|
|
||||||||



* Division of Immunology and
Division of Experimental Animal Pathology, The Netherlands Cancer Institute, Amsterdam, The Netherlands; and
Center for Cell and Gene Therapy, Baylor College of Medicine, Houston, TX 77030
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
In addition to treatment protocols involving allogeneic T cell transfer, an increasing effort is made to produce autologous tumor-reactive T cells for T cell therapy. In case of melanoma, infusion of ex vivo expanded tumor-infiltrating lymphocytes has shown considerable promise (2, 3). Furthermore, by introduction of TCR or chimeric receptors (CR) that target tumor-associated self-Ags, a high-avidity tumor-reactive T cell repertoire may also be created for other tumor types (4, 5, 6). These different types of autologous T cell products also have the potential to cause autoimmunity, due to either (on-target) recognition of the intended self-Ag on other tissues, or due to the (off-target) recognition of other self Ags (7, 8). Consequently, the pharmacological control of the in vivo survival of infused autologous T cell products may in certain cases also be desirable.
The most extensively studied safety-switch to date is the HSV I-derived thymidine kinase (HSV-TK) gene product. The HSV-TK safety switch has been shown to be effective in patients who developed GvHD after DLI (9, 10) and these studies provide the first proof of principle that a safety-switch can be effective in the clinical management of GvHD. Despite this, the HSV-TK safety switch has a number of limitations. First, the toxicity of the HSV-TK gene product is based on the enzymatic production of the toxic metabolite ganciclovir triphosphate upon administration of ganciclovir. However, ganciclovir is also frequently used to treat CMV infections in patients who undergo allogeneic stem cell transplantation (allo-SCT), resulting in an unwanted elimination of the genetically modified cells. More importantly, unwanted elimination of the transferred T cells as a consequence of immune responses toward the HSV-TK gene product has been observed in a substantial fraction of patients, likely limiting the use of this safety switch to patients who are immune suppressed at the time of T cell infusion (11, 12). As a first possible nonimmunogenic alternative safety switch, a human CD20 molecule has been validated in preclinical studies (13, 14). Exposure of patients to anti-CD20 mAb could then be used to induce killing of T cells that express this safety switch, but would in clinical practice also lead to an unwanted and prolonged loss of B cells.
As a second, nonimmunogenic safety switch system for clinical use, fusion proteins composed of human proapoptotic molecules linked to modified human FK506-binding proteins (FKBPF36V) have been developed. These safety switches can be activated by injection of a chemical inducer of dimerization (CID), consisting of a dimer of two synthetic variants of FK506. The CID is lipid-permeable and binds at subnanomolar concentrations to FKBPF36V domains, while the affinity for endogenous FKBP is 1000-fold lower (15). Binding of the CID leads to clustering of the linked proapoptotic molecules and thereby induces their activation. A safety switch based on this design and consisting of a modified human caspase 9 molecule fused to FKBPF36V (iCasp9M) has shown substantial potential, with elimination of 99% of T cells expressing high levels of this iCasp9M safety switch by a single dose of the CID (16). Because the iCasp9M safety switch is fully composed of human sequences, immunogenicity of this safety switch is likely to be minimal. In addition, contrary to safety switches that rely on upstream apoptosis initiators, the caspase 9-based suicide switch should be relatively insensitive to alterations in the expression levels of cellular inhibitors of apoptosis. In line with this, the iCasp9M safety switch is functional in a T cell line expressing high levels of c-FLIP and Bcl-xL, whereas the function of a Fas-based safety switch is blocked in these cells (16). Because of these reasons, the iCasp9M safety switch appears an attractive candidate for the pharmacological control of infused T cell populations. However, its effectiveness in the amelioration or blockade of cell therapy-induced autoimmune pathology has not been determined.
In this study, we aimed to test the value of the pharmacologically inducible caspase 9 (iCaspase9)-based safety switch to control cell therapy-induced autoimmunity, using a mouse model for severe and acute autoimmune diabetes. In this model, we show that autoreactive T cells containing the iCasp9M safety switch can be rapidly eliminated in vivo. This blockade of an ongoing autoimmune attack suffices to halt the development of an otherwise lethal type I diabetes.
| Materials and Methods |
|---|
|
|
|---|
C57BL/6 (B6), RIP-OVAhigh mice (17), and F1 offspring of Ly5.1+C57BL/6 with OT-I mice were obtained from the Experimental Animal Department of The Netherlands Cancer Institute. All animal experiments were performed in accordance with institutional and national guidelines and were approved by the Experimental Animal Committee of The Netherlands Cancer Institute.
Retroviral constructs and retroviral transduction of T cells
The iCasp9M safety switch (16) and enhanced GFP (eGFP) genes, separated by an internal ribosomal entry sequence (IRES) were cloned into the pMX retroviral vector (18) to obtain pMX-iCasp9M-IRES-GFP. As a control, a pMX vector solely containing the eGFP gene was used (pMX-GFP). B6 splenocytes were modified by retroviral transduction as described previously (19). For transduction of Ly5.1+ OT-I T cells, a modified protocol was used in which splenocyte cultures of OT-I TCR-transgenic mice were supplemented with 5–10% purified CD4+ cells to enhance transduction efficiencies (our unpublished observations). To this purpose, spleens from RIP-OVAhigh mice (that lack detectable OVA-specific CD8+ T cells) were harvested and leukocytes were purified over a Lympholyte-M (Cedarlane Laboratories) gradient. Splenocytes (5 x 107/ml) were incubated with PE-labeled anti-CD4 (1 µg/ml; BD Pharmingen) for 20 min at room temperature in complete medium (IMDM; Invitrogen Life Technologies) supplemented with 8% FCS, 10 µM 2-ME, and 100 U/ml penicillin, 100 µg/ml streptomycin). Cells were washed and incubated with anti-PE beads (Miltenyi Biotec) according to the manufacturers protocol. Positive selection was performed by autoMACS (Miltenyi Biotec) according to the manufacturers guidelines. Following addition of purified CD4+ cells to the Ly5.1+ OT-I T cells, retroviral transduction was performed as described (19).
Flow cytometry
Transduction efficiency was measured 24 h after transduction by flow cytometric analysis of GFP expression within the CD8+ cell population. For the measurement of T cell responses, peripheral blood samples were taken at the indicated days posttransfer and treated as previously described (4). Samples were stained with anti-CD8
mAbs (PE or allophycocyanin conjugated), when necessary in combination with PE-conjugated anti-Ly5.1 mAb (all mAbs obtained from BD Pharmingen) and analyzed by flow cytometry. Propidium iodide (Sigma-Aldrich) was used to select for live cells. Data acquisition and analysis was done on a FACSCalibur (BD Biosciences) with CellQuest Pro software. For isolation of GFP+CD8+ T cells, retrovirally transduced splenocytes (50 x 106/ml) were stained with PE-labeled anti-CD8 (0.4 µg/ml; BD Pharmingen). Cells were subsequently sorted on a FACS Aria (BD Biosciences) (filter for GFP 585/30 nm; filter for PE 585/42 nm) using DiVa Software. In each experiment a postsort analysis was performed and
95% of the sorted population was GFPbright.
Induction and analysis of apoptosis
For in vitro experiments, CID (AP20187; ARIAD Pharmaceuticals) was added to transduced splenocytes at the indicated concentrations. In vitro depletion of transduced T cells was determined by flow cytometric analysis of GFP expression in CD8+ cells 24 h post-CID administration. For in vivo experiments, 50 µg of CID diluted in 200 µl of carrier solution (22.5% PEG400, 1.25% Tween 80) was injected once i.p. at the indicated day post-cell transfer. In vivo depletion of transduced T cells was determined by flow cytometric analysis of GFP expression in CD8+ cells in peripheral blood samples at the indicated time points post-cell transfer.
In vivo assessment of the iCaspase9 suicide switch
In cell transfer experiments, indicated numbers of Ly5.1+, OT-I T cells were adoptively transferred into RIP-OVAhigh mice. Mice were subsequently vaccinated either by i.p. administration of 1 x 106 PFU of rVV-OVA, a recombinant vaccinia strain that expresses OVA (20) or by intranasal administration of 1000 PFU of influenza A/WSN/33 (WSN)-OVA(I) (21). Alternatively, mice underwent irradiation-induced host conditioning by 5 Gy total body irradiation with a radiobiology constant potential x-ray unit (Pantak HF-320; Pantak Limited), 1 day before adoptive cell transfer. To create a more proinflammatory environment, mice were s.c. injected with 20 µg of CpG (oligodeoxynucleotide (ODN)) 1826, a 20-mer containing two CpG motifs (TTCATGACGTTCCTGACGTT), at the indicated time point. Where indicated, blood glucose levels were monitored by Accu-Check Compact (Roche Diagnostics) measurement. Mice were considered diabetic when blood glucose levels were
20 mM/L. The severity of diabetes was determined by the extent of weight loss. Diabetic mice were either sacrificed when experiencing a weight loss of
5 g of their initial body weight, when mice became subconscious, or when mice displayed clinical signs of severe discomfort such as a hunched back and reduced activity.
Immunohistochemistry (IHC)
IHC was conducted on pancreata sampled in buffered formalin. For Ag retrieval, sections were pretreated with 0.1 M citrate (pH 6.0; 95–100°C). Endogenous peroxidases were inactivated by incubation with 3% H2O2 in methanol. Sections were preincubated with PBS/4% BSA/5% normal goat serum. As a primary Ab, rabbit anti-murine CD3 (clone, SP7; 1/50 dilution; Neomarkers) was used. Anti-CD3 staining was visualized by a three-step immunoenzymatic procedure. First, biotin labeled goat-anti-rabbit Igs (1/1000 dilution; DakoCytomation) were applied, followed by HRP-labeled avidin-biotin complex (ABC; DakoCytomation). Finally, 3,3-diaminobenzidine-tetrahydrochoride (Sigma-Aldrich) was used as a substrate chromagen and slides were counterstained with hematoxylin. Images were acquired using an Axiocam HR digital camera and processed with Axiovision 4 software (Carl Zeiss Vision).
| Results |
|---|
|
|
|---|
The iCasp9M safety switch consists of a modified human caspase 9 molecule of which the caspase recruitment domain is removed to prevent physiological dimerization. This truncated caspase 9 molecule is genetically coupled to a modified FKBP (FKBPF36V). Upon administration of a bivalent ligand of FKBPF36V, dimers of the caspase9-FKBPF36V fusion protein are formed, leading to caspase 9 activation (16). To address whether iCasp9M can function as a conditional apoptotic switch in murine T cells, splenocytes were retrovirally transduced with a vector encoding the iCasp9M safety switch plus a GFP reporter. Control cells were transduced with a retrovirus encoding GFP only. Twenty-four hours after transduction, 19.3% of CD8+ cells transduced with iCasp9M retrovirus showed high GFP expression (Fig. 1A, middle panel) and 28.4% of CD8+ cells transduced with the control retrovirus showed high GFP expression (Fig. 1A, right panel). To determine the sensitivity of murine T cells for triggering of the iCasp9M safety switch, the retrovirally transduced splenocytes were cultured for 24 h in presence of CID at various concentrations (range 0–100 nM). Subsequently, the percentage of GFP-expressing cells was calculated by comparing GFP expression in cultures exposed to CID to that in cultures not exposed to CID (Fig. 1B). As is the case for human T cells (16), a single administration of CID at
1 nM results in the elimination of
98% of the iCasp9-GFPbright cells within 24 h (Fig. 1C). The percentage of GFP-expressing cells in cultures transduced with the GFP control construct was unaffected by increasing doses of CID, demonstrating that the elimination of GFPbright cells is due to the induced dimerization of the modified caspase 9 molecules and not by some unrelated toxicity of the CID itself. Notably, iCasp9M-IRES-GFP-transduced T cells expressing intermediate levels of GFP are only moderately sensitive to CID administration, indicating that a critical expression level of iCaspase9 is required for the induction of apoptosis (16).
|
RIP-OVAhigh mice express OVA in the insulin-producing β-cells of the pancreas. Whereas the endogenous T cell repertoire is immune tolerant for OVA (4), adoptive transfer of T cells expressing the OT-I TCR that recognizes the class I-restricted epitope OVA257–264 followed by vaccination leads to destruction of the β cells, resulting in a severe form of autoimmune diabetes (4, 17). The induction of diabetes in this model is extremely rapid, with blood glucose levels changing from normoglycemic into >20 mM/L within 24 h. Development of diabetes results in a weight loss of >1 g (>5%) in the same time span and death within <1 wk after disease onset if mice are left untreated. To assess whether T cells that express high levels of the conditional safety switch are functional in vivo, Ly5.1+ OT-I TCR-transgenic T cells were retrovirally transduced with the iCasp9M safety switch, sorted 24 h posttransduction for GFP expression and transferred into Ly5.1–RIP-OVAhigh recipients. Subsequently, the mice were vaccinated with a recombinant influenza strain expressing OVA (inflova). Analysis of peripheral blood samples revealed that Ag-specific T cells that express the iCasp9M safety switch do proliferate upon Ag encounter in vivo (Fig. 2A). Importantly, during this Ag-driven proliferation, there was no evidence of preferential outgrowth of either GFPdull or GFP-negative Ly5.1+ cells (Fig. 2B). This indicates that during a physiological in vivo T cell response, the iCasp9M safety switch shows no basal toxicity. Consistent with this, recipients of iCasp9M modified T cells all became diabetic within 2 wk post-T cell infusion (Fig. 2C).
|
Having established that mouse T cells expressing the iCasp9M safety switch proliferate upon Ag encounter in vivo and perform effector functions, we wished to determine whether the activity of iCasp9M-modified T cells can be halted by CID administration. To first develop a preclinical parameter that would report on an ongoing autoimmune attack, we analyzed whether the presence of OT-I T cells in peripheral blood samples can be used as a measure of an ongoing autoimmune attack within the islets of Langerhans. To this purpose, RIP-OVAhigh mice received an adoptive transfer of 5 x 104 Ly5.1+OT-I T cells, followed by vaccination with rVV-OVA. Control mice were only vaccinated. To determine the percentage of OT-I T cells and blood glucose levels, blood was sampled daily from day 3 on. Mice were killed to harvest pancreatic tissue for IHC when OT-I cells could first be detected in peripheral blood, but blood glucose levels were still normal. In four of four recipients of OT-I T cells with detectable OT-I T cell responses in peripheral blood (average T cell response of 2.7%), a clear infiltrate of CD3+ cells could be detected by IHC in the islets of Langerhans. As a control, no CD3+ cells could be detected in pancreatic sections of mice that had not received OT-I T cells (Fig. 3, Table I). Furthermore, in line with the fact that mice are still normoglycemic when OT-I T cell responses are first detected in peripheral blood, the majority of β cells in sections of these mice are still intact (Fig. 3). Notably, recipients of OT-I T cells that were not sacrificed at the time point at which OT-I T cell responses became detectable in peripheral blood all became diabetic within 24 h after the first detection of Ag-specific T cells (Table I). In pancreatic sections of these mice, a dense infiltrate of CD3+ T cells was apparent throughout the whole islet (Fig. 3, Table I). These data indicate that the detection of OT-I T cells in peripheral blood can be used as a diagnostic indicator for an ongoing but incomplete β cell attack, thereby allowing one to determine the feasibility of halting such an attack by activation of a conditional safety switch. Importantly, as clinically manifest diabetes occurs within 24 h after the first detection of OT-I T cells in peripheral blood (Table I), the result of such an activation needs to be swift.
|
|
85% reduction in the number of GFP+Ly5.1+ T cells as compared with untreated mice (average T cell responses of 1.3 and 8.2% at day 7 posttransfer). The remaining Ly5.1+ population displayed low to intermediate expression of the GFP marker gene, also demonstrating that in vivo, a threshold of iCasp9M expression is required to render T cells sensitive to CID administration (Fig. 4, B and C). Indeed, when gated on GFPbright cells, in vivo depletion of the adoptively transferred cells was close to complete (
98%, average T cell responses of 0.12 and 5.4% at day 7 posttransfer; Fig. 4, B and C). A similar efficiency of elimination of adoptively transferred cells was also seen when mice were treated after having already reached the diabetic state (data not shown).
|
|
In clinical trials of adoptive T cell therapy (ACT) (23), (non)myeloablative irradiation or chemotherapy rather than vaccination is often used to promote engraftment of the infused T cells. Due to the fact that vaccination- and lymphopenia-induced T cell proliferation are driven by distinct mechanisms, the resultant T cell populations show clear differences with respect to both functional properties and persistence. Specifically, while vaccination results in the rapid emergence of a highly differentiated pool of effector T cells (24), T cell populations induced by host conditioning display properties of memory T cells (25), translating into an enhanced capacity for long-term persistence. Consistent with the less differentiated state of T cell populations generated through lymphopenia-induced proliferation, ACT with OT-I T cells rarely leads to the induction of type I diabetes in RIP-OVAhigh mice (data not shown).
To test whether triggering of the iCasp9 M safety switch can also be used to halt lymphopenia-induced T cell expansion, RIP-OVAhigh recipients were irradiated and then received 1 x 105 Ly5.1+ iCasp9M-bright OT-I T cells. At day 6 post transfer, mice either received the chemical inducer of dimerization or were left untreated. In all recipients of the CID a marked and rapid reduction in the percentage of GFP+, Ly5.1+ OT-I T cells was observed as compared with untreated mice (average T cell responses of 7.6% and 25.5% at day 10 post transfer; Fig. 6, top panel). Furthermore, the reduction in GFPbright T cell numbers was close to complete (
97%, average T cell responses of 0.3% and 10.6% at day 10 post transfer; Fig. 6, bottom panel). Importantly, this single administration was sufficient to maintain OT-I T cell responses at this low level throughout the course of the experiment. These data indicate that the iCasp9M safety switch can also be used to significantly reduce lymphopenia-induced T cell responses.
|
| Discussion |
|---|
|
|
|---|
A second form of ACT in which the inclusion of safety switch systems may be of value involves the transfer of autologous gene-modified T cells. Such gene modification may either involve the introduction of chimeric receptor genes or full-length TCR genes, with the aim to convey tumor specificity onto the genetically modified T cell population. Several scenarios in which TCR- or CR-modified T cells can induce autoimmunity by recognition of self-Ags on healthy tissue are conceivable (8). First, TCR gene transfer may result in recognition of unknown self-peptide MHC complexes (self-pMHC), for instance through the formation of mixed dimers of endogenous and exogenous TCR chains, or by activation of ignorant self-reactive T cells. Although this type of "off-target" autoimmunity has not been seen in mouse studies (4) or in a first clinical trial in melanoma patients (5), this clearly does not exclude the possibility that such side effects will occur when other TCRs are used, or when conditioning regimens or adjuvant treatments are modified. In addition to these off-target effects, the potential occurrence of on-target autoimmunity by CR- or TCR-modified T cells may be a reason for concern, in particular for target Ags that are also expressed in vital tissues (28, 29).
Safety switch systems such as HSV-TK, CD20, Myc-tagged transgenes, and iCasp9M (9, 13, 16, 30) that can be used for the conditional elimination of infused T lymphocytes in either of the above clinical settings should meet three conditions. First implementation of the system in a clinical setting should be readily feasible. Second, introduction of the safety switch should have no deleterious effect on the function or survival of the infused cell product. Third, upon triggering, the elimination of the safety switch-expressing cells should be rapid, efficient, and selective.
With regard to the implementation in a clinical setting, the generation of cells that show uniform expression of the safety switch will be essential for most if not all clinical applications of genetically encoded safety switch systems. Furthermore, such expression may need to exceed a certain threshold level, as is the case for iCasp9M-induced apoptosis and also for complement-directed cytotoxicity via CD20 (31). It is noted that even though transduced T cells were sorted for GFPbright expression in the current experiments (Fig. 4A), Ly5.1+GFPdull cells were apparent in peripheral blood, and these cells were refractory to CID treatment (Fig. 4B). Interestingly, the presence of this CID-resistant population did not result in lethal diabetes, even when mice were challenged with CpGs 2 wk post-CID infusion. The absence of diabetes despite the presence of a residual population of infused T cells may form a reflection of the fact that development of diabetes in this model is cell dose dependent (32). In addition, it seems possible that the CID-resistant population is enriched in quiescent T cells. Prior studies have demonstrated that long terminal repeat-driven transgene expression in retrovirally modified T cells is decreased in quiescent cells (33, 34) and analysis of ex vivo blood samples indicates that the average forward and sideward scatter of GFPbright cells is indeed larger than that of GFPdull cells (p < 0.005 for both parameters; data not shown). It may therefore be useful to determine whether the presence of such marker-genedull populations upon ACT can be reduced by inclusion of gene elements that promote maintenance of transgene expression in quiescent cells (35).
Although the CD20 and Myc-tagged systems inherently offer the possibility for the selection of gene-modified cells on magnetic bead-based systems, for the iCasp9M system such selection will require the additional incorporation of a nonimmunogenic marker gene such as the truncated nerve growth factor receptor (36). In particular for obtaining the required cell doses for clinical application, inclusion of such a marker gene does seem an essential next step.
With regard to the second issue, the effect of safety switch expression on the function and survival of the infused cell product; the current data show that introduction of the iCasp9M safety switch has no detectable effect on the in vivo potential of the gene-modified cells in a murine model system. Furthermore, immunogenicity of the gene-modified cells is likely to be minimal, because of the lack of substantial amounts of nonhuman sequence. This offers a substantial advantage over the HSV-TK system, where the survival of gene-modified cells may be limited due the immunogenicity of the HSV-TK gene product (11), and where ganciclovir treatment of CMV infection can also lead to the untimely elimination of the infused cell population.
Finally, with regard to the speed, effectiveness, and selectivity of the different safety switch systems: while anti-CD20 treatment leads to a prolonged depletion of B cells up to 6 mo (37), administration of CID has no detrimental effects other than on the targeted gene-modified cells. Furthermore, while the effectiveness of all four systems is likely to be comparable, T cell depletion via iCasp9M may be somewhat more rapid due to the direct activation of an effector caspase. If such a difference in kinetics can be confirmed in a direct comparison, this may be considered an advantage in settings where a rapid elimination of the infused cell population is required.
In summary, this study has demonstrated in a murine in vivo model that a conditional caspase 9-based safety switch is effective and rapid, and that the triggering of this switch can stall an ongoing autoimmune attack that is lethal if untreated. Provided that genetically modified cells with a homogeneous and high iCasp9M can readily be generated or selected, these properties, combined with the high selectivity and low immunogenicity of this system, form a clear incentive to use this safety switch in clinical trials.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by the European Union FP6 Program ATTACK and Koningin Wilhelmina Fonds Grant 2003-2860. ![]()
2 M.A.d.W. and A.J. contributed equally to this work. ![]()
3 Address correspondence and reprint requests to Prof. Ton N. M. Schumacher, Division of Immunology, The Netherlands Cancer Institute, Plesmanlaan 121, 1066 CX, Amsterdam, The Netherlands. E-mail address: t.schumacher{at}nki.nl ![]()
4 Abbreviations used in this paper: DLI, donor lymphocyte infusion; GvL, graft-vs-leukemia; GvHD, graft-vs-host disease; CR, chimeric receptor; TK, thymidine kinase; allo-SCT, allogeneic stem cell transplantation; CID, chemical inducer of dimerization; FKBP, FK506-binding protein; IRES, internal ribosomal entry site; iCaspase9, inducible caspase 9; ODN, oligodeoxynucleotide; IHC, immunohistochemistry; ACT, adoptive T cell therapy. ![]()
Received for publication May 4, 2007. Accepted for publication March 3, 2008.
| References |
|---|
|
|
|---|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |