|
|
||||||||





* Department of Microbiology and Immunology, Vanderbilt University, Nashville, TN 37232;
Experimental Research Center for Infectious Diseases, Institute for Virus Research, Department of Molecular and Cellular Biology, Graduate School of Biostudies, Kyoto University, Kyoto, Japan; and
Faculty of Biology, University of Freiburg and Max-Planck Institute of Immunobiology, Freiburg, Germany
| Abstract |
|---|
|
|
|---|
L chains and a corresponding inhibition of Ig
gene assembly in bone marrow precursors. These findings indicate that the H3K9me2 epigenetic mark affects a highly restricted set of processes during lymphocyte development and activation. | Introduction |
|---|
|
|
|---|
An important component of the mammalian epigenome is modification of histone H3 lysine 9 (H3K9),3 which is targeted by histone acetyltransferases and histone deacetylases. In general, acetylation of H3K9 leads to high-affinity interactions with bromodomains in other histone acetyltransferases or nucleosome-remodeling complexes, which further augment chromatin accessibility and induce transcription (3, 4, 5). In contrast, H3K9 methylation at promoters inhibits gene expression via recruitment of proteins that impair chromatin accessibility (6). The extent of methylation at H3K9 varies between types of repressive chromatin. Mono- and dimethylated forms of H3K9 (H3K9me1 and -me2) generally are found in euchromatin, suggesting a role for these modifications in dynamic mechanisms of repression (7). In contrast, trimethylated H3K9 (H3K9me3) is found predominantly at pericentric heterochromatin (8).
H3K9 methylation is catalyzed by one of six known histone methyltransferases (HMT) in mammals, which all contain an enzymatic SET domain. These H3K9 HMTs are expressed ubiquitously but display distinct enzymatic activities and patterns of chromosomal localization. The G9a/GLP proteins form heteromeric complexes and catalyze H3K9me1 and H3K9me2 at euchromatin (9). Similarly, ESET is found in euchromatic regions and is proposed to catalyze the conversion of H3K9me2 to H3K9me3 (10, 11, 12). The H3K9 HMT called RIZ1 is inactivated in a variety of human tumors, but its function in the modification of endogenous chromatin remains unknown (13). The redundant enzymes Suv39h1 and -h2 catalyze H3K9me3 and associate with pericentric heterochromatin. The functional significance of each H3K9 HMT has been confirmed by mouse knockout studies. Dual deletion of Suv39h1/2 results in reduced viability, genomic instability, and the lack of H3K9me3 at pericentric heterochromatin (8). Knockouts of G9a or GLP result in early embryonic lethality and substantially reduced levels of H3K9me1 and -me2 at euchromatin (7, 9).
In addition to changes in lymphocyte gene expression, the crosstalk between cis-acting elements and epigenetic modifications plays a key role in tissue- and stage-specific control of V(D)J recombination. This gene assembly process creates critical checkpoints that guide lymphocyte development and generates a diverse repertoire of Ig and TCR genes (1, 14, 15). In brief, a pro-B cell initially targets the RAG-1/2 components of V(D)J recombinase to assemble variable (V), diversity (D), and joining (J) gene segments that are selected randomly from large arrays within the Ig heavy (IgH) chain locus (16). Formation of a productive IgH gene stimulates developmental progression to the pre-B cell stage and V
J recombination at IgL chain loci, which also proceeds in a stepwise manner (Ig
precedes Ig
). A similar genetic program is used during thymocyte development, in which pro-T cells initiate Dβ
Jβ rearrangement followed by Vβ
DβJβ assembly. On incorporation into a pre-TCR, TCRβ signals for differentiation into pre-T cells and activation of V
J
rearrangement. The control mechanisms that direct V(D)J recombinase to specific clusters of gene segments rely on changes in chromatin accessibility (17). Indeed, the accessibility status of specific Ig and TCR gene segments correlates with their epigenetic modification. Similar to expressed genes, recombinationally active segments are hyperacetylated but hypomethylated at H3K9 (18, 19). Using model substrates, we recently established a cause-effect relationship between H3K9 methylation by G9a and repression of recombinase accessibility (20).
Despite these advances, little is known about the in vivo role of any H3K9 HMT in either V(D)J recombination or the gene expression programs that guide lymphocyte development. To address this issue, we generated mice that are devoid of G9a specifically in B or T cells. Mutant lymphocytes exhibit significantly reduced levels of H3K9me2 but not H3K9me3. Surprisingly, lymphocyte development is unperturbed by this whole-scale reduction of H3K9me2. B cell proliferation is modestly affected by G9a deficiency, but the humoral immune response to a T-dependent Ag is largely normal. Although tissue-specific control of V(D)J recombination remains intact, Ig
gene rearrangement is reduced in G9a-deficient pre-B cells. Together, these findings indicate that G9a is the major H3K9 dimethyltransferase in B cells; however, global defects in H3K9me2 affect a highly restricted set of processes in lymphocyte development and function.
| Materials and Methods |
|---|
|
|
|---|
Preparation of the G9acnd allele as well as mb1-Cre and Lck-Cre mice are published elsewhere (21, 22, 23). To generate mice with G9a-deficient B cells, we bred the G9acnd allele into the mb1-Cre background, which already had a G9a
allele, to produce mb1-Cre/G9acnd/
mice. The G9a
allele arose from spurious Cre-mediated deletion of G9acnd in the germ cells of an mb1-Cre/G9awt/cnd mouse. All animal studies have been reviewed and approved by the Vanderbilt Institutional Review Board.
Immunoblotting
Immunoblotting analyses of global histone modifications and G9a were performed as described (7).
PCR and chromatin immunoprecipitation (ChIP) assays
For recombination, DNA extracts were prepared from primary lymphocytes (1000 cells/µl) as outlined (24). Primers and probes to detect rearrangements have been described for V
J
(25), V
J
(26), V
J
(27), VHDHJH (24), V
J
(28), Dβ1Jβ1 (20), and Vβ12 and Vβ14 (29). Vβ16: primer, GGACCCAAAGTCTTACAGATCCC; Dβ2Jβ2, CACGATGTAACATTGTGGGGACTG and TCAGATCCCCACCAACCATGAGTG; probe, CCTTCACCAAAGTAGAGCTGC. V
J
: primer, ATGAATTCACTGGTCTAATAGGTGGTACCA, CTAGGACAGTCAGTTTGGTTCC, and CTAGGACAGTGACCTTGGTTCC; probes, TGCTGTACCATAGAGCACAGAAAT (all V
J
), GGTGTTCGGTGGAGG (V
1J
1), and TATGTTTTCGGCGGT (V
2J
2). For transcription assays, total RNA was extracted from lymphocytes using Trizol (Invitrogen) and converted to cDNA as described (20). Assays for RT-PCR have been reported for JH (30); J
(31); Blimp-1 (32); IgG1 germline transcripts (33); V
1, V
2, J
1, J
2, and β-actin (28). Activation-induced deaminase (AID): primer, GTGCCACCTCCTGCTCACTGG and TTCATGTAGCCCTTCCCAGGC; probe, GTGGCTGAGTTTCTGAGATGG. IgJ, primers, ATGAAGACCCACCTGCTTCTCTGG and TTGCTCTGGGTGGCAGTAACAACC; probe, ATGTGTACCCGAGTTACC. ChIP assays on B cell precursors were performed as described previously (34). Primers for Dβ ChIPs have been reported (20). JH4 ChIP: primer, GCTCAGTCACCGTCTCCTCAGG and GCCTCCAAAGTCCCTATCCCATC; probe, GGCTGAGAGAAGTTGGG. J
ChIP, primers, CGTTCGGTGCTGGGACCAAGC and GCCACGTCAACTGATAATGAGCCCTCTCC; probe, GACCAAGCTGGAGCTGAAACG. V
1 ChIP: primers, CCCCTGCAAACAGATGAGAAATCC and GCCTGCTGCTGACCAATATTG; probe, GAAAAGAATAGACCTGGTT. V
2 ChIP: CTGGCTCCTGCAAACAGGTA and GCCTGCTGCTGACCAATATTG; probe, GAAAATAATAGACTTGGTT. J
1 ChIP: primers, GATCTTTCAGTGATGTCACCACC and GCACCTCAAGTCTTGGAGAGAAC; probe, GGTGTTCGGTGGAGG. All amplification products were analyzed by Southern blotting.
Flow cytometry
Abs for cell surface markers were purchased from BD Biosciences except anti-Ig
-PE (Upstate Biotechnologies). Flow cytometry was performed on a FACSCalibur (BD Biosciences) and analyzed using CellQuest software.
Cell purification
MACS was used to purify splenic (CD43–) or bone marrow (B220+) B cells following the manufacturers protocol (Miltenyi Biotec). Splenic T cells were isolated using a mouse T cell Negative Isolation Kit (Dynal Biotech). Isolation of pro- and pre-B cell populations was performed as described (30).
Cell proliferation assays
Purified lymphocytes were seeded in 96-well plates (106/ml) and cultured in RPMI supplemented with 10% FCS. Proliferation was induced in B cell cultures with anti-IgM (Jackson Immunoresearch Laboratories), LPS (Sigma), or anti-CD40 (BD Biosciences) and in T cells by precoating wells with anti-CD3 (2C11, 1 µg/ml). After 48 h (B cells) or 60 h (T cells), [3H]TdR was added to each well, cells were incubated for 12–18 h, and TdR incorporation was quantified using liquid scintillation counting.
Immunization
Eight-week-old mice were immunized by i.p. injection of keyhole limpet hemocyanin (KLH; Sigma-Aldrich) at a concentration of 100 µg/50 µl/mouse mixed 1:1 with CFA (Difco). Serum was collected preimmunization or 3 wk postinjection. Total or KLH-specific Ig levels were measured by ELISA (Southern Biotech) as described (35).
Ig class switching
CD43– spleen cells (5 x 105) were cultured for 6 days with 5 µg/ml LPS ± 5 ng/ml mouse IL-4 (Peprotech). IgG1 and IgE were detected by ELISA (Southern Biotech).
| Results |
|---|
|
|
|---|
Germline inactivation of the gene encoding G9a leads to early embryonic lethality in mice, precluding studies of lymphocyte development (7). To circumvent this obstacle, we generated embryonic stem (ES) cells with a G9a allele containing loxP sites that flank exons 26 and 27 (G9acnd), which encode for its enzymatic SET domain (23). Expression of Cre recombinase in cells containing the G9acnd mutation deletes floxed exons and produces a functionally null G9a allele (G9a
; Ref. 23). The G9acnd allele was passed into the mouse germline as described (23).
To generate mice with G9a-deficient B cells, we bred G9acnd and mb1-Cre mice. The latter strain harbors a Cre expression cassette driven by the endogenous mb1 (Ig
) promoter, which is expressed in early progenitor B cells (21). Southern blotting confirmed that G9acnd was efficiently converted to G9a
(>90%) in bone marrow and splenic B cells (B220+) from the mb1-Cre genetic background (Fig. 1A). In contrast, non-B cells (B220–) retained the G9acnd configuration, confirming cell type-specific deletion by mb1-Cre. To generate T cell-specific G9a knockouts, we crossed G9acnd mice with lck-Cre-transgenic animals (22). Southern blot analysis of G9acnd/lck-Cre offspring confirmed T lineage-specific conversion to G9a
alleles (
90%) in both thymus and peripheral lymphoid organs (data not shown). Western blot analysis of G9a protein expression revealed almost complete ablation of this HMT in B lineage cells from mb1-Cre crosses, whereas residual G9a was detected in thymocytes and resting T cells from lck-Cre crosses (Fig. 1, B and C).
|
20%; Fig. 1B and data not shown). As expected, levels of H3K9me3 are largely unaffected by G9a deletion (7). In contrast, only a modest reduction in global H3K9me2 is observed in T cells from lck-Cre/G9acnd mice (Fig. 1C), which correlates with persistent G9a expression. Notwithstanding, these data indicate that G9a is the major H3K9 dimethyltransferase in lymphocytes. G9a-deficient lymphocytes develop normally
Given the global nature of the H3K9me2 mark on chromatin, we reasoned that G9a would regulate important aspects of gene expression programs that guide lymphocyte development, activation, and differentiation. Initially, we examined lymphocyte development using flow cytometric analyses of cell surface markers. Surprisingly, G9a-deficient mice generate a normal complement of mature B cells in their bone marrow and spleen despite a substantial defect in global H3K9me2 (Fig. 2A). Likewise, G9a deletion by lck-Cre does not significantly alter thymocyte development or generation of splenic T cells (Fig. 2B). Thus, expression of G9a and consequential H3K9me2 are largely dispensable for proper development of effector B and T cells.
|
To test whether G9a plays an important role in lymphocyte activation programs, B cells were purified from control or G9a
/
spleens and cultured with polyclonal agonists LPS or anti-IgM. As shown in Fig. 3A, G9a-deficient B cells exhibit only a modest proliferation defect upon LPS stimulation. However, proliferation of G9a
/
B lymphocytes is inhibited
4-fold after BCR cross-linking with anti-IgM. Decreased proliferation does not result from enhanced cell death in the induced cultures as monitored by annexin V-7-aminoactinomycin D staining (apoptotic fraction: wild type 31 ± 17%, G9a
/
36 ± 10% for LPS; wild type 53 ± 10%, G9a
/
60 ± 8% for anti-IgM). Furthermore, these effects are agonist specific because mutant cells proliferate normally upon CD40 cross-linking (data not shown). No significant defects are observed in the proliferative capacity of G9a-deficient T cells upon treatment with anti-CD3 Abs (data not shown). These data indicate that G9a is required for optimal activation of B cells following engagement of their Ag receptor.
|
/
mice are normal (Fig. 3B and data not shown); however, a 50% reduction in circulating Ig
is observed in the mutant animals. Similar results for IgH isotypes (unchanged) and Ig
(reduced) are obtained following immunization with the T-dependent Ag KLH in CFA (data not shown).
To more rigorously test whether G9a regulates class switch recombination (CSR), purified B cells from control and G9a
/
mice were cultured with the polyclonal agonist LPS for 6 days in the presence or absence of the TH2 cytokine IL-4. As shown in Fig. 3C, G9a
/
cells undergo class switching, but produce significantly less IgG1 and IgE than their wild-type counterparts. RT-PCR indicates that AID expression is unaffected by G9a deletion (Fig. 3D). Likewise, no differences are observed in germline transcription of the IgG1 locus, a prerequisite for its CSR (Fig. 3D). In contrast, expression of two plasma cell markers, Blimp-1 and J chain (IgJ), are
3-fold lower in G9a
/
cells upon stimulation with LPS and IL-4 but not with LPS treatment alone (Fig. 3D). Quantitative real-time PCR assays confirmed the reduction in Blimp-1 (3-fold) and IgJ mRNA expression (2.5-fold; data not shown). These findings suggest that G9a deficiency inhibits plasma cell differentiation, rather than CSR, leading to reduced secretion of IgG1 and IgE in LPS + IL-4 B cell cultures. Indeed, FACS indicated a 2-fold reduction of plasma cell differentiation in G9a
/
cultures after LPS+IL-4 stimulation for 3 days (Fig. 3E). Again, the paucity of plasma cells in these cultures could not be attributed to enhanced cell death because annexinV-7-aminoactinomycin D staining reveals similar numbers of apoptotic cells for the wild-type and G9a-deficient genotypes (data not shown). Together, these data indicate a specific role for G9a in processing the cues that lead activated B cells into their terminal differentiation program under certain stimulatory conditions.
G9a is dispensable for tissue-specific control of V(D)J recombination
Prior studies established correlations between H3K9me and tissue- or stage-specific repression of recombinase accessibility (18, 19). Moreover, G9a-mediated methylation of H3K9 inhibits recombination of chromosomal substrates (20). Our finding that lymphocyte development is unaffected in G9a-deficient mice suggested that it is dispensable for most aspects of Ag receptor gene assembly. However, these cell-based assays are insufficient to probe whether G9a is required for tissue-specific repression of Ig loci in thymocytes or TCR loci in developing B cells.
To test whether repression of TCR gene assembly is compromised in G9a-deficient B cells, we measured products of V(D)J recombination in DNA from bone marrow or splenic B cells. As shown in Fig. 4A, repression of TCR
and TCRβ recombination is maintained in B cells from G9a-deficient mice. Similarly, the loss of G9a fails to induce rearrangement of TCR
or TCR
loci in B cells. Analogous assays were used to probe for loss of tissue-specific Ig gene assembly in G9a-deficient T cells. These sensitive assays fail to detect IgH or IgL gene rearrangements above background levels from contaminating B cells in thymocytes from G9a-deficient mice (Fig. 4B). Although we observed no gross thymocyte developmental defects in G9a-deficient mice (Fig. 2B), it remained possible that cellular selection processes are masking potential rearrangement defects at the endogenous TCRβ locus. To test this possibility, we measured D-to-J rearrangements of Dβ1 and Dβ2 gene segments, which indicate that the initial stage of TCRβ assembly is unaffected by the loss of G9a (Fig. 4B). Likewise, rearrangement of distal (Vβ16), medial (Vβ12), and proximal (Vβ14) Vβ gene segments to Dβ1 remains largely normal upon deletion of G9a (Fig. 4B).
|
Inhibition of Ig
gene assembly in G9a-deficient pre-B cells
In addition to tissue specificity, V(D)J recombination proceeds in a stage-specific manner during lymphocyte development. After IgH gene assembly in pro-B cells, V(D)J recombinase is targeted to the Ig
locus for V
J
rearrangement in pre-B cells. Should a pre-B cell fail to make a productive join on either Ig
allele, recombinase is then retargeted to the Ig
locus. Consistent with ordered Ig gene assembly, histone modification patterns at Ig loci change during the pro-B to pre-B cell transition (18, 38).
One consequence of ordered IgL gene assembly is a preponderance of mouse B cells that express Ig
as their L chain (
90% Ig
, 10% Ig
). In this regard, we noted further skewing of IgL isotypes in G9a
/
serum before or after immunization (Fig. 3B and data not shown). Upon further examination, we found that G9a-deficient mice possess fewer Ig
+ B cells in their spleens (Figs. 5, A and B). This skewing of IgL usage is not simply due to selection in peripheral lymphoid organs because a similar exaggeration of Ig
:Ig
is observed in G9a-deficient bone marrow. Flow cytometry indicated that IgL isotype exclusion remains intact because Ig
+Ig
+ double-expressing cells are absent in G9a
/
animals (Fig. 5A).
|

J
and V
J
joins in purified pro-B, pre-B, and mature B cells from G9a-deficient and control bone marrow. To confirm sorting purities, we measured levels of VH
DHJH and V
J
rearrangements in each cell fraction (Fig. 5D). As expected, VH
DHJH rearrangements are readily detected in pro- and pre-B cells from both genotypes, whereas V
J
recombinations are restricted to pre-B cells. These data indicate that stage-specific restrictions on Ig
are maintained in the absence of G9a. Thus, premature activation of Ig
does not explain the paucity of Ig
-producing cells in mutant mice. In contrast, V
J
rearrangement is consistently reduced
3-fold in G9a-deficient pre-B cells (Fig. 5D).
To extend these findings, we examined the effects of G9a deficiency on recombination of specific V
J
gene segments. The mouse Ig
locus consists of two cassettes with the first encoding a single V
gene segment, V
1, which rearranges to J
1 or J
3 (Fig. 5C). A second cassette contains two V and two J segments (V
2, V
x, J
2, and J
4). The predominant rearrangement in this cassette is V
2
J
2 because V
x rarely rearranges and J
4 lacks a consensus recombination signal sequence (28). To determine the specificity of V
J
rearrangement defects in G9a
/
mice, we performed PCR assays that distinguish V
J
joins in each cassette (V
1
J
1 or V
2
J
2). As shown in Fig. 5D, V
1
J
1 and V
2
J
2 joins are both reduced
3-fold in G9a
/
pre-B cells. These data indicate that G9a potentiates assembly of the entire Ig
locus during B cell development.
The recombination potential of a given gene segment correlates with its germline transcription (39, 40), indicating that shared cis-acting elements regulate chromatin accessibility to transcriptional and recombinational machinery. To investigate accessibility mechanisms at Ig
, we performed assays for germline transcription in pro-B cells isolated from Rag2–/– animals or a mixture of pro-B and pre-B cells (B220+IgM–) from Rag2+/+ mice. These assays revealed a consistent reduction in steady-state levels of germline V
1 and V
2 transcripts in precursors from G9a-deficient animals (Fig. 5E). In contrast, germline transcripts of J
, JH, and J
segments are unaffected by the loss of G9a. These data suggest that reduced Ig
usage results from a V
-specific defect in chromatin accessibility, which inhibits V
J
recombination.
To extend these findings, we performed ChIP analyses on the same cell populations. Consistent with immunoblot analyses of global methylation, H3K9me2 levels are significantly decreased at all IgL loci in G9a-deficient cells (Fig. 5F). Loss of this histone mark alone does not impair V(D)J recombination because similar decreases in H3K9me2 are observed at IgH and Ig
gene segments, which rearranged at wild-type levels. ChIP analyses also revealed a 2- to 3-fold reduction of H3K9 acetylation in G9a
/
pre-B cells at both the V
1 and V
2 segments (Fig. 5F and data not shown). In contrast, H3K9 acetylation of J
1, J
2, and J
segments is comparable in wild-type and G9a-deficient pre-B cells (Fig. 5F and data not shown). We conclude that Ig
gene assembly is inhibited in G9a-deficient pre-B cells due to altered patterns of epigenetic modifications at V
segments, leading to decreased chromatin accessibility.
| Discussion |
|---|
|
|
|---|
gene assembly in G9a-deficient pre-B cells is decreased, resulting in reduced surface expression and serum levels of this IgL isotype. These data provide the first evidence that G9a-mediated modification of H3K9 controls Ag receptor gene assembly via either direct or indirect mechanisms. Our biochemical analyses indicate an 80% reduction in global levels of H3K9me2 upon deletion of G9a in pre-B cells. Thus, similar to ES cells, G9a serves as the major H3K9 dimethyltransferase in B lymphocytes (7). We cannot draw an analogous conclusion regarding T cells due to persistent G9a expression following Cre-mediated deletion. Notwithstanding, residual levels of H3K9me2 in lymphocytes from both mutant animals may result from methylation by a compensatory HMT. In this regard, GLP and G9a form heterodimers to cooperatively dimethylate H3K9 (9). However, our observations that global H3K9me2 is reduced in the absence of G9a would indicate that GLP cannot fully substitute for G9a in developing B cells.
Prior studies have shown that significant loss of H3K9me2 during embryonic development is lethal (7), suggesting an important role for G9a in many cellular processes. Therefore, it was surprising that B cell development proceeded unperturbed upon the concomitant loss of G9a and H3K9me2. These findings can be interpreted in several ways, including: 1) H3K9me2 is dispensable in the B lineage and/or other differentiated cells; 2) B cells require minimal levels of H3K9me2; or 3) H3K9me3, which is unaffected by G9a deficiency, compensates for many H3K9me2 functions in differentiated cells. In contrast to developmental processes, we found that BCR-mediated activation of mature B cells is compromised upon loss of G9a. However, general cell division is unaffected by G9a deficiency because mutant B cells respond normally to CD40 cross-linking. More likely, G9a regulates a cohort of genes that are unique to the BCR signaling pathway. Future studies will establish G9a-dependent expression programs that fall under BCR control.
Although G9a-deficient B cells undergo class switching to IgG1 and IgE upon stimulation with LPS and IL-4, these two Ig isotypes are significantly decreased in culture supernatants. However, AID and germline IgG1 expression are unaffected by G9a deficiency, suggesting that attenuated levels of IgG1 and IgE do not result from overt defects in CSR. G9a-deficient B cells exhibit a marked decrease in Blimp-1 and IgJ expression upon LPS + IL-4 stimulation, which correlates with a 2-fold reduction of plasma cells in these cultures. These findings suggest that G9a
/
B cells fail to fully execute the plasma cell differentiation program under certain stimulatory conditions, which likely accounts for the lower levels of secreted IgG1 and IgE in culture supernatants. Future experiments will define the range of gene expression defects in G9a-deficient B cells and identify relevant G9a target genes that guide terminal differentiation to plasma cells.
H3K9 modifications correlate with activation or repression of V(D)J recombination at Ig and TCR loci. Recombinationally active loci are characterized by H3K9ac, whereas inert loci are hypoacetylated and hypermethylated at this residue (18, 19, 34, 41, 42). Moreover, targeting of G9a to chromosomal substrates suppresses V(D)J recombination (20). Despite these data, we show that tissue-/stage-specific assembly of Ag receptor genes is maintained upon loss of H3K9me2. Our findings suggest that the H3K9me3 mark is sufficient to enforce tissue-specific repression of V(D)J recombination either directly or by impeding acetylation at this residue. Consistent with emerging mechanistic models, these data indicate that changes in a single histone modification are insufficient to initiate gene activation or repression. Instead, activation states are determined by the general pattern of histone modifications at the locus (43). Moreover, essential transcription factors that promote chromatin accessibility or induce H3K9ac at Ag receptor loci may not be activated upon G9a deletion. We conclude that tissue- and/or stage-specificity of V(D)J recombination is controlled at many genetic and epigenetic levels beyond the simple acquisition of H3K9me2.
In contrast to tissue-specific control, we found that loss of G9a perturbed IgL usage at the level of V(D)J recombination. Pre-B cells from mutant mice exhibit a 2- to 3-fold reduction in V
J
rearrangement. At face value, our findings are counterintuitive because G9a normally enforces gene repression. However, B cell-specific deletion of a second repressive HMT (Ezh2, H3K27me3) inhibits recombination of VH gene segments (44). In both cases, it remains likely that these HMTs regulate locus recombination via indirect mechanisms. Given the role of G9a in gene repression, we hypothesize that this HMT may normally repress an inhibitor of Ig
locus accessibility. The absence of G9a would lead to enhanced expression of the inhibitor and partial repression of V
J
rearrangement. Alternatively, G9a may function by unknown mechanisms to directly activate a transcription factor that promotes Ig
gene assembly (45).
Regardless of the precise mechanism, our data indicate that G9a regulates Ig
specifically by controlling chromatin accessibility at V
1 and V
2 segments. Loss of G9a significantly reduces germline transcription and H3K9ac at both V
segments while sparing these metrics of open chromatin at J
segments. These data suggest that a V
-specific accessibility control element is regulated by G9a either directly or indirectly. Each V
-J
cluster contains a single known enhancer (E
1–3 and E
2–4), an undefined J
germline promoter, and promoters situated 5' of each V
segment. However, the ACE function and domain of influence for these transcriptional control elements are unknown (1, 46). We suspect that G9a-mediated control of Ig
is independent of known E
enhancers because germline transcription of J segments falls under enhancer control at all other Ig and TCR loci. Instead, we propose that G9a regulates V
promoters in the germline Ig
configuration, perhaps by altering the expression of a cognate promoter factor. However, the functional architecture of V
promoters is very similar to those driving V
and VH expression, suggesting the existence of an unidentified factor specific for V
. The advent of G9a-deficient mice such as those reported here will permit a dissection of mechanisms by which this HMT controls chromatin accessibility at V
segments and thereby maintains a balance of IgL usage in developing B cells.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by National Institutes of Health Grants P01 HL68744 and CA100905 (to E.M.O.) and F32 AI066691-01A1 (to L.R.T.); Cancer Center Support Grant P30 CA68485, Vanderbilt-Ingram Cancer Center (to E.M.O.); a grant-in-aid from the Ministry of Education, Science, Technology, and Culture of Japan (to Y.S. and M.T.); the 21st Century Center of Excellence Program of the Ministry of Education, Culture, Sports, Science, Technology to the Graduate School of Biostudies (to H.M.); and Deutsche Forschungsgemeinschaft Grant SFB620, Teilprojekte B5 (to M.R.). ![]()
2 Address correspondence and reprint requests to Dr. Eugene M. Oltz, Department of Microbiology and Immunology, Vanderbilt University School of Medicine, 1161 21st Avenue South, Nashville, TN 37232. E-mail address: eugene.oltz{at}vanderbilt.edu ![]()
3 Abbreviations used in this paper: H3K9, histone 3 lysine 9; H3K9me1, me2, and me3, mono-, di-, and trimethylated forms of H3K9; HMT, histone methyltransferase; AID, activation-induced deaminase; CSR, class switch recombination; ChIP, chromatin immunoprecipitation; KLH, keyhole limpet hemocyanin; ES cells, embryonic stem cells; H3K9ac, acetylated H3K9. ![]()
Received for publication September 4, 2007. Accepted for publication April 16, 2008.
| References |
|---|
|
|
|---|
gene recombination by transcription. Nat. Immunol. 7: 1109-1115. [Medline]
locus correlates with transcription of the unrearranged genes. J. Exp. Med. 177: 729-739.
, and
rearrangements during adult thymic development: T cell receptor rearrangements are present in Cd44+Cd25+ pro-T thymocytes. Proc. Natl. Acad. Sci. USA 95: 12522-12527.
B regulates Ig
light chain gene rearrangement. J. Immunol. 167: 264-269.
immunoglobulin light-chain locus: Nf-
b-dependent and -independent pathways of activation. Mol. Cell. Biol. 17: 3477-3487. [Abstract]
globulinemia and macrophage activation by silicone gels and oils in female A.SW mice. Clin. Diag. Lab. Immunol. 7: 366-370.
locus: sequence of the initiation region and comparison of activity with a rearranged V
-C
gene. Cell 27: 593-602. [Medline]
are associated with transcription elongation through mammalian chromatin. Mol. Cell 19: 381-391. [Medline]This article has been cited by other articles:
![]() |
F. L. Kuang, Z. Luo, and M. D. Scharff H3 trimethyl K9 and H3 acetyl K9 chromatin modifications are associated with class switch recombination PNAS, March 31, 2009; 106(13): 5288 - 5293. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |