methyltransferases (HMT) in mammals, which all contain an enzymatic SET domain. These H3K9 HMTs are expressed ubiquitously but display distinct enzymatic activities and patterns of chromosomal localization. The G9a/GLP proteins form heteromeric complexes and catalyze H3K9me1 and H3K9me2 at euchromatin (9). Similarly, ESET is found in euchromatic regions and is proposed to catalyze the conversion of H3K9me2 to H3K9me3 (10, 11, 12). The H3K9 HMT called RIZ1 is inactivated in a variety of human tumors, but its function in the modification of endogenous chromatin remains unknown (13). The redundant enzymes Suv39h1 and -h2 catalyze H3K9me3 and associate with pericentric heterochromatin. The functional significance of each H3K9 HMT has been confirmed by mouse knockout studies. Dual deletion of Suv39h1/2 results in reduced viability, genomic instability, and the lack of H3K9me3 at pericentric heterochromatin (8). Knockouts of G9a or GLP result in early embryonic lethality and substantially reduced levels of H3K9me1 and -me2 at euchromatin (7, 9).

In addition to changes in lymphocyte gene expression, the crosstalk between cis-acting elements and epigenetic modifications plays a key role in tissue- and stage-specific control of V(D)J recombination. This gene assembly process creates critical checkpoints that guide lymphocyte development and generates a diverse repertoire of Ig and TCR genes (1, 14, 15). In brief, a pro-B cell initially targets the RAG-1/2 components of V(D)J recombinase to assemble variable (V), diversity (D), and joining (J) gene segments that are selected randomly from large arrays within the Ig heavy (IgH) chain locus (16). Formation of a productive IgH gene stimulates developmental progression to the pre-B cell stage and V->J recombination at IgL chain loci, which also proceeds in a stepwise manner (Ig{kappa} precedes Ig{lambda}). A similar genetic program is used during thymocyte development, in which pro-T cells initiate Dβ->Jβ rearrangement followed by Vβ->DβJβ assembly. On incorporation into a pre-TCR, TCRβ signals for differentiation into pre-T cells and activation of V{alpha}->J{alpha} rearrangement. The control mechanisms that direct V(D)J recombinase to specific clusters of gene segments rely on changes in chromatin accessibility (17). Indeed, the accessibility status of specific Ig and TCR gene segments correlates with their epigenetic modification. Similar to expressed genes, recombinationally active segments are hyperacetylated but hypomethylated at H3K9 (18, 19). Using model substrates, we recently established a cause-effect relationship between H3K9 methylation by G9a and repression of recombinase accessibility (20).

Despite these advances, little is known about the in vivo role of any H3K9 HMT in either V(D)J recombination or the gene expression programs that guide lymphocyte development. To address this issue, we generated mice that are devoid of G9a specifically in B or T cells. Mutant lymphocytes exhibit significantly reduced levels of H3K9me2 but not H3K9me3. Surprisingly, lymphocyte development is unperturbed by this whole-scale reduction of H3K9me2. B cell proliferation is modestly affected by G9a deficiency, but the humoral immune response to a T-dependent Ag is largely normal. Although tissue-specific control of V(D)J recombination remains intact, Ig{lambda} gene rearrangement is reduced in G9a-deficient pre-B cells. Together, these findings indicate that G9a is the major H3K9 dimethyltransferase in B cells; however, global defects in H3K9me2 affect a highly restricted set of processes in lymphocyte development and function.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
G9a conditional knockout mice

Preparation of the G9acnd allele as well as mb1-Cre and Lck-Cre mice are published elsewhere (21, 22, 23). To generate mice with G9a-deficient B cells, we bred the G9acnd allele into the mb1-Cre background, which already had a G9a{Delta} allele, to produce mb1-Cre/G9acnd/{Delta} mice. The G9a{Delta} allele arose from spurious Cre-mediated deletion of G9acnd in the germ cells of an mb1-Cre/G9awt/cnd mouse. All animal studies have been reviewed and approved by the Vanderbilt Institutional Review Board.

Immunoblotting

Immunoblotting analyses of global histone modifications and G9a were performed as described (7).

PCR and chromatin immunoprecipitation (ChIP) assays

For recombination, DNA extracts were prepared from primary lymphocytes (1000 cells/µl) as outlined (24). Primers and probes to detect rearrangements have been described for V{alpha}J{alpha} (25), V{gamma}J{gamma} (26), V{delta}J{delta} (27), VHDHJH (24), V{kappa}J{kappa} (28), Dβ1Jβ1 (20), and Vβ12 and Vβ14 (29). Vβ16: primer, GGACCCAAAGTCTTACAGATCCC; Dβ2Jβ2, CACGATGTAACATTGTGGGGACTG and TCAGATCCCCACCAACCATGAGTG; probe, CCTTCACCAAAGTAGAGCTGC. V{lambda}J{lambda}: primer, ATGAATTCACTGGTCTAATAGGTGGTACCA, CTAGGACAGTCAGTTTGGTTCC, and CTAGGACAGTGACCTTGGTTCC; probes, TGCTGTACCATAGAGCACAGAAAT (all V{lambda}J{lambda}), GGTGTTCGGTGGAGG (V{lambda}1J{lambda}1), and TATGTTTTCGGCGGT (V{lambda}2J{lambda}2). For transcription assays, total RNA was extracted from lymphocytes using Trizol (Invitrogen) and converted to cDNA as described (20). Assays for RT-PCR have been reported for JH (30); J{kappa} (31); Blimp-1 (32); IgG1 germline transcripts (33); V{lambda}1, V{lambda}2, J{lambda}1, J{lambda}2, and β-actin (28). Activation-induced deaminase (AID): primer, GTGCCACCTCCTGCTCACTGG and TTCATGTAGCCCTTCCCAGGC; probe, GTGGCTGAGTTTCTGAGATGG. IgJ, primers, ATGAAGACCCACCTGCTTCTCTGG and TTGCTCTGGGTGGCAGTAACAACC; probe, ATGTGTACCCGAGTTACC. ChIP assays on B cell precursors were performed as described previously (34). Primers for Dβ ChIPs have been reported (20). JH4 ChIP: primer, GCTCAGTCACCGTCTCCTCAGG and GCCTCCAAAGTCCCTATCCCATC; probe, GGCTGAGAGAAGTTGGG. J{kappa} ChIP, primers, CGTTCGGTGCTGGGACCAAGC and GCCACGTCAACTGATAATGAGCCCTCTCC; probe, GACCAAGCTGGAGCTGAAACG. V{lambda}1 ChIP: primers, CCCCTGCAAACAGATGAGAAATCC and GCCTGCTGCTGACCAATATTG; probe, GAAAAGAATAGACCTGGTT. V{lambda}2 ChIP: CTGGCTCCTGCAAACAGGTA and GCCTGCTGCTGACCAATATTG; probe, GAAAATAATAGACTTGGTT. J{lambda}1 ChIP: primers, GATCTTTCAGTGATGTCACCACC and GCACCTCAAGTCTTGGAGAGAAC; probe, GGTGTTCGGTGGAGG. All amplification products were analyzed by Southern blotting.

Flow cytometry

Abs for cell surface markers were purchased from BD Biosciences except anti-Ig{lambda}-PE (Upstate Biotechnologies). Flow cytometry was performed on a FACSCalibur (BD Biosciences) and analyzed using CellQuest software.

Cell purification

MACS was used to purify splenic (CD43) or bone marrow (B220+) B cells following the manufacturer’s protocol (Miltenyi Biotec). Splenic T cells were isolated using a mouse T cell Negative Isolation Kit (Dynal Biotech). Isolation of pro- and pre-B cell populations was performed as described (30).

Cell proliferation assays

Purified lymphocytes were seeded in 96-well plates (106/ml) and cultured in RPMI supplemented with 10% FCS. Proliferation was induced in B cell cultures with anti-IgM (Jackson Immunoresearch Laboratories), LPS (Sigma), or anti-CD40 (BD Biosciences) and in T cells by precoating wells with anti-CD3 (2C11, 1 µg/ml). After 48 h (B cells) or 60 h (T cells), [3H]TdR was added to each well, cells were incubated for 12–18 h, and TdR incorporation was quantified using liquid scintillation counting.

Immunization

Eight-week-old mice were immunized by i.p. injection of keyhole limpet hemocyanin (KLH; Sigma-Aldrich) at a concentration of 100 µg/50 µl/mouse mixed 1:1 with CFA (Difco). Serum was collected preimmunization or 3 wk postinjection. Total or KLH-specific Ig levels were measured by ELISA (Southern Biotech) as described (35).

Ig class switching

CD43 spleen cells (5 x 105) were cultured for 6 days with 5 µg/ml LPS ± 5 ng/ml mouse IL-4 (Peprotech). IgG1 and IgE were detected by ELISA (Southern Biotech).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Lymphocyte-specific inactivation of G9a

Germline inactivation of the gene encoding G9a leads to early embryonic lethality in mice, precluding studies of lymphocyte development (7). To circumvent this obstacle, we generated embryonic stem (ES) cells with a G9a allele containing loxP sites that flank exons 26 and 27 (G9acnd), which encode for its enzymatic SET domain (23). Expression of Cre recombinase in cells containing the G9acnd mutation deletes floxed exons and produces a functionally null G9a allele (G9a{Delta}; Ref. 23). The G9acnd allele was passed into the mouse germline as described (23).

To generate mice with G9a-deficient B cells, we bred G9acnd and mb1-Cre mice. The latter strain harbors a Cre expression cassette driven by the endogenous mb1 (Ig{alpha}) promoter, which is expressed in early progenitor B cells (21). Southern blotting confirmed that G9acnd was efficiently converted to G9a{Delta} (>90%) in bone marrow and splenic B cells (B220+) from the mb1-Cre genetic background (Fig. 1A). In contrast, non-B cells (B220) retained the G9acnd configuration, confirming cell type-specific deletion by mb1-Cre. To generate T cell-specific G9a knockouts, we crossed G9acnd mice with lck-Cre-transgenic animals (22). Southern blot analysis of G9acnd/lck-Cre offspring confirmed T lineage-specific conversion to G9a{Delta} alleles (~90%) in both thymus and peripheral lymphoid organs (data not shown). Western blot analysis of G9a protein expression revealed almost complete ablation of this HMT in B lineage cells from mb1-Cre crosses, whereas residual G9a was detected in thymocytes and resting T cells from lck-Cre crosses (Fig. 1, B and C).


Figure 1
View larger version (40K):
[in this window]
[in a new window]

 
FIGURE 1. Generation of G9a conditional knockout mice. A, Generation of the G9a{Delta} allele in B cells. G9acnd mice were crossed with mb1-Cre animals and genomic DNA was isolated from thymus (T) or from the B220+ and B220 cell fractions of the spleen (SP) and bone marrow (BM) of mice with the indicated genotypes. Tissue DNA was digested with HindIII and analyzed by Southern blotting. Sizes of the G9acnd (4.6 kb) and G9a{Delta} (5.8 kb) alleles are indicated at the right. B, Loss of G9a protein and H3K9me2 in B cells. B220+ cells were purified from bone marrow or spleen of G9a{Delta}/{Delta} and G9acnd/{Delta} mice. A portion of splenic B cells was cultured for 2 days in LPS-containing medium. Protein lysates were probed on immunoblots with a G9a-specific Ab. Immunoblot analysis of H3K9me was performed on nuclear protein extracts. The blot was sequentially probed with Abs specific for H3K9me2 and H3K9me3 as well as total H3 protein. C, Protein extracts from indicated lck-Cre/G9acnd/cnd cells were analyzed by immunoblotting as described in B. Control samples from either heterozygous or G9a-deficient ES cells are included. Total histone H4 levels serve as a protein loading control.

 
Prior studies established that G9a deficiency in ES cells produces a dramatic and specific decrease in global H3K9me2 (7). To determine whether this functional phenotype is recapitulated in G9a-deficient lymphocytes, we purified these cells and immunoblotted protein extracts for H3K9 modifications. Global levels of H3K9me2 are significantly decreased in resting and LPS-stimulated B cells from mb1-Cre/G9acnd mice when compared with control cells (≤20%; Fig. 1B and data not shown). As expected, levels of H3K9me3 are largely unaffected by G9a deletion (7). In contrast, only a modest reduction in global H3K9me2 is observed in T cells from lck-Cre/G9acnd mice (Fig. 1C), which correlates with persistent G9a expression. Notwithstanding, these data indicate that G9a is the major H3K9 dimethyltransferase in lymphocytes.

G9a-deficient lymphocytes develop normally

Given the global nature of the H3K9me2 mark on chromatin, we reasoned that G9a would regulate important aspects of gene expression programs that guide lymphocyte development, activation, and differentiation. Initially, we examined lymphocyte development using flow cytometric analyses of cell surface markers. Surprisingly, G9a-deficient mice generate a normal complement of mature B cells in their bone marrow and spleen despite a substantial defect in global H3K9me2 (Fig. 2A). Likewise, G9a deletion by lck-Cre does not significantly alter thymocyte development or generation of splenic T cells (Fig. 2B). Thus, expression of G9a and consequential H3K9me2 are largely dispensable for proper development of effector B and T cells.


Figure 2
View larger version (39K):
[in this window]
[in a new window]

 
FIGURE 2. Lymphocyte development in G9a conditional knockout mice. A, Bone marrow or splenic cells from wild-type (G9acnd/{Delta} mb1-cre) or mb1-Cre crosses with G9acnd/{Delta} mice were analyzed by flow cytometry. Bone marrow cells were stained with anti-CD43-biotin, streptavidin-FITC, and anti-B220-PE (top). Spleen cells were stained with anti-IgM-FITC and anti-B220-PE (bottom). All data were gated for live lymphocyte populations. Representative FACS plots from independent analyses of at least eight mice for each genotype are shown. The percentages for each cell population are shown. No reproducible differences were observed in total cell numbers for spleen or bone marrow (BM) samples from any of the genotypes. B, T cell development was examined in thymocytes (top) from lck-Cre/G9acnd/cnd and wild-type animals, which were stained with CD4-FITC and CD8-PE (top). CD3-FITC and B220-PE stains revealed normal levels of B and T cell populations in the spleen samples from G9a-deficient animals (bottom).

 
Lymphocyte proliferation and humoral immune response

To test whether G9a plays an important role in lymphocyte activation programs, B cells were purified from control or G9a{Delta}/{Delta} spleens and cultured with polyclonal agonists LPS or anti-IgM. As shown in Fig. 3A, G9a-deficient B cells exhibit only a modest proliferation defect upon LPS stimulation. However, proliferation of G9a{Delta}/{Delta} B lymphocytes is inhibited ~4-fold after BCR cross-linking with anti-IgM. Decreased proliferation does not result from enhanced cell death in the induced cultures as monitored by annexin V-7-aminoactinomycin D staining (apoptotic fraction: wild type 31 ± 17%, G9a{Delta}/{Delta} 36 ± 10% for LPS; wild type 53 ± 10%, G9a{Delta}/{Delta} 60 ± 8% for anti-IgM). Furthermore, these effects are agonist specific because mutant cells proliferate normally upon CD40 cross-linking (data not shown). No significant defects are observed in the proliferative capacity of G9a-deficient T cells upon treatment with anti-CD3 Abs (data not shown). These data indicate that G9a is required for optimal activation of B cells following engagement of their Ag receptor.


Figure 3
View larger version (44K):
[in this window]
[in a new window]

 
FIGURE 3. Proliferative defects and primary immune responses. A, Purified splenic B cells from G9a{Delta}/+ or G9a{Delta}/{Delta} mice were stimulated for 2 days with indicated amounts of LPS or anti-IgM. Proliferation was determined by [3H]TdR incorporation after an 18-h pulse. Experiments from two mice of each genotype are shown and are representative of at least 15 independent experiments using both G9a{Delta}/+ mb1-cre+ and G9acnd/{Delta} mb1-cre mice as wild-type controls. B, Natural Ig levels. Serum was collected from six G9a{Delta}/+ or six G9a{Delta}/{Delta} littermates at 8 wk of age. Steady-state levels of total serum Ig or specific Ig isotypes were determined by ELISA assays. Relative values for total Ig, IgM, Ig{kappa}, and Ig{lambda} are shown. No significant differences were observed in any IgH isotype (data not shown). Bars represent mean values of Ig concentration for each genotype. C, ELISA for IgH isotypes. Purified splenic B cells were stimulated with 5 ng/ml LPS ± 5 ng/ml IL-4. After 6 days, culture media were collected, and ELISA was used to determine IgG1 and IgE titers. Data are representative of two independent experiments. D, RNA expression analysis for B cell activation genes. Total RNA was prepared from wild-type or G9a-deficient B cells stimulated for 3.5 days with LPS alone (5 µg/ml) or LPS with 5 ng/ml IL-4. RNA was reverse transcribed, and the resultant cDNA was subject to PCR assays specific for Blimp-1, IgJ, AID, germline IgG1 transcripts, or β-actin. Titrations represent 3-fold dilutions. E, Plasma cell formation. G9a{Delta}/{Delta} and control splenocytes were stimulated for 3.5 days in the presence of LPS and IL-4 as in D. The percentage of plasma cells in these cultures was determined by FACS using FITC-B220 and PE-CD138. The circled fractions highlight the plasma cell subset.

 
In addition to proliferation, the B cell activation program includes Ig isotype switching, affinity maturation, and terminal differentiation into Ig-secreting plasma cells. Isotype switching and affinity maturation require AID, whose expression is regulated by the transcription factor Blimp-1 (36). Importantly, Blimp-1 interacts with G9a to mediate gene-specific H3K9me2 and gene repression (37). To test whether these processes are perturbed upon G9a deletion, we measured steady-state levels of circulating Ig proteins. Steady-state levels of IgH isotypes in G9a{Delta}/{Delta} mice are normal (Fig. 3B and data not shown); however, a 50% reduction in circulating Ig{lambda} is observed in the mutant animals. Similar results for IgH isotypes (unchanged) and Ig{lambda} (reduced) are obtained following immunization with the T-dependent Ag KLH in CFA (data not shown).

To more rigorously test whether G9a regulates class switch recombination (CSR), purified B cells from control and G9a{Delta}/{Delta} mice were cultured with the polyclonal agonist LPS for 6 days in the presence or absence of the TH2 cytokine IL-4. As shown in Fig. 3C, G9a{Delta}/{Delta} cells undergo class switching, but produce significantly less IgG1 and IgE than their wild-type counterparts. RT-PCR indicates that AID expression is unaffected by G9a deletion (Fig. 3D). Likewise, no differences are observed in germline transcription of the IgG1 locus, a prerequisite for its CSR (Fig. 3D). In contrast, expression of two plasma cell markers, Blimp-1 and J chain (IgJ), are ~3-fold lower in G9a{Delta}/{Delta} cells upon stimulation with LPS and IL-4 but not with LPS treatment alone (Fig. 3D). Quantitative real-time PCR assays confirmed the reduction in Blimp-1 (3-fold) and IgJ mRNA expression (2.5-fold; data not shown). These findings suggest that G9a deficiency inhibits plasma cell differentiation, rather than CSR, leading to reduced secretion of IgG1 and IgE in LPS + IL-4 B cell cultures. Indeed, FACS indicated a 2-fold reduction of plasma cell differentiation in G9a{Delta}/{Delta} cultures after LPS+IL-4 stimulation for 3 days (Fig. 3E). Again, the paucity of plasma cells in these cultures could not be attributed to enhanced cell death because annexinV-7-aminoactinomycin D staining reveals similar numbers of apoptotic cells for the wild-type and G9a-deficient genotypes (data not shown). Together, these data indicate a specific role for G9a in processing the cues that lead activated B cells into their terminal differentiation program under certain stimulatory conditions.

G9a is dispensable for tissue-specific control of V(D)J recombination

Prior studies established correlations between H3K9me and tissue- or stage-specific repression of recombinase accessibility (18, 19). Moreover, G9a-mediated methylation of H3K9 inhibits recombination of chromosomal substrates (20). Our finding that lymphocyte development is unaffected in G9a-deficient mice suggested that it is dispensable for most aspects of Ag receptor gene assembly. However, these cell-based assays are insufficient to probe whether G9a is required for tissue-specific repression of Ig loci in thymocytes or TCR loci in developing B cells.

To test whether repression of TCR gene assembly is compromised in G9a-deficient B cells, we measured products of V(D)J recombination in DNA from bone marrow or splenic B cells. As shown in Fig. 4A, repression of TCR{alpha} and TCRβ recombination is maintained in B cells from G9a-deficient mice. Similarly, the loss of G9a fails to induce rearrangement of TCR{gamma} or TCR{delta} loci in B cells. Analogous assays were used to probe for loss of tissue-specific Ig gene assembly in G9a-deficient T cells. These sensitive assays fail to detect IgH or IgL gene rearrangements above background levels from contaminating B cells in thymocytes from G9a-deficient mice (Fig. 4B). Although we observed no gross thymocyte developmental defects in G9a-deficient mice (Fig. 2B), it remained possible that cellular selection processes are masking potential rearrangement defects at the endogenous TCRβ locus. To test this possibility, we measured D-to-J rearrangements of Dβ1 and Dβ2 gene segments, which indicate that the initial stage of TCRβ assembly is unaffected by the loss of G9a (Fig. 4B). Likewise, rearrangement of distal (Vβ16), medial (Vβ12), and proximal (Vβ14) Vβ gene segments to Dβ1 remains largely normal upon deletion of G9a (Fig. 4B).


Figure 4
View larger version (70K):
[in this window]
[in a new window]

 
FIGURE 4. Maintenance of tissue-specific V(D)J recombination in the absence of H3K9me2. A, TCR rearrangement assays in G9a-deficient B cells. DNA from purified B220+ cells, from bone marrow (BM) or spleen (SP), of two G9acnd/{Delta} or G9a{Delta}/{Delta} mice was subjected to PCR assays for V{alpha}->J{alpha}, Dβ->Jβ, V{gamma}->J{gamma}, or V{delta}->J{delta} coding joins. Samples from a RAG-deficient pro-B cell line (63-12) or thymocytes served as negative and positive controls, respectively. Total DNA content for each sample was measured using PCR for C{lambda}. The linearity of each assay was confirmed using 1/3 serial dilutions of unsorted G9acnd/{Delta} thymus DNA. B, Rearrangement of Ig and TCR genes in G9a-deficient T cells. Thymocyte DNA from two G9a{Delta}/+ or G9a{Delta}/{Delta} mice was subjected to PCR assays for the indicated IgH, IgL, and TCR rearrangements. DNA from B220+ bone marrow cells or thymocytes was used as a positive control, and the wedge indicates 1/3 dilutions of these samples. C, ChIP assays for H3K9 modifications of the TCRβ or IgH loci in G9a-deficient precursor B cells. Chromatin from wild-type and G9a-deficient pro-B or a mixture of predominantly pre-B cells was immunoprecipitated with Abs specific for H3K9ac, H3K9me2, H3K9me3, or nonspecific IgG. Immunocomplexes were assayed by PCR for Dβ1 or JH4 sequences. Wedges indicate sequential 1/4 dilutions of each sample.

 
Our biochemical analyses of G9a-deficient B cells showed that global levels of H3K9me2 were significantly decreased when compared with control cells (Fig. 1B). However, it remained possible that specific regions within the genome, including TCR loci, retain normal levels of H3K9me2, perhaps via the function of a redundant HMT. To address this possibility, we performed ChIP experiment to probe for modifications on chromatin isolated from pro-B (B220+/Rag2–/–) or a mixture of bone marrow pro- and pre-B cells (B220+/IgM/Rag2–/–). Deletion of G9a has no effect on levels of H3K9me3 or acetylated H3K9 (H3K9ac) within the DβJβ cluster of these precursor B cells (Fig. 4C). In sharp contrast, H3K9me2 is largely absent from chromatin associated with both the TCRβ and Ig regions in precursor cells from G9a-deficient mice. Together, these results indicate that H3K9me2 is dispensable for tissue-specific repression of recombinase accessibility at Ig and TCR loci.

Inhibition of Ig{lambda} gene assembly in G9a-deficient pre-B cells

In addition to tissue specificity, V(D)J recombination proceeds in a stage-specific manner during lymphocyte development. After IgH gene assembly in pro-B cells, V(D)J recombinase is targeted to the Ig{kappa} locus for V{kappa}->J{kappa} rearrangement in pre-B cells. Should a pre-B cell fail to make a productive join on either Ig{kappa} allele, recombinase is then retargeted to the Ig{lambda} locus. Consistent with ordered Ig gene assembly, histone modification patterns at Ig loci change during the pro-B to pre-B cell transition (18, 38).

One consequence of ordered IgL gene assembly is a preponderance of mouse B cells that express Ig{kappa} as their L chain (~90% Ig{kappa}, 10% Ig{lambda}). In this regard, we noted further skewing of IgL isotypes in G9a{Delta}/{Delta} serum before or after immunization (Fig. 3B and data not shown). Upon further examination, we found that G9a-deficient mice possess fewer Ig{lambda}+ B cells in their spleens (Figs. 5, A and B). This skewing of IgL usage is not simply due to selection in peripheral lymphoid organs because a similar exaggeration of Ig{kappa}:Ig{lambda} is observed in G9a-deficient bone marrow. Flow cytometry indicated that IgL isotype exclusion remains intact because Ig{kappa}+Ig{lambda}+ double-expressing cells are absent in G9a{Delta}/{Delta} animals (Fig. 5A).


Figure 5
View larger version (56K):
[in this window]
[in a new window]

 
FIGURE 5. Perturbation of Ig{lambda} gene assembly in G9a-deficient B cells. A, Skewed IgL usage in G9a-deficient B cells. FACS of bone marrow or spleen cells from mb1-Cre/G9acnd/{Delta} and control mice stained for surface expression of Ig{kappa} and Ig{lambda} light chains. FACS data are representative of eight independent mice of each genotype. B, Graphic representation of FACS data for Ig{lambda}:Ig{kappa} ratios. C, Schematic of the Ig{lambda} locus. Boxes represent coding sequences, triangles depict recombination signal sequences, and arrows indicate the predominant V{lambda} to J{lambda} rearrangement events observed in mouse B cells. V{lambda}1 and V{lambda}2 are separated from their corresponding J{lambda} segments by ~20 and 60 kb, respectively. D, DNA extracts were prepared from pro-B, pre-B, or IgM+ bone marrow compartments of G9acnd/{Delta} and G9a{Delta}/{Delta} mice. DNA was analyzed for relative levels of IgH (VH558->J3), Ig{kappa} (all V{kappa}->J{kappa}1), and Ig{lambda} gene rearrangements. Distinct radiolabeled probes were used for general V{lambda}->J{lambda} rearrangements or specific V{lambda}J{lambda} products as indicated at the right. The linearity of each assay was confirmed using 1/2 dilutions. DNA from the RAG-deficient pro-B cell 63-12 provides a negative control. C{lambda} serves as a loading control for total DNA content. E, Germline transcription of Ig gene segments. Total mRNA was prepared from pro-B cells (B220+ bone marrow on a RAG-deficient background) or a mixture of pro-B and pre-B cells (IgM/B220+ bone marrow) from G9acnd/{Delta} or G9a{Delta}/{Delta} mice. RNA samples were subjected to RT-PCR assays specific for JH, J{kappa}, or individual V{lambda} and J{lambda} transcripts as indicated at the left. cDNA from the RAG-deficient pro-T cell line P5424 was included as a negative control and assay linearity was confirmed using serial 1/2 dilutions. F, ChIP assays for H3K9 modifications of IgL loci in G9a-deficient precursor B cells. Chromatin from control and G9a-deficient pro- or pre-B cells was immunoprecipitated with Abs specific for H3K9ac, H3K9me2, H3K9me3, or nonspecific IgG. Immunocomplexes were assayed by PCR for V{lambda}1, J{lambda}1, or J{kappa} sequences. Wedges indicate sequential 1/4 dilutions of each sample.

 
To test whether redistribution of IgL usage results from perturbations in gene assembly, we measured levels of V{kappa}->J{kappa} and V{lambda}->J{lambda} joins in purified pro-B, pre-B, and mature B cells from G9a-deficient and control bone marrow. To confirm sorting purities, we measured levels of VH->DHJH and V{kappa}->J{kappa} rearrangements in each cell fraction (Fig. 5D). As expected, VH->DHJH rearrangements are readily detected in pro- and pre-B cells from both genotypes, whereas V{kappa}->J{kappa} recombinations are restricted to pre-B cells. These data indicate that stage-specific restrictions on Ig{kappa} are maintained in the absence of G9a. Thus, premature activation of Ig{kappa} does not explain the paucity of Ig{lambda}-producing cells in mutant mice. In contrast, V{lambda}->J{lambda} rearrangement is consistently reduced ~3-fold in G9a-deficient pre-B cells (Fig. 5D).

To extend these findings, we examined the effects of G9a deficiency on recombination of specific V{lambda}J{lambda} gene segments. The mouse Ig{lambda} locus consists of two cassettes with the first encoding a single V{lambda} gene segment, V{lambda}1, which rearranges to J{lambda}1 or J{lambda}3 (Fig. 5C). A second cassette contains two V and two J segments (V{lambda}2, V{lambda}x, J{lambda}2, and J{lambda}4). The predominant rearrangement in this cassette is V{lambda}2->J{lambda}2 because V{lambda}x rarely rearranges and J{lambda}4 lacks a consensus recombination signal sequence (28). To determine the specificity of V{lambda}->J{lambda} rearrangement defects in G9a{Delta}/{Delta} mice, we performed PCR assays that distinguish V{lambda}J{lambda} joins in each cassette (V{lambda}1->J{lambda}1 or V{lambda}2->J{lambda}2). As shown in Fig. 5D, V{lambda}1->J{lambda}1 and V{lambda}2->J{lambda}2 joins are both reduced ~3-fold in G9a{Delta}/{Delta} pre-B cells. These data indicate that G9a potentiates assembly of the entire Ig{lambda} locus during B cell development.

The recombination potential of a given gene segment correlates with its germline transcription (39, 40), indicating that shared cis-acting elements regulate chromatin accessibility to transcriptional and recombinational machinery. To investigate accessibility mechanisms at Ig{lambda}, we performed assays for germline transcription in pro-B cells isolated from Rag2–/– animals or a mixture of pro-B and pre-B cells (B220+IgM) from Rag2+/+ mice. These assays revealed a consistent reduction in steady-state levels of germline V{lambda}1 and V{lambda}2 transcripts in precursors from G9a-deficient animals (Fig. 5E). In contrast, germline transcripts of J{lambda}, JH, and J{kappa} segments are unaffected by the loss of G9a. These data suggest that reduced Ig{lambda} usage results from a V{lambda}-specific defect in chromatin accessibility, which inhibits V{lambda}->J{lambda} recombination.

To extend these findings, we performed ChIP analyses on the same cell populations. Consistent with immunoblot analyses of global methylation, H3K9me2 levels are significantly decreased at all IgL loci in G9a-deficient cells (Fig. 5F). Loss of this histone mark alone does not impair V(D)J recombination because similar decreases in H3K9me2 are observed at IgH and Ig{kappa} gene segments, which rearranged at wild-type levels. ChIP analyses also revealed a 2- to 3-fold reduction of H3K9 acetylation in G9a{Delta}/{Delta} pre-B cells at both the V{lambda}1 and V{lambda}2 segments (Fig. 5F and data not shown). In contrast, H3K9 acetylation of J{lambda}1, J{lambda}2, and J{kappa} segments is comparable in wild-type and G9a-deficient pre-B cells (Fig. 5F and data not shown). We conclude that Ig{lambda} gene assembly is inhibited in G9a-deficient pre-B cells due to altered patterns of epigenetic modifications at V{lambda} segments, leading to decreased chromatin accessibility.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Lymphocyte development requires a dynamic regulation of gene expression that relies on changes in chromatin modifications. One modification, H3K9me, represses assembly of Ag receptor genes in lymphocytes and generally inhibits gene expression (19, 20, 41). To determine the role of H3K9me2 in lymphocyte development and function, we used tissue-specific deletion of G9a. Despite significant reductions in global H3K9me2, lymphocyte development and stage-/tissue-specific control of V(D)J recombination is unaffected by the loss of G9a. However, Ig{lambda} gene assembly in G9a-deficient pre-B cells is decreased, resulting in reduced surface expression and serum levels of this IgL isotype. These data provide the first evidence that G9a-mediated modification of H3K9 controls Ag receptor gene assembly via either direct or indirect mechanisms.

Our biochemical analyses indicate an 80% reduction in global levels of H3K9me2 upon deletion of G9a in pre-B cells. Thus, similar to ES cells, G9a serves as the major H3K9 dimethyltransferase in B lymphocytes (7). We cannot draw an analogous conclusion regarding T cells due to persistent G9a expression following Cre-mediated deletion. Notwithstanding, residual levels of H3K9me2 in lymphocytes from both mutant animals may result from methylation by a compensatory HMT. In this regard, GLP and G9a form heterodimers to cooperatively dimethylate H3K9 (9). However, our observations that global H3K9me2 is reduced in the absence of G9a would indicate that GLP cannot fully substitute for G9a in developing B cells.

Prior studies have shown that significant loss of H3K9me2 during embryonic development is lethal (7), suggesting an important role for G9a in many cellular processes. Therefore, it was surprising that B cell development proceeded unperturbed upon the concomitant loss of G9a and H3K9me2. These findings can be interpreted in several ways, including: 1) H3K9me2 is dispensable in the B lineage and/or other differentiated cells; 2) B cells require minimal levels of H3K9me2; or 3) H3K9me3, which is unaffected by G9a deficiency, compensates for many H3K9me2 functions in differentiated cells. In contrast to developmental processes, we found that BCR-mediated activation of mature B cells is compromised upon loss of G9a. However, general cell division is unaffected by G9a deficiency because mutant B cells respond normally to CD40 cross-linking. More likely, G9a regulates a cohort of genes that are unique to the BCR signaling pathway. Future studies will establish G9a-dependent expression programs that fall under BCR control.

Although G9a-deficient B cells undergo class switching to IgG1 and IgE upon stimulation with LPS and IL-4, these two Ig isotypes are significantly decreased in culture supernatants. However, AID and germline IgG1 expression are unaffected by G9a deficiency, suggesting that attenuated levels of IgG1 and IgE do not result from overt defects in CSR. G9a-deficient B cells exhibit a marked decrease in Blimp-1 and IgJ expression upon LPS + IL-4 stimulation, which correlates with a 2-fold reduction of plasma cells in these cultures. These findings suggest that G9a{Delta}/{Delta} B cells fail to fully execute the plasma cell differentiation program under certain stimulatory conditions, which likely accounts for the lower levels of secreted IgG1 and IgE in culture supernatants. Future experiments will define the range of gene expression defects in G9a-deficient B cells and identify relevant G9a target genes that guide terminal differentiation to plasma cells.

H3K9 modifications correlate with activation or repression of V(D)J recombination at Ig and TCR loci. Recombinationally active loci are characterized by H3K9ac, whereas inert loci are hypoacetylated and hypermethylated at this residue (18, 19, 34, 41, 42). Moreover, targeting of G9a to chromosomal substrates suppresses V(D)J recombination (20). Despite these data, we show that tissue-/stage-specific assembly of Ag receptor genes is maintained upon loss of H3K9me2. Our findings suggest that the H3K9me3 mark is sufficient to enforce tissue-specific repression of V(D)J recombination either directly or by impeding acetylation at this residue. Consistent with emerging mechanistic models, these data indicate that changes in a single histone modification are insufficient to initiate gene activation or repression. Instead, activation states are determined by the general pattern of histone modifications at the locus (43). Moreover, essential transcription factors that promote chromatin accessibility or induce H3K9ac at Ag receptor loci may not be activated upon G9a deletion. We conclude that tissue- and/or stage-specificity of V(D)J recombination is controlled at many genetic and epigenetic levels beyond the simple acquisition of H3K9me2.

In contrast to tissue-specific control, we found that loss of G9a perturbed IgL usage at the level of V(D)J recombination. Pre-B cells from mutant mice exhibit a 2- to 3-fold reduction in V{lambda}->J{lambda} rearrangement. At face value, our findings are counterintuitive because G9a normally enforces gene repression. However, B cell-specific deletion of a second repressive HMT (Ezh2, H3K27me3) inhibits recombination of VH gene segments (44). In both cases, it remains likely that these HMTs regulate locus recombination via indirect mechanisms. Given the role of G9a in gene repression, we hypothesize that this HMT may normally repress an inhibitor of Ig{lambda} locus accessibility. The absence of G9a would lead to enhanced expression of the inhibitor and partial repression of V{lambda}->J{lambda} rearrangement. Alternatively, G9a may function by unknown mechanisms to directly activate a transcription factor that promotes Ig{lambda} gene assembly (45).

Regardless of the precise mechanism, our data indicate that G9a regulates Ig{lambda} specifically by controlling chromatin accessibility at V{lambda}1 and V{lambda}2 segments. Loss of G9a significantly reduces germline transcription and H3K9ac at both V{lambda} segments while sparing these metrics of open chromatin at J{lambda} segments. These data suggest that a V{lambda}-specific accessibility control element is regulated by G9a either directly or indirectly. Each V{lambda}-J{lambda} cluster contains a single known enhancer (E{lambda}1–3 and E{lambda}2–4), an undefined J{lambda} germline promoter, and promoters situated 5' of each V{lambda} segment. However, the ACE function and domain of influence for these transcriptional control elements are unknown (1, 46). We suspect that G9a-mediated control of Ig{lambda} is independent of known E{lambda} enhancers because germline transcription of J segments falls under enhancer control at all other Ig and TCR loci. Instead, we propose that G9a regulates V{lambda} promoters in the germline Ig{lambda} configuration, perhaps by altering the expression of a cognate promoter factor. However, the functional architecture of V{lambda} promoters is very similar to those driving V{kappa} and VH expression, suggesting the existence of an unidentified factor specific for V{lambda}. The advent of G9a-deficient mice such as those reported here will permit a dissection of mechanisms by which this HMT controls chromatin accessibility at V{lambda} segments and thereby maintains a balance of IgL usage in developing B cells.


    Acknowledgments
 
We thank Danyvid Olivares-Villagomez and Vrajesh Parekh for help with ELISAs and measurement of cell proliferation.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by National Institutes of Health Grants P01 HL68744 and CA100905 (to E.M.O.) and F32 AI066691-01A1 (to L.R.T.); Cancer Center Support Grant P30 CA68485, Vanderbilt-Ingram Cancer Center (to E.M.O.); a grant-in-aid from the Ministry of Education, Science, Technology, and Culture of Japan (to Y.S. and M.T.); the 21st Century Center of Excellence Program of the Ministry of Education, Culture, Sports, Science, Technology to the Graduate School of Biostudies (to H.M.); and Deutsche Forschungsgemeinschaft Grant SFB620, Teilprojekte B5 (to M.R.). Back

2 Address correspondence and reprint requests to Dr. Eugene M. Oltz, Department of Microbiology and Immunology, Vanderbilt University School of Medicine, 1161 21st Avenue South, Nashville, TN 37232. E-mail address: eugene.oltz{at}vanderbilt.edu Back

3 Abbreviations used in this paper: H3K9, histone 3 lysine 9; H3K9me1, me2, and me3, mono-, di-, and trimethylated forms of H3K9; HMT, histone methyltransferase; AID, activation-induced deaminase; CSR, class switch recombination; ChIP, chromatin immunoprecipitation; KLH, keyhole limpet hemocyanin; ES cells, embryonic stem cells; H3K9ac, acetylated H3K9. Back

Received for publication September 4, 2007. Accepted for publication April 16, 2008.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Cobb, R. M., K. J. Oestreich, O. A. Osipovich, E. M. Oltz. 2006. Accessibility control of V(D)J recombination. Adv. Immunol. 91: 45-109. [Medline]
  2. Abarrategui, I., M. S. Krangel. 2006. Regulation of T cell receptor-{alpha} gene recombination by transcription. Nat. Immunol. 7: 1109-1115. [Medline]
  3. Jenuwein, T., C. D. Allis. 2001. Translating the histone code. Science 293: 1074-1080. [Abstract/Free Full Text]
  4. Jacobson, R. H., A. G. Ladurner, D. S. King, R. Tjian. 2000. Structure and function of a human Tafii250 double bromodomain module. Science 288: 1422-1425. [Abstract/Free Full Text]
  5. Syntichaki, P., I. Topalidou, G. Thireos. 2000. The Gcn5 bromodomain co-ordinates nucleosome remodelling. Nature 404: 414-417. [Medline]
  6. Struhl, K.. 1998. Histone acetylation and transcriptional regulatory mechanisms. Genes Dev. 12: 599-606. [Free Full Text]
  7. Tachibana, M., K. Sugimoto, M. Nozaki, J. Ueda, T. Ohta, M. Ohki, M. Fukuda, N. Takeda, H. Niida, H. Kato, Y. Shinkai. 2002. G9a histone methyltransferase plays a dominant role in euchromatic histone H3 lysine 9 methylation and is essential for early embryogenesis. Genes Dev. 16: 1779-1791. [Abstract/Free Full Text]
  8. Peters, A. H., D. O'Carroll, H. Scherthan, K. Mechtler, S. Sauer, C. Schofer, K. Weipoltshammer, M. Pagani, M. Lachner, A. Kohlmaier, et al 2001. Loss of the Suv39h histone methyltransferases impairs mammalian heterochromatin and genome stability. Cell 107: 323-337. [Medline]
  9. Tachibana, M., J. Ueda, M. Fukuda, N. Takeda, T. Ohta, H. Iwanari, T. Sakihama, T. Kodama, T. Hamakubo, Y. Shinkai. 2005. Histone methyltransferases G9a and Glp form heteromeric complexes and are both crucial for methylation of euchromatin at H3–K9. Genes Dev. 19: 815-826. [Abstract/Free Full Text]
  10. Dodge, J. E., Y. K. Kang, H. Beppu, H. Lei, E. Li. . 2004. Histone H3–K9 methyltransferase eset is essential for early development. Mol. Cell. Biol. 24: 2478-2486. [Abstract/Free Full Text]
  11. Tachibana, M., K. Sugimoto, T. Fukushima, Y. Shinkai. 2001. SET domain-containing protein, G9a, is a novel lysine-preferring mammalian histone methyltransferase with hyperactivity and specific selectivity to lysines 9 and 27 of histone H3. J. Biol. Chem. 276: 25309-25317. [Abstract/Free Full Text]
  12. Wang, H., W. An, R. Cao, L. Xia, H. Erdjument-Bromage, B. Chatton, P. Tempst, R. G. Roeder, Y. Zhang. 2003. Mam facilitates conversion by eset of dimethyl to trimethyl lysine 9 of histone H3 to cause transcriptional repression. Mol. Cell 12: 475-487. [Medline]
  13. Kim, K. C., L. Geng, S. Huang. 2003. Inactivation of a histone methyltransferase by mutations in human cancers. Cancer Res. 63: 7619-7623. [Abstract/Free Full Text]
  14. Jung, D., F. W. Alt. 2004. Unraveling V(D)J recombination: insights into gene regulation. Cell 116: 299-311. [Medline]
  15. Schlissel, M. S.. 2003. Regulating antigen-receptor gene assembly. Nat. Rev. Immunol. 3: 890-899. [Medline]
  16. Sen, R., E. Oltz. 2006. Genetic and epigenetic regulation of Igh gene assembly. Curr. Opin. Immunol. 18: 237-242. [Medline]
  17. Stanhope-Baker, P., K. M. Hudson, A. L. Shaffer, A. Constantinescu, M. S. Schlissel. 1996. Cell type-specific chromatin structure determines the targeting of V(D)J recombinase activity in vitro. Cell 85: 887-897. [Medline]
  18. Johnson, K., D. L. Pflugh, D. Yu, D. G. Hesslein, K. I. Lin, A. L. Bothwell, A. Thomas-Tikhonenko, D. G. Schatz, K. Calame. 2004. B cell-specific loss of histone 3 lysine 9 methylation in the V(H) locus depends on Pax5. Nat. Immunol. 5: 853-861. [Medline]
  19. Morshead, K. B., D. N. Ciccone, S. D. Taverna, C. D. Allis, M. A. Oettinger. 2003. Antigen receptor loci poised for V(D)J rearrangement are broadly associated with Brg1 and flanked by peaks of histone H3 dimethylated at lysine 4. Proc. Natl. Acad. Sci. USA 100: 11577-11582. [Abstract/Free Full Text]
  20. Osipovich, O., R. Milley, A. Meade, M. Tachibana, Y. Shinkai, M. S. Krangel, E. M. Oltz. 2004. Targeted inhibition of V(D)J recombination by a histone methyltransferase. Nat. Immunol. 5: 309-316. [Medline]
  21. Hobeika, E., S. Thiemann, B. Storch, H. Jumaa, P. J. Nielsen, R. Pelanda, M. Reth. 2006. Testing gene function early in the B cell lineage in mb1-cre mice. Proc. Natl. Acad. Sci. USA 103: 13789-13794. [Abstract/Free Full Text]
  22. Lee, P. P., D. R. Fitzpatrick, C. Beard, H. K. Jessup, S. Lehar, K. W. Makar, M. Perez-Melgosa, M. T. Sweetser, M. S. Schlissel, S. Nguyen, et al 2001. A critical role for Dnmt1 and DNA methylation in T cell development, function, and survival. Immunity 15: 763-774. [Medline]
  23. Tachibana, M., M. Nozaki, N. Takeda, Y. Shinkai. 2007. Functional dynamics of H3k9 methylation during meiotic prophase progression. EMBO J. 26: 3346-3359. [Medline]
  24. Schlissel, M. S., L. M. Corcoran, D. Baltimore. 1991. Virus-transformed Pre-B cells show ordered activation but not inactivation of immunoglobulin gene rearrangement and transcription. J. Exp. Med. 173: 711-720. [Abstract/Free Full Text]
  25. Levin, S. D., S. J. Anderson, K. A. Forbush, R. M. Perlmutter. 1993. A dominant-negative transgene defines a role for P56lck in thymopoiesis. EMBO J. 12: 1671-1680. [Medline]
  26. Goldman, J. P., D. M. Spencer, D. H. Raulet. 1993. Ordered rearrangement of variable region genes of the T cell receptor {gamma} locus correlates with transcription of the unrearranged genes. J. Exp. Med. 177: 729-739. [Abstract/Free Full Text]
  27. Capone, M., R. D. Hockett, Jr, A. Zlotnik. 1998. Kinetics of T cell receptor β, {gamma}, and {delta} rearrangements during adult thymic development: T cell receptor rearrangements are present in Cd44+Cd25+ pro-T thymocytes. Proc. Natl. Acad. Sci. USA 95: 12522-12527. [Abstract/Free Full Text]
  28. Bendall, H. H., M. L. Sikes, E. M. Oltz. 2001. Transcription factor Nf-{kappa}B regulates Ig {lambda} light chain gene rearrangement. J. Immunol. 167: 264-269. [Abstract/Free Full Text]
  29. Whitehurst, C. E., S. Chattopadhyay, J. Chen. 1999. Control of V(D)J recombinational accessibility of the Dβ1 gene segment at the Tcr β locus by a germline promoter. Immunity 10: 313-322. [Medline]
  30. Afshar, R., S. Pierce, D. J. Bolland, A. Corcoran, E. M. Oltz. 2006. Regulation of Igh gene assembly: role of the intronic enhancer and 5'dq52 region in targeting Dhjh recombination. J. Immunol. 176: 2439-2447. [Abstract/Free Full Text]
  31. O'Brien, D. P., E. M. Oltz, B. G. Van Ness. 1997. Coordinate transcription and V(D)J recombination of the {kappa} immunoglobulin light-chain locus: Nf-{kappa}b-dependent and -independent pathways of activation. Mol. Cell. Biol. 17: 3477-3487. [Abstract]
  32. Klein, U., S. Casola, G. Cattoretti, Q. Shen, M. Lia, T. Mo, T. Ludwig, K. Rajewsky, R. Dalla-Favera. 2006. Transcription factor Irf4 controls plasma cell differentiation and class-switch recombination. Nat. Immunol. 7: 773-782. [Medline]
  33. Muramatsu, M., K. Kinoshita, S. Fagarasan, S. Yamada, Y. Shinkai, T. Honjo. 2000. Class switch recombination and hypermutation require activation-induced cytidine deaminase (Aid), a potential RNA editing enzyme. Cell 102: 553-563. [Medline]
  34. Oestreich, K. J., R. M. Cobb, S. Pierce, J. Chen, P. Ferrier, E. M. Oltz. 2006. Regulation of Tcrβ gene assembly by a promoter/enhancer holocomplex. Immunity 24: 381-391. [Medline]
  35. Naim, J. O., M. Satoh, N. A. Buehner, K. M. Ippolito, H. Yoshida, D. Nusz, L. Kurtelawicz, S. F. Cramer, W. H. Reeves. 2000. Induction of hyper{gamma}globulinemia and macrophage activation by silicone gels and oils in female A.SW mice. Clin. Diag. Lab. Immunol. 7: 366-370. [Abstract/Free Full Text]
  36. Shaffer, A. L., K. I. Lin, T. C. Kuo, X. Yu, E. M. Hurt, A. Rosenwald, J. M. Giltnane, L. Yang, H. Zhao, K. Calame, L. M. Staudt. 2002. Blimp-1 orchestrates plasma cell differentiation by extinguishing the mature B cell gene expression program. Immunity 17: 51-62. [Medline]
  37. Gyory, I., J. Wu, G. Fejer, E. Seto, K. L. Wright. 2004. Prdi-Bf1 recruits the histone H3 methyltransferase G9a in transcriptional silencing. Nat. Immunol. 5: 299-308. [Medline]
  38. Goldmit, M., Y. Ji, J. Skok, E. Roldan, S. Jung, H. Cedar, Y. Bergman. 2005. Epigenetic ontogeny of the Igk locus during B cell development. Nat. Immunol. 6: 198-203. [Medline]
  39. Van Ness, B. G., M. Weigert, C. Coleclough, E. L. Mather, D. E. Kelley, R. P. Perry. 1981. Transcription of the unrearranged mouse C{kappa} locus: sequence of the initiation region and comparison of activity with a rearranged V{kappa}-C{kappa} gene. Cell 27: 593-602. [Medline]
  40. Yancopoulos, G. D., F. W. Alt. 1985. Developmentally controlled and tissue-specific expression of unrearranged Vh gene segments. Cell 40: 271-281. [Medline]
  41. McMurry, M. T., M. S. Krangel. 2000. A Role for histone acetylation in the developmental regulation of Vdj recombination. Science 287: 495-498. [Abstract/Free Full Text]
  42. Chowdhury, D., R. Sen. 2003. Transient Il-7/Il-7r signaling provides a mechanism for feedback inhibition of immunoglobulin heavy chain gene rearrangements. Immunity 18: 229-241. [Medline]
  43. Berger, S. L.. 2007. The complex language of chromatin regulation during transcription. Nature 447: 407-412. [Medline]
  44. Su, I. H., A. Basavaraj, A. N. Krutchinsky, O. Hobert, A. Ullrich, B. T. Chait, A. Tarakhovsky. 2003. Ezh2 controls B cell development through histone H3 methylation and Igh rearrangement. Nat. Immunol. 4: 124-131. [Medline]
  45. Vakoc, C. R., S. A. Mandat, B. A. Olenchock, G. A. Blobel. 2005. Histone H3 lysine 9 methylation and HP1{gamma} are associated with transcription elongation through mammalian chromatin. Mol. Cell 19: 381-391. [Medline]
  46. Lauster, R., C. A. Reynaud, I. L. Martensson, A. Peter, D. Bucchini, J. Jami, J. C. Weill. 1993. Promoter, enhancer and silencer elements regulate rearrangement of an immunoglobulin transgene. EMBO J. 12: 4615-4623. [Medline]



This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
F. L. Kuang, Z. Luo, and M. D. Scharff
H3 trimethyl K9 and H3 acetyl K9 chromatin modifications are associated with class switch recombination
PNAS, March 31, 2009; 106(13): 5288 - 5293.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thomas, L. R.
Right arrow Articles by Oltz, E. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thomas, L. R.
Right arrow Articles by Oltz, E. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS