The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


The Journal of Immunology, 2008, 180, 6199 -6210
Copyright © 2008 by The American Association of Immunologists, Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Baritaki, S.
Right arrow Articles by Bonavida, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Baritaki, S.
Right arrow Articles by Bonavida, B.

Inhibition of Yin Yang 1-Dependent Repressor Activity of DR5 Transcription and Expression by the Novel Proteasome Inhibitor NPI-0052 Contributes to its TRAIL-Enhanced Apoptosis in Cancer Cells1

Stavroula Baritaki2,*, Eriko Suzuki2,*,{ddagger}, Kazuo Umezawa{ddagger}, Demetrios A. Spandidos§, James Berenson, Tracy R. Daniels{dagger}, Manuel L. Penichet*,{dagger}, Ali R. Jazirehi*, Michael Palladino|| and Benjamin Bonavida3,*

* Department of Microbiology, Immunology, and Molecular Genetics and {dagger} Department of Surgery, Division of Surgical Oncology, David Geffen School of Medicine, Johnson Comprehensive Cancer Center, University of California, Los Angeles, CA 90095; {ddagger} Department of Applied Chemistry, Keio University, Yokohama, Japan; § Department of Clinical Virology, Faculty of Medicine, University of Crete, Heraklion, Greece; Institute for Myeloma and Bone Cancer Research, West Hollywood, CA 90069; and || Nereus Pharmaceuticals, Inc., San Diego, CA 92121


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
TRAIL promotes apoptotic tumor cell death; however, TRAIL-resistant tumors need to be sensitized to reverse resistance. Proteasome inhibitors potentiate TRAIL apoptosis in vitro and in vivo and correlate with up-regulation of death receptor 5 (DR5) via an unknown mechanism. We hypothesized that the proteasome inhibitor NPI-0052 inhibits the transcription repressor Yin Yang 1 (YY1) which regulates TRAIL resistance and negatively regulates DR5 transcription. Treatment of PC-3 and Ramos cells with NPI-0052 (≤2.5 nM) and TRAIL sensitizes the tumor cells to TRAIL-induced apoptosis. By comparison to bortezomib, a 400-fold less concentration of NPI-0052 was used. NPI-0052 up-regulated DR5 reporter activity and both surface and total DR5 protein expression. NPI-0052-induced inhibition of NF-{kappa}B activity was involved in TRAIL sensitization as corroborated by the use of the NF-{kappa}B inhibitor dehydroxymethylepoxyquinomicin. NPI-0052 inhibited YY1 promoter activity as well as both YY1 mRNA and protein expression. The direct role of NPI-0052-induced inhibition of YY1 and up-regulation of DR5 in the regulation of TRAIL sensitivity was demonstrated by the use of YY1 small interfering RNA. The NPI-0052-induced sensitization to TRAIL involved activation of the intrinsic apoptotic pathway and dysregulation of genes that regulate apoptosis. The NPI-0052 concentrations used for TRAIL sensitization were not toxic to human hematopoetic stem cells. The present findings demonstrate, for the first time, the potential mechanism by which a proteasome inhibitor, like NPI-0052, inhibits the transcription repressor YY1 involved in TRAIL resistance and DR5 regulation. The findings also suggest the therapeutic application of subtoxic NPI-0052 concentrations in combination with TRAIL/agonist DR4/DR5 mAbs in the treatment of TRAIL-resistant tumors.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Conventional treatment for the majority of cancers consists of surgery, chemotherapy, radiation, hormonal therapy, and immunotherapy. However, many patients experience recurrences and relapses and develop tumor cross-resistance to the above cytotoxic and apoptotic therapies, and tumor cells often develop mechanisms to evade apoptosis-inducing stimuli. For instance, tumor cells exhibit constitutively hyperactivated cell survival pathways that regulate cell proliferation and several antiapoptotic gene products. The NF-{kappa}B signaling pathway regulates cell survival and is activated in many cancers. It regulates the transcription of many apoptotic gene products including an X-linked inhibitor of apoptosis (XIAP),4 inhibitors of apoptosis proteins (IAPs), and Bcl-2 family members (1). Inhibition of the NF-{kappa}B pathway or inhibition of the above antiapoptotic gene products can overcome tumor cell resistance to chemotherapy and immunotherapy and, thus, proteasome inhibitors have been considered as anticancer therapeutic agents.

The 26S proteasome is a multifunctional proteolytic complex that plays critical roles in cell cycle regulation and apoptosis by mediating the degradation of ubiquitinylated target proteins that include p21, p53, members of the Bcl-2 family, and the inhibitor of NF-{kappa}B I{kappa}B{alpha} (2) and augments cancer cell response to chemotherapy and radiation (3, 4). Bortezomib (PS-341, Velcade; Millenium Pharmaceuticals), a synthetic reversible peptide boronate inhibitor of the proteasome chymotrypsin-like (CT-L) and caspase-like proteolytic activities, was the first proteasome inhibitor evaluated in clinical trials for cancer treatment and the only such agent that has been approved by the Food and Drug Administration for clinical use in multiple myeloma (MM) with objective response rates up to 35% (2, 5). This was the result, in part, of bortezomib-mediated inhibition of NF-{kappa}B and expression of genes involved in cancer cell survival such as Bcl-2 family members (2).

NPI-0052 (salinosporamide A), is a novel nonpeptide, marine-derived proteasome inhibitor shown to display irreversible inhibition of all three enzymatic activities (CT-L, trypsin-like, and caspase-like) of the 20S proteasome core (6, 7). NPI-0052 targets CT-L and trypsin-like proteolytic activity at lower concentrations than bortezomib; however, higher concentrations are required for inhibition of C-L which is predominantly affected by bortezomib (8). Recent findings demonstrate that NPI-0052 is a potent, orally active proteasome inhibitor with unique pharmacogenic properties that can achieve high levels of proteasome inhibition in vivo and is also well tolerated (8). It is also an effective anticancer agent that synergizes with various drugs in the treatment of various tumors such as colon cancer in a preclinical animal model (9).

TRAIL (Apo-2L) is a type II transmembrane protein and induces cell death by apoptosis in a variety of tumor cell lines, but fails to induce apoptosis in nontransformed normal cells (10). TRAIL induces apoptosis by interacting with two death receptors, death receptor (DR) 4 and DR5 (10). This has led to the potential of TRAIL as an effective anticancer therapy (11). In addition, Abs directed against TRAIL death receptors DR4 and DR5 are in clinical trials for a variety of cancers (12). There are several reports indicating a synergistic apoptotic response achieved by the combination of TRAIL with chemotherapeutic drugs (13, 14). Increased apoptotic rates in a variety of cancer cell lines have also been reported after the combination of TRAIL with proteasome inhibitors resulting by augmentation of DR5 protein levels (15, 16, 17, 18, 19, 20, 21, 22, 23). Although the role of DR5 up-regulation and involvement in TRAIL-induced sensitization to apoptosis by proteasome inhibitors is well documented, the mechanism by which DR5 is up-regulated is not known and is the subject of the present investigation.

In this study, we examined the mechanism of NPI-0052-induced reversal of tumor resistance to TRAIL and the concomitant up-regulation of DR5 expression. Our recent findings demonstrated that inhibition of NF-{kappa}B by various chemotherapeutic drugs or by the NO donor DETANONOate resulted in the sensitization of TRAIL-resistant tumor cells to TRAIL-mediated apoptosis (24, 25). The inhibition of NF-{kappa}B was concomitant with the inhibition of the transcription repressor Yin Yang 1 (YY1), which has been shown to be regulated by NF-{kappa}B (26) and it negatively regulates DR5 transcription and expression. Because proteasome inhibitors inhibit NF-{kappa}B, we hypothesized that treatment of TRAIL-resistant tumor cells with the novel proteasome inhibitor NPI-0052 will sensitize the tumor cells to TRAIL-mediated apoptosis via inhibition of YY1 and modulation of gene products regulating apoptosis and up-regulation of DR5 expression. The present study was designed to test this hypothesis. We chose the PC-3 human prostate carcinoma cell line and the Ramos B-NHL cell line as models for investigation. The following were examined: 1) Does NPI-0052 sensitize PC-3 and Ramos cells to TRAIL-induced apoptosis? 2) Does NPI-0052-induced sensitization correlate with up-regulation of DR5 transcription and expression? 3) Does NPI-0052 induce inhibition of YY1 expression and activity? 4) Is NPI-0052-induced inhibition of YY1 responsible for DR5 up-regulation and does inhibition of YY1 mimic NPI-0052-induced DR5 up-regulation and cell sensitization to TRAIL? 5) Does NPI-0052-induced sensitization to TRAIL involve the activation of the mitochondrial type II apoptotic signaling pathway and regulate antiapoptotic gene products that are involved in TRAIL resistance? and 6) Does NPI-0052 exhibit any toxicity to normal hematopoetic precursor stem cells. The findings, herein, establish for the first time a novel mechanism by which NPI-0052 sensitizes tumor cells to TRAIL apoptosis, which is mediated by NPI-0052-induced inhibition of the DR5 transcription repressor YY1, and leads to up-regulation of DR5 expression and activation of the mitochondrial apoptotic pathway.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Cell lines/reagents

The cancer cell lines PC-3 (metastatic bone-derived human androgen-independent human prostatic adenocarcinoma) and Ramos (human non-Hodgkin’s B cell lymphoma (B-NHL)) were obtained from the American Type Culture Collection and cultured as previously described (24). Frozen human bone marrow mononuclear cells were purchased from Stem Cell Technologies and thawed according to the manufacturer’s instructions. The proteasome inhibitors NPI-0052 and bortezomib were obtained from Nereus Pharmaceuticals and Millennium Pharmaceuticals, respectively. Soluble recombinant human TRAIL was purchased from PeproTech. The NF-{kappa}B inhibitor dehydroxymethylepoxyquinomicin (DHMEQ) was provided by Dr. K. Umezawa (Keio University, Yokohama, Japan) and diluted in DMSO. The Bcl-2 inhibitor 2-methoxyantimycin A3 (2MAM-A3) was obtained from BIOMOL. PE-labeled anti-DR5 and FITC-labeled anti-active caspase-3 Ab as well as the corresponding IgG1 isotype controls were obtained from BD Pharmingen. The polyclonal anti-DR5 and the monoclonal anti-β-actin Abs were purchased from Axxora and Chemicon International, respectively. The monoclonal anti- DcR1, anti-DcR2, anti-DR4, anti-YY1, and anti-Bcl-xL Abs and the polyclonal anti-Bax and HRP-labeled anti-mouse IgG Abs were obtained from Santa Cruz Biotechnology. Small interfering RNA (siRNA) for YY1 and the appropriate transfection reagents were also purchased from Santa Cruz Biotechnology. Polyclonal anti-XIAP, anti-survivin, anti-p65, anti-phospho p65, anti-I{kappa}B{alpha}, anti-phospho I{kappa}B{alpha}, anti-IAP1, and HRP-conjugated anti-rabbit IgG Abs were purchased from Cell Signaling.

Human colony-forming assay

The human colony-forming assay was performed in MethoCult medium as instructed by StemCell Technologies. Cells were plated in quadruplicate (at a density of 20,000 cells per 35-mm dish) in MethoCult GF H4434 (complete methylcellulose medium with recombinant cytokines and erythropoietin). NPI-0052 was tested at 2.5 nM along with either 10 or 5 ng/ml TRAIL. Both compounds were incubated with the bone marrow mononuclear cells simultaneously for the full 14-day incubation period. Nontreated mononuclear cells were used as a negative control. DMSO-alone controls were also tested at an equal volume to the highest concentration tested. After a 14-day incubation at 37°C/5% CO2, the number of CFU-erythroid (CFU-E), burst-forming unit-erythroid (BFU-E), CFU-granulocyte/macrophage (CFU-GM), and CFU-granulocyte/erythrocyte/macrophage/megakaryocyte multilineage colony (CFU-GEMM) was determined using an inverted microscope and the criteria were defined by StemCell Technologies for each colony type.

Transient transfections

Transient transfections with the reporter plasmids pDR5-Luc, pYY1-Luc, or pNF-{kappa}B-Luc were performed in 10- cm2 petri dishes containing exponentially grown PC-3 cells. The luciferase pDR5 and pYY1 constructs carrying the full length of the relevant wild-type promoter sequence were synthesized as previously described (24, 27). The pNF-{kappa}B-Luc plasmid was purchased from Invitrogen. Transfections were performed using the Transfectol Transfection Kit (Gene Choice). Transfection solutions consisted of 1 ml/dish of transfection buffer supplemented with 12.5 µl of Transfectol and 7.5 µg of pYY1-Luc or 12.5 µg of pDR5-Luc or pNF-{kappa}B-Luc DNA plasmids were prepared according to the manufacturer’s instructions. The transfection mix was added to the cells with 4 ml of antibiotic-free cell culture medium for 5 h of incubation followed by replacement with fresh complete growth medium containing various concentrations of NPI-0052 or 10 µg/ml DHMEQ for a further incubation of 20 h. Luciferase activity in protein extracts was measured in an analytical luminescence counter according to the manufacturer’s protocol (BD Biosciences). Data were normalized to protein concentration levels using the Bio-Rad protein assay.

Application of siRNA

Application of siRNA against YY1 in PC-3 and Ramos cells was done as previously described (24, 28).

Determination of apoptosis

Apoptosis was assessed in PC-3 and Ramos cells pretreated for 6 h with different concentrations of either NPI-0052 or bortezomib or DHMEQ (5 or 10 µg/ml) or 2MAM-A3 (15 µg/ml), followed by an 18-h treatment with various concentrations of TRAIL. Apoptosis was determined by cleavage of procaspase 3 using flow cytometry as previously described (24).

Trypan blue exclusion assay

The toxicity of various concentrations of NPI-0052 ranging from 1 to 20 nM was tested on PC-3 and Ramos cells using the trypan blue exclusion assay. The viability or 24-h treated cells was examined after trypan blue staining under the microscope. The viability of the untreated cells was set at 100%. Subtoxic NPI-0052 concentrations were considered the concentrations giving >80% cell viability.

Flow cytometry for evaluation of DR5 expression

PC-3 and Ramos cells treated for 24 h with 1, 2.5, or 5 nM NPI-0052 or cells after transfection and treatment with YY1 siRNA and TRAIL, respectively, were subjected to flow cytometric evaluation of DR5 expression as it has been described previously (24).

Measurement of mitochondrial membrane depolarization

The mitochondria-specific dye 3,3'-dihexyloxacarbocyanine (DiOC6; Molecular Probes) was used to measure the mitochondrial membrane potential in both cells before and after 24 h of treatment with 1 and 2.5 nM NPI-0052, as previously reported (25).

Quantitative real-time PCR (qRT-PCR) analysis

Total RNA was extracted and purified from 1 x 106 PC-3 or Ramos cells treated with 2.5 nM NPI-0052 for 0, 3, 6, 9, 12, and 24 h. Untreated cells served as control. One microgram of total RNA was reversed-transcribed to first-strand cDNA for 1 h at 42°C with 200 U of AMV reverse transcriptase and 20 µM random hexamer primers according to the manufacturer’s instructions (Promega). Transcribed products were subjected to real-time PCR assay with SYBR Green in a programmable thermal controller apparatus (Bio-Rad) for determination of DcR1, DcR2, DR4, DR5, and YY1 mRNA expression. For each target gene, 1.5 µl of 1/5 diluted cDNA was amplified in a total volume of 25 µl containing 1x homemade SYBR Green QPCR Master Mix supplemented with 2.5 mM MgCl2, 0.4 mM dNTPs mix, 30 mM ROX as passive reference dye, and 200 nM of each primer set. GAPDH was used as internal control to normalize target gene mRNA expression levels. All primer pairs were designed to span at least one intron to avoid amplification of contaminating genomic DNA along with cDNA. Primer sequences were as follows: DcR1 forward, GGATCCCCAAGACCCTAAAGTTCG and DcR1 reverse, CGGGCAGTGGTGGCAGAGTAAG (product size: 82 bp); DcR2 forward, ACAGCGTCGGGAACCAGA and DcR2 reverse, CGGACCGGCAGCAGAAC (product size: 86 bp); DR4 forward, GGCAGCTGGACCTCACGAA and DR4 reverse, CATCCCCTGGGCCTGCTGCTGTA (product size: 66 bp); DR5 forward, GCCGCGGTCCTGCTGTTG and DR5 reverse, GGGGCTGGACCTCTTTTGTTG (product size: 102 bp); YY1 forward, GGAATACCTGGCATTGACC and YY1 reverse, TCTTTGTGCAGCCTTTATGAG (product size: 127 bp); and GAPDH forward, GGAAGGTGAAGGTCGGAGTCA and GAPDH reverse, GTCATTGATGGCAACAATATCCACT (product size: 101bp). All reactions were performed in triplicate. The samples were subjected to 42 cycles of amplification comprised of denaturation at 95°C for 30 s, annealing for 30 s at 60°C, and elongation at 72°C for 30 s. After amplification, standard curves were constructed, from samples used in a series of consecutive dilutions, for both the gene of interest and the internal control (GAPDH). Dissociation curves were also performed for all of the tested genes to exclude the presence of by-products or primer-dimer formation. Data were collected during annealing and extension with two measurements at each step and at all times during melting curve analysis. The correct PCR products were further confirmed by analysis on 2% ethidium bromide-stained agarose gels. For all tested samples, the mRNA expression of both the target and the housekeeping gene (GAPDH) was calculated, projecting, with the help of the standard curve, the cycle threshold value of all unknown samples to a relative mRNA quantity. Normalized mRNA values for each target gene were derived by dividing the relative mRNA value of each sample by the corresponding relative quantity of GAPDH mRNA as previously described (29).

Western blot analysis

Total protein extracts derived from cells treated with 2.5 nM NPI-0052 for different time periods were analyzed for YY1, DcR1, DcR2, DR4, and DR5 expression by Western blot. Analysis was done according to our previous studies (24, 25, 28).

Isobologram analysis

This analysis was performed according to the method of Berenbaum (30).

Statistical analysis

Significant differences between values obtained in a population of PC-3 or Ramos cells treated with different experimental conditions were determined by the Mann-Whitney U test. The Kruskal-Wallis H test was also applied to the results obtained as function of drug or TRAIL concentration used as well as to the results from qRT-PCR. For the human colony-forming assay, the mean values were determined from the quadruplicate samples and significant differences were calculated using the Student t test (unpaired samples, unequal variance). Probability was set significant at the level of 0.05. All of the statistical analyses were performed using the SPSS software.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
NPI-0052 sensitizes TRAIL-resistant Ramos B-NHL and PC-3 prostate carcinoma cells to TRAIL-induced apoptosis

The prostate carcinoma cell line PC-3 and the Ramos B-NHL cells were treated with various concentrations of NPI-0052 for 24 h, and cell viability was measured by the trypan blue dye exclusion assay. As shown in Fig. 1A, 2.5 nM NPI-0052 was determined, for both cell lines, as the optimal subtoxic concentration for use in the subsequent experiments. Cotreatment of tumor cells with NPI-0052 and various concentrations of TRAIL resulted in significant sensitization of PC-3 and Ramos cells to TRAIL-mediated apoptosis 24 h posttreatment; the intensity of which was a function of the TRAIL concentration used and synergy was achieved (Fig. 1B). In contrast, a single treatment of cells with NPI-0052 or TRAIL did not reveal any significant apoptosis induction. These data indicate that the combination treatment results in significant potentiation of apoptosis. Comparison of PC-3 cell sensitization to TRAIL after treatment with NPI-0052 or bortezomib revealed that a 400-fold less concentration of NPI-0052 than bortezomib was able to induce the same level of TRAIL-mediated apoptosis (Fig. 1C). This finding suggests that NPI-0052 is a more effective agent than bortezomib used at concentrations <5 nM in terms of sensitization of prostate tumor cells to TRAIL apoptosis.


Figure 1
View larger version (29K):
[in this window]
[in a new window]

 
FIGURE 1. NPI-0052-induced sensitization of PC-3 and Ramos cells to TRAIL-mediated apoptosis. A, Titration of NPI-0052-induced cytotoxicity in Ramos and PC-3 cells. Ramos and PC-3 cells were treated with different concentrations of NPI-0052 for 24 h. Cell viability was examined microscopically by trypan blue dye exclusion. B, NPI-0052 sensitizes tumor cells to TRAIL-mediated apoptosis. PC-3 (left panel) and Ramos (right panel) were pretreated for 6 h with increasing concentrations of NPI-0052 followed by treatment with TRAIL (5 or 10 ng/ml) for 18 h and apoptosis was determined at 24 h after initial treatment by activation of procaspase 3 as described in Materials and Methods. Synergy between TRAIL and NPI-0052 was achieved in both cell lines as indicated by the isobologram analysis (lower panels). F.I.C., Fractional inhibitory concentration. C, Comparison between bortezomib- and NPI-0052-induced sensitization of PC-3 cells to TRAIL-mediated apoptosis. PC-3 cells were treated with different concentrations of NPI-0052 or bortezomib for 6 h followed by treatment with TRAIL (5 ng/ml) for an additional 18 h. Apoptosis was determined as described above. The data represent the mean values ± SEM from three independent experiments. *, p < 0.04: cells treated with a single agent (proteasome inhibitor or TRAIL) vs combined treatment (Mann-Whitney U test); **, p < 0.02: TRAIL concentration-dependent increase in apoptosis in cotreated cells (Kruskal-Wallis H test).

 
Treatment of tumor cells with NPI-0052 up-regulates DR5 transcription and expression

Our recent findings showed that inhibition of NF-{kappa}B and the transcription repressor of DR5, YY1, sensitized the cells to TRAIL apoptosis (24). We, therefore, hypothesized that suppression of NF-{kappa}B by NPI-0052 might result in inhibition of YY1 leading to up-regulation of DR5 expression and an increase of tumor cell sensitivity to TRAIL. Quantitative RT-PCR and Western blot analyses (Fig. 2A) performed for DR5 protein and mRNA determinations, respectively, confirmed the overexpression of both DR5 transcript and total protein levels. Increased DR5 transcriptional activity was observed as early as 6 or 9 h after NPI-0052 treatment in Ramos and PC-3 cells, respectively, while the peak of DR5 protein overexpression was observed 18 and 24 h after treatment for both cell lines. In contrast, no significant change was detected in PC-3 cells in the expression profiles of other TRAIL receptors, such DR4, DcR1, and DcR2, as a function of time of NPI-0052 treatment. In Ramos cells, treatment with NPI-0052 resulted not only in up-regulation of DR5 transcript levels but also in a slight significant increase of DcR2 mRNA expression; however, the elevated DcR2 transcript levels were not accompanied by increase in total DcR2 protein expression. Similar to PC-3, the expression of all of the other TRAIL receptors tested in Ramos cells remained not significantly changed. Our findings related to the increased DR5 transcript levels after cell treatment with NPI-0052 were corroborated by the elevated DR5 promoter activity in PC-3 cells transfected with a DR5 luciferase reporter construct and treated with different concentrations of NPI-0052 (1–5 nM; Fig. 2B). The NF-{kappa}B inhibitor DHMEQ was used as an internal positive control. A significant up-regulation of DR5 surface protein levels after treatment with NPI-0052 was also observed in a concentration-dependent manner (Fig. 2C).


Figure 2
View larger version (41K):
[in this window]
[in a new window]

 
FIGURE 2. Treatment of tumor cells with NPI-0052 results in up-regulation of DR5 transcription and expression. A, NPI-0052 induces both DR5 protein and mRNA overexpression in PC-3 and Ramos cells. Total RNA or cell lysates were prepared from both cells lines treated with 2.5 nM NPI-0052 for different time periods. DcR1, DcR2, DR4, and DR4 transcript levels were determined by qRT-PCR (upper panels), whereas the corresponding protein expression was assessed by Western blot analysis (lower panel). Normalized mRNA values were derived by dividing the mRNA value of each target gene with the corresponding quantity of GAPDH mRNA. Statistical analysis was performed by using the Mann-Whitney U and Kruskal-Wallis H tests. *, p: treated vs untreated cells (Mann-Whitney U test). β-Actin expression was used as internal control in Western blot. The 48- and 43- kDa bands correspond to the long and short DR5 isoforms, respectively. Blots are representative of three independent and reproducible experiments. B, NPI-0052 augments DR5 promoter activity in PC-3 cells. Exponentially grown PC-3 cells were transfected with the pDR5-Luc reporter construct and after 4 h were treated with different concentrations of NPI-0052 for an additional 22 h. The promoter activity was determined 24 h after transfection by assessment of luciferase activation expressed as relative light units (RLU). Transfected cells treated with DMSO in the highest concentration used for NPI-0052 (5 nM) served as a negative control. The indicated values represent the mean ± SEM of three independent experiments and were calculated based on the control value set at 100% (control: untreated cells). *, p < 0.01: treated vs untreated cells (Mann-Whitney U test). C, Both cell lines were treated with 1, 2.5, or 5 nM NPI-0052 for 24 h and surface expression of DR5 was assessed by flow cytometry. Values on the y axis represent the mean fluorescence intensity (MFI) of DR5 staining. All data shown in each panel represent the mean values ± SEM from at least three independent experiments. *, p < 0.02: treated vs untreated cells (Mann-Whitney U test).

 
NPI-0052 inhibits NF-{kappa}B promoter activity, p65 phosphorylation, and phospho-I{kappa}B{alpha} degradation: role of NF-{kappa}B inhibition in tumor cell sensitization to TRAIL-mediated apoptosis

The effect of NPI-0052 treatment on NF-{kappa}B inhibition has been previously reported. To confirm this observation in our cell systems, we tested the NF-{kappa}B promoter activity as well as the I{kappa}B{alpha} and p65 protein levels after cell treatment with NPI-0052. Our findings revealed that NF-{kappa}B reporter activity was suppressed by NPI-0052 in a concentration-dependent manner in both of the cell lines tested (Fig. 3A). Western blot analysis in cell lysates derived from both cell lines treated with 2.5 nM NPI-0052 for 3, 6, and 9 h showed decreased phospho-p65 levels and accumulation of phospho-I{kappa}B{alpha} protein; however, no significant change was observed in total protein levels (Fig. 3B). The link between NF-{kappa}B inhibition and enhancement of tumor cell sensitivity to TRAIL-mediated apoptosis was confirmed by treating Ramos and PC-3 cells with different concentrations of the NF-{kappa}B chemical inhibitor DHMEQ and with increasing concentrations of TRAIL. As shown in Fig. 3C, DHMEQ showed a significant potentiating effect in combination with TRAIL in the induction of apoptosis in both PC-3 and Ramos cells. These findings suggest that NPI-0052, as an NF-{kappa}B inhibitor, mimics DHMEQ (by acting as a suppressor of the NF-{kappa}B survival pathway), facilitating increased sensitization of tumor cells to TRAIL-mediated apoptosis.


Figure 3
View larger version (38K):
[in this window]
[in a new window]

 
FIGURE 3. Treatment of tumor cells with NPI-0052 inhibits NF-{kappa}B activity and the NF-{kappa}B inhibitor DHMEQ sensitizes tumor cells to TRAIL-mediated apoptosis. A, NPI-0052 inhibits NF-{kappa}B promoter activity. NF-{kappa}B promoter activity was assessed in NPI-0052-treated PC-3 (left panel) and Ramos cells (right panel) using a NF-{kappa}B-Luc reporter plasmid as described in Materials and Methods. Values represent the mean ± SEM of three independent experiments and were calculated based on the control value set at 100% (control: untreated cells). Cells treated with 10 µg/ml DHMEQ, a chemical inhibitor of NF-{kappa}B, served as a positive control for NF-{kappa}B promoter activity inhibition. *, p: treated vs untreated cells (Mann-Whitney U test). B, NPI-0052 inhibits p65 phosphorylation and prevents phospho-I{kappa}B{alpha} degradation. Ramos and PC-3 cells were treated with 2.5 nM NPI-0052 for the indicated time points and Western blot analysis was performed in whole cell lysates for detection of phosphorylated and total p65 and I{kappa}B{alpha} levels. Actin expression was used as an internal loading control. C, Sensitization of tumor cells to TRAIL-mediated apoptosis by the NF-{kappa}B inhibitor DHMEQ. PC-3 (upper panel) and Ramos (lower panel) cells were treated with various concentrations of TRAIL in the presence or absence of various concentrations of DHMEQ and apoptosis was assessed. *, p values: single cell treatment with DHMEQ or TRAIL vs combinational treatment (Mann-Whitney U test). RLU, Relative light units.

 
Inhibition of YY1 by NPI-0052 sensitizes tumor cells to TRAIL-mediated apoptosis

Recent findings demonstrated that YY1 is under the positive regulation of NF-{kappa}B (24, 26, 29); therefore, suppression of NF-{kappa}B by NPI-0052 might result in inhibition of YY1 and DR5 overexpression. To test this hypothesis, we examined the YY1 mRNA and protein expression in Ramos and PC-3 cells before and after treatment with NPI-0052 for several time periods. As shown in Fig. 4A, YY1 transcript levels were significantly reduced as early as 3 or 6 h posttreatment in PC-3 and Ramos cells, respectively, while the peaks of YY1 protein down-regulation were observed at least after 9 h posttreatment for both cell lines. The decreased YY1 mRNA levels after cell treatment with NPI-0052 were corroborated with significant suppression of YY1 promoter activity as assessed in PC-3 and Ramos cells by using a YY1-Luc reporter construct (Fig. 4B). These results demonstrate that NPI-0052 inhibits YY1 transcription and expression and these correlated with NPI-induced up-regulation of DR5 and inhibition of NF-{kappa}B.


Figure 4
View larger version (30K):
[in this window]
[in a new window]

 
FIGURE 4. Inhibition of YY1 expression and YY1 promoter activity by NPI-0052. A, Kinetic analysis of YY1 mRNA (upper panels) and protein expression (lower panel) in PC-3 and Ramos cells after treatment with NPI-0052. Exponentially grown cells were treated with 2.5 nM NPI-0052 for the indicated time periods. Total RNA and whole cell lysates were extracted for qRT-PCR and Western blot analyses, respectively. Normalized YY1 mRNA values were derived by dividing the relative mRNA value of each time point by the corresponding relative quantity of GAPDH mRNA. Statistical analysis was performed by using the Mann-Whitney U and Kruskal-Wallis H tests. *, p: treated vs untreated cells (Mann-Whitney U test). β-Actin expression was used as internal control for Western blot. Blots are representative of three independent experiments. B, Down-regulation of YY1 promoter activity was assessed following treatment of PC-3 (upper panel) and Ramos cells (lower panel) with different concentrations of NPI-0052. Cell transfection was performed using a YY1-Luc reporter construct, followed by treatment with NPI-0052 for 20 h. DHMEQ-treated cells were used as positive control of YY1 promoter suppression. Values are the mean ± SEM of two experiments in triplicates and represent the percentage of the control (untreated cells). *, p: treated vs untreated cells (Mann-Whitney U test). RLU, Relative light units.

 
The direct involvement of YY1 inhibition by NPI-0052 in tumor cell sensitization to TRAIL by up-regulating DR5 was examined by transfecting cells with siRNA against YY1 mRNA and tested the cells for sensitivity to TRAIL. We observed that transfection of both cell lines tested with YY1 siRNA for 72 h inhibited YY1 expression (Fig. 5A) and sensitized the cells to TRAIL-mediated apoptosis in a concentration-dependent manner (Fig. 5A, PC-3 and Ramos, upper and lower panels, respectively). Furthermore, as assessed by flow cytometry, 72 h posttransfection the surface DR5 protein levels were found significantly elevated in both PC-3 and Ramos cells (Fig. 5B). These findings demonstrate that YY1 plays a major role in TRAIL-mediated apoptosis and suggest that NPI-0052 enhances cell sensitivity to TRAIL by enhancing DR5 expression through YY1 inhibition.


Figure 5
View larger version (34K):
[in this window]
[in a new window]

 
FIGURE 5. Inhibition of YY1 inhibition by YY1 siRNA sensitizes tumor cells to TRAIL-mediated apoptosis correlated with DR5 up-regulation. A, Tumor cell sensitization to TRAIL-mediated apoptosis by YY1 siRNA. Forty-eight hours posttransfection with YY1 siRNA, PC-3 (upper panel) or Ramos cells (lower panel) were treated or left untreated with 1, 2.5, or 5 ng/ml recombinant TRAIL for 24 h and apoptosis was determined. *, p < 0.022: single TRAIL or YY1 siRNA treatment vs combined treatment (Mann-Whitney U test). Inhibition of YY1 after treatment with YY1 siRNA was confirmed in both cells by Western blot analysis. Actin was used as an internal control for loading. B, Up-regulation of DR5 by YY1 siRNA. Seventy-two hours posttransfection with YY1 siRNA, DR5 surface expression was assessed in PC-3 (upper panel) and Ramos (lower panel) cells by flow cytometry. Values were calculated based on the control mean fluorescence intensity (MFI) value set at 100% (control: untransfected cells). All data represent the mean ± SEM of at least three independent experiments. *, p values: transfected vs control cells (Mann-Whitney U test).

 
NPI-0052 inhibits NF-{kappa}B-regulated antiapoptotic gene products and induces mitochondrial membrane depolarization: role of Bcl-xL down-regulation in TRAIL sensitization

The inhibition of antiapoptotic gene products, several of which are regulated by NF-{kappa}B such as Bcl-xL, IAPs, and XIAP (30, 31) and/or up-regulation of proapoptotic proteins such as Bax, are known to contribute to mitochondrial membrane depolarization and release of cytochrome c and Smac/DIABLO leading to apoptosis induction (32). We hypothesized that NPI-0052-induced inhibition of the NF-{kappa}B pathway may modulate the ratios between pro- and antiapoptotic gene products in favor of proapoptotic activity, thus influencing the mitochondrial membrane potential and promoting apoptosis.

PC-3 and Ramos cells were treated with increasing concentrations of NPI-0052 for 24 h and the mitochondrial membrane potential permeability was assessed by flow cytometry. As shown in Fig. 6A, both cell lines treated with even 1 nM NPI-0052 exhibited increased mitochondrial membrane depolarization. Cell lysates extracted from PC-3 and Ramos cells treated with 2.5 nM NPI-0052 for various time periods were subjected to Western blot analysis for determination of the protein expression of the anti- and proapoptotic gene products, including Bcl-xL, survivin, IAPs, XIAP, Bax, caspase 8, and FLIP. As shown in Fig. 6B, treatment of PC-3 cells with NPI-0052 resulted in time-dependent reduction in the levels of Bcl-xL, survivin, IAPs, and XIAP. Maximum inhibitory effects were observed 18 and 24 h after treatment for most of the antiapoptotic gene products. In contrast, the expression of the proapoptotic protein Bax was found elevated as early as 3 h after treatment. The same patterns were also observed in Ramos cells after treatment with 2.5 nM NPI-0052 for 24 h (Fig. 6B). However, in both cell lines tested, there was no significant change observed in FLIP expression, while minimal caspase 8 activation was monitored. These findings suggest that NPI-0052 sensitizes tumor cells to TRAIL-mediated apoptosis, at least in part, by decreasing the ratio of antiapoptotic gene products over proapoptotic gene products and thus inducing mitochondrial membrane depolarization and activation of at least the type II apoptotic pathway.


Figure 6
View larger version (30K):
[in this window]
[in a new window]

 
FIGURE 6. NPI-0052 sensitizes tumor cells to apoptosis via activation of the intrinsic apoptotic pathway and inhibition of Bcl-xL expression. A, Depolarization of mitochondrial membrane was assessed in Ramos and PC-3 cells treated with various concentrations of NPI-0052 for 24 h using the DiOC6 dye and flow cytometry. Untreated cells served as control. Values are expressed as MFI of DiOC6 incorporation and represent the mean ± SEM of at least three independent experiments. *, p < 0.035: treated vs untreated cells. B, Protein lysates derived from PC-3 or Ramos cells treated with 2.5 nM NPI-0052 for different time periods were screened by Western blot analysis for survivin, Bcl-xL, XIAP, IAP1, Bax, caspase 8, and cFLIP expression. Actin served as an internal control. Blots are representative of three independent experiments. C, Role of Bcl-xL in TRAIL-mediated apoptosis. PC-3 (left panel) and Ramos (right panel) cells were treated with the Bcl-xL inhibitor 2MAM-A3 for 5 h and then treated with different concentrations of TRAIL for 18 h and analyzed for apoptosis. *, p values: single cell treatment with 2MAM-A3 or TRAIL vs combined treatment. All statistical analyses were performed using the Mann-Whitney U test.

 
Bcl-xL has been reported, by us and others, as one dominant factor responsible for the acquired resistance of certain tumor cells to chemo- and immunotherapy, including TRAIL (25, 29, 31, 33, 34). Since Bcl-xL is inhibited by NPI-0052, we hypothesized that direct inhibition of Bcl-xL will mimic NPI-0052. Indeed, treatment of PC-3 and Ramos cells with the Bcl-2 inhibitor 2MAM-A3 resulted in significant cell sensitivity to TRAIL-mediated apoptosis, and the extent was a function of the TRAIL concentration used (Fig. 6C). These findings indicate that Bcl-xL inhibition by NPI-0052 via NF-{kappa}B inactivation contributes to NPI-0052-induced tumor cell sensitization to TRAIL-mediated apoptosis.

Toxicity profiles of NPI-0052 and TRAIL combinational treatment of human progenitor cells

The human colony-forming assay was used to determine the toxicity of NPI-0052 on normal hemopoiesis by evaluating its ability to block colony formation. Each colony formed is the result of cell division and differentiation of a single progenitor cell over time. NPI-0052 was tested at 2.5 nM along with either 5 or 10 ng/ml TRAIL. Both compounds were incubated with bone marrow mononuclear cells simultaneously for 14 days. Untreated and DMSO-treated cells were used as controls. Colony counts of CFU-E, BFU-E, CFU-GM, and CFU-GEMM were determined at day 14 of incubation. NPI-0052 or TRAIL (at both concentrations used) as single agent treatment demonstrated no toxicity to the progenitor cells of any lineage as evidenced by the number of the various colony types compared with untreated controls. However, both combination treatments demonstrated inhibition of colony formation of all types, although they did not block colony formation completely, allowing 40–70% of the colonies to grow and differentiate (Fig. 7).


Figure 7
View larger version (42K):
[in this window]
[in a new window]

 
FIGURE 7. Toxicity profile of NPI-0052 and TRAIL combinational treatment on colony formation of human progenitor cells. NPI-0052 was tested at 2.5 nM along with either 10 or 5 ng/ml TRAIL. Both compounds were incubated with bone marrow mononuclear cells simultaneously for a 14-day incubation period. Nontreated mononuclear cells were used as a negative control. DMSO-alone control was also tested at an equal volume. Colonies of various lineages were counted at day 14 as discussed in Materials and Methods. Data are presented as the mean number of colonies formed for each treatment of quadruplicate samples. Error bars, SD. The Student t test was used to determine significant differences, *, p < 0.05.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
In the present study, we have examined the mechanisms by which proteasome inhibitors up-regulate DR5 expression and sensitize tumor cells to TRAIL apoptosis. Our findings demonstrate that NPI-0052 sensitizes both prostate and B-NHL cell lines to TRAIL-mediated apoptosis via a mechanism which involves inhibition of the TRAIL-resistant factor, the transcription repressor YY1, and consequently up-regulation of DR5. Inhibition of YY1 by NPI-0052 is mediated, in part, by inactivation of its positive regulator NF-{kappa}B (26), as confirmed by down-regulation of the phosphorylated p65 protein levels and accumulation of phosphorylated I{kappa}B{alpha}. In addition to YY1 inhibition and DR5 induction, NPI-0052 was shown to promote activation of the mitochondrion-related apoptotic pathway through depolarization of the mitochondrial membrane, inhibition of XIAP, IAPs, and Bcl-xL antiapoptotic gene products, and induction of Bax. Cancer cells, including prostate and B-NHL tumors, have been shown to have constitutive NF-{kappa}B activity which regulates the transcription of many gene products involved in cell survival and antiapoptotic pathways (1, 34). Since the above antiapoptotic gene products are under the direct regulation of NF-{kappa}B and their elevated expression has been shown to confer resistance of prostate and B-NHL tumors to immuno- or chemotherapy (25, 29, 32), their inhibition by NPI-0052 in combination with the inhibition of NF-{kappa}B and YY1 and DR5 overexpression contribute to resensitization of those tumors to TRAIL-mediated apoptosis.

Several mechanisms have been proposed to elucidate the antitumor activity of proteasome inhibitors in different cancer models. Among such mechanisms, of particular interest is the reduced I{kappa}B{alpha} degradation, leading to decreased NF-{kappa}B-dependent synthesis of antiapoptotic factors resulting in a shift in the balance between pro- and anti-apoptotic Bcl-2 family members and induction of apoptosis (35). Moreover, stabilization and accumulation of p53 (2), generation of reactive oxygen species and oxidative stress, JNK stabilization, increased c-Jun phosphorylation, and AP-1 DNA-binding activity (17, 36, 37), have also been correlated with the use of proteasome inhibitors in cancer therapy. The effect of proteasome inhibitors in tumor cell sensitization to TRAIL has been studied in different experimental models in vitro. Proteasome inhibitors like bortezomib (PS-341) and MG-132 have been shown, as single agents, to induce modest apoptosis in several types of tumors; however, low doses in combination with TRAIL result in synergy (17, 23, 36, 37, 38, 39, 40). Some of the proposed underlying mechanisms include proteasome inhibitor-mediated p21 and Bax induction followed by Smac/DIABLO release and activation of procaspase 9 (23, 39, 40) and inhibition of c-FLIP, Bcl-2, Bcl-xL, and IAP1 antiapoptotic gene products (17, 37) via inactivation of NF-{kappa}B.

The induction of TRAIL receptors DR4 and/or DR5 by PS-341 resulting in potentiation of TRAIL-induced apoptosis has been shown in certain types of cancer cells, including colon, prostate, bladder and ovarian cancer, chronic lymphocytic leukemia, non-small cell lung cancer, and glioblastoma (19, 20, 21, 39, 40). The role of proteasome inhibitor-induced DR5 expression in sensitization to TRAIL is well documented by the use of siRNA DR5 in which the transfected cells show reduced levels of apoptosis to TRAIL (20). Our findings agree with those of Liu et al. (20) and those of Kabore et al. (21) for DR5, although unlike Liu et al. (20) we could not demonstrate up-regulation of DR4 in our cell lines in both mRNA and protein level. We also did not detect any changes in the expression profiles of other TRAIL receptors such as DcR1 and DcR2 in PC-3 cells; however, in Ramos cells, a slight significant increase in DcR2 transcript levels was not accompanied with a similar increase in protein level, indicating that among the TRAIL receptors the main target of NPI-0052 is DR5. Nothing is known about the mechanism by which proteasome inhibitors regulate DR5 expression. It is well known that DR5 expression is regulated through p53-dependent or p53-independent mechanisms (41, 42). It was suggested that JNK could possibly regulate DR5 expression (43, 44); however, inhibition of JNK did not affect PS-341-induced sensitization to TRAIL in human non-small-cell lung carcinoma. In contrast, PS-341 induced up-regulation of the CHOP/GADD-153 transcriptional factor that regulates DR5 expression (23, 45).

Our findings demonstrate, for the first time, that proteasome inhibitor-induced up-regulation of DR5 expression is mediated, in part, by transcriptional and posttranscriptional inhibition of the transcription repressor YY1 that we have shown to negatively regulate DR5 transcription and expression (24). YY1 can exert wide activities at target promoters acting either as an activator, a repressor, or as an initiator binding protein (46, 47). In addition to previous reports indicating directly or indirectly positive regulation of YY1 by NF-{kappa}B (24, 26, 29), here we show that NPI-0052-induced YY1 inhibition and the subsequent cell sensitization to TRAIL-mediated apoptosis results from inactivation of NF-{kappa}B. NF-{kappa}B inhibition by NPI-0052 in our cell systems seems to result mainly by progressive accumulation of phospho-I{kappa}B{alpha} since NF-{kappa}B is constitutively active in the tested cell lines and the pI{kappa}B{alpha} is continuously degraded by the proteasome. However, no significant increase was observed in total IKB{alpha} protein levels. Our findings are consistent with data recently reported by Ahn et al. (48) in cell lines treated with NPI-0052 and TNF-{alpha}. Similar to I{kappa}B{alpha}, we did not observe any change in total p65 protein levels after cell treatment with NPI-0052; however, phospho-p65 levels were significantly decreased as a function of time and exposure. Those were expected findings because we used total protein cell extracts for our analysis. These findings are in agreement with the findings reported by Ahn et al. (48).

NPI-0052-induced NF-{kappa}B inhibition was consistent with the increased sensitivity of tumor cells to TRAIL-induced apoptosis mediated by DR5 up-regulation after cell treatment with the NF-{kappa}B inhibitor DHMEQ or YY1 siRNA. We also show that several NF-{kappa}B-dependent antiapoptotic gene products including Bcl-xL, IAPs, and, to a less extent, XIAP are down-regulated by NPI-0052 while it promotes the overexpression of proapoptotic gene products such as Bax. Bcl-xL, IAPs, and XIAP have been reported to confer resistance to TRAIL in several tumor models, including prostate cancer cells, and their inhibition by different agents promote tumor resensitization to immuno- or chemotherapy (29, 32, 34). The NPI-0052-induced inhibition of Bcl-xL seems to be a key component in the mechanism of NPI-0052 action against PC-3 and Ramos cell resistance to TRAIL, since inhibition of Bcl-xL by chemical inhibitors such as 2MAM-A3 was able by itself to resensitize the cells to TRAIL-mediated apoptosis. Thus, we demonstrate that NPI-0052-induced DR5 overexpression is the result of both NF-{kappa}B and YY1 inhibition and in combination with TRAIL activates the type II apoptotic pathway, leading to reversal of tumor resistance to TRAIL. However, it is not known whether NPI-0052 by itself is able to activate the type I apoptotic pathway by DR5 up-regulation and DISC assembly and such studies will be the subject of a future report. Our preliminary data on procaspase 8 activation show that 2.5 nM NPI-0052 cannot activate substantially the procaspase 8 in both cell lines in a time-dependent manner, while FLIP expression is also not significantly changed. Under conditions of excess NPI-0052 concentrations, Miller et al. (49) and Ahn et al. (48) have reported significant activation of caspase 8, down-regulation of FLIP, and FADD recruitment in leukemia cell models after cell treatment with NPI-0052 in concentrations ranging from 50 nM up to 1000 nM, used alone or in combination with other agents such as TNF-{alpha}.

In some studies, NF-{kappa}B inhibition by proteasome inhibitors was insufficient to explain the observed synergy between proteasome inhibitors and TRAIL such as in glioblastoma (19) or the chemoresistant Bcl-2-overexpressing cells, where most likely Bcl-2 cleavage and elimination of antiapoptotic Mcl-1 may both play a role in the proteasome inhibitor-TRAIL cooperation (22). Similarly, novel NF-{kappa}B and death receptor-independent mechanisms have been proposed in reversal of primary keratinocyte resistance to TRAIL by proteasome inhibitors including removal of the downstream resistance-mediating block of effector caspase maturation (37). Other reports indicate that bortezomib and TRAIL interact synergistically to preferentially promote apoptosis in a murine myeloid leukemia and renal cancers; however, bortezomib affected neither the activity of NF-{kappa}B nor the levels of most antiapoptotic proteins but only resulted in reduced c-FLIP (17). NF-{kappa}B- independent mechanisms have also been proposed to explain melanoma cell resistance to TRAIL-mediated apoptosis which is most likely attributed to down-regulation of initiator caspases and DR4 than to up-regulation of antiapoptotic proteins by NF-{kappa}B (50).

The most well-studied proteasome inhibitor and already approved for MM treatment is bortezomib (PS-341; Velcade). Bortezomib was shown to induce cytotoxicity of MM by the induction of apoptosis of drug-resistant myeloma cells via inhibition of {kappa}B kinases and thereby inactivation of NF-{kappa}B (51). It was first shown to have antitumor activity in a phase II trial in relapsed and refractory myeloma, both alone and combined with dexamethasone and was approved in 2003 (5). Approval was extended for relapsed myeloma and it significantly prolonged time to progression and survival compared with dexamethasone (52). These findings and new clinical trials have demonstrated bortezomib use alone or in combination with other drugs in newly diagnosed patients (53). Additionally, preclinical studies have shown a wider spectrum of tumors where bortezomib could be active as a single agent, including prostate cancer, mantle cell lymphomas, and non-small cell lung cancer (5, 54, 55, 56). The novel proteasome inhibitor NPI-0052 is distinct from bortezomib not only in its chemical structure, but also in the irreversible fashion that affects the three proteolytic activities of the 20S proteasome core as well as the mechanism of action and toxicity profile against normal cells (57). In vitro findings have shown that NPI-0052 induces apoptosis in MM resistant to conventional and bortezomib therapies; however, the first human trial is currently ongoing (8). Moreover, a recent study by Cusack et al. (9) reported that NPI-0052 is well tolerated in mice and enhances tumor responses to conventional cancer therapy in a colon cancer model. A comparable study report by Ruiz et al. (57) demonstrates that NPI-0052 is a more potent apoptotic inducer than bortezomib in lymphocytes from patients with chronic lymphocytic leukemia.

Both NPI-0052 and bortezomib have been reported to exhibit time and concentration-dependent inhibition of the proteasome in vitro based on their different kinetics and pharmacologic profiles (58). With respect to the efficacy of each agent to induce tumor cell sensitization to TRAIL, bortezomib has been shown to be effective at concentrations ranging from 0.5 µM up to 10 µM in various tumor models including ovarian, thyroid, colon, and pancreatic carcinomas (38, 39, 40, 59). The concentrations of NPI-0052 used in our experimental models to achieve high tumor sensitization rates to TRAIL apoptosis were significantly lower (1–5 nM) compared with those used for bortezomib in the previous studies. Comparison between bortezomib and NPI-0052 in terms of the concentrations used for sensitization of PC-3 cells to TRAIL revealed that 5 nM NPI-0052 was able to give the same net tumor response to TRAIL as 2 µM bortezomib. This indicates a 400-fold higher efficiency of NPI-0052 to induce TRAIL-mediated apoptosis at such low concentrations than bortezomib, at least in prostate tumor cells. Moreover, by testing the effect of the combination treatment (TRAIL and NPI-0052) on hematopoietic progenitor colony formation, we showed that despite some toxicity observed, the majority of the colonies from all types (40–70%) were still able to grow and differentiate under the combination treatment. These findings are in accordance with reported data on the toxicity profiles of other proteasome inhibitors, such as PS-341, used at higher concentrations than NPI-0052, when combined with TRAIL in normal cells (21).

In summary, our findings here demonstrate, for the first time, that the novel proteasome inhibitor NPI-0052 is able to break the resistance of prostate and B-NHL cell lines to TRAIL via a mechanism which involves inhibition of the constitutively expressed DR5 transcriptional repressor YY1. Inhibition of YY1 by NPI-0052 is the result of inhibition of NF-{kappa}B activity which regulates, in part, YY1 transcription and expression (26). Thus, NPI-0052-induced inhibition of phospho-I{kappa}B degradation results in retaining NF-{kappa}B in its inactive form and thus inhibits its transcriptional activity for YY1 and many other antiapoptotic gene products such as XIAP, IAPs, and Bcl-xL. Thus, treatment of tumor cells with NPI-0052 results in the concomitant up-regulation of DR5 and down-regulation of antiapoptotic gene products. In addition, NPI-0052 induces mitochondrial membrane depolarization and the combination of NPI-0052 and TRAIL through the activation of type II apoptotic pathway results in synergy in apoptosis as shown in Fig. 8. The inverse correlation between DR5 and YY1 expression has been observed in several human tumor tissues with different disease stages such as multiple MM, prostate, and lung carcinomas (data not shown). Preliminary findings demonstrate that tissues derived from prostate tumor xenografts revealed inhibition of YY1 and up-regulation of DR5 expression following treatment of the mice with the chemotherapeutic drug cis-diammine dichloroplatinum or the NO donor DETA/NONOate (data not shown). Our data suggest that NPI-0052 can effectively break the tumor cell resistance to TRAIL in very low nontoxic to normal cells concentrations and could thereby support the clinical applicability of a combination of TRAIL and/or receptor agonist Abs with NPI-0052 in the treatment of drug/TRAIL-resistant tumors.


Figure 8
View larger version (24K):
[in this window]
[in a new window]

 
FIGURE 8. Schematic diagram representing the role of the proteasome inhibitor NPI-0052 in the regulation of tumor cells sensitivity to TRAIL-induced apoptosis. Treatment with NPI-0052 results in the modification of several genes regulating the apoptotic pathways. NPI-0052 inhibits the NF-{kappa}B pathway via inhibition of I{kappa}B{alpha} and p65 phosphorylation. NF-{kappa}B inhibition by NPI-0052 leads to the down-regulation of Bcl-xL and the induction of Bax (Fig. 6) contributing to the mitochondrial membrane depolarization. Furthermore, NPI-0052 inhibits the transcription repressor YY1, leading to up-regulation of DR5 (Figs. 4 and 2, respectively).Thus, the combination of NPI-0052 and TRAIL results in the activation of the mitochondrial apoptotic pathway, inhibition of antiapoptotic gene products, activation of procaspases 9 and 7, formation of the apoptosome, and altogether downstream activation of the effector caspase 3 resulting in apoptosis.

 

    Acknowledgments
 
We thank Maggie Yang and Erica Keng in the preparation of this manuscript. We also acknowledge Dr. T. Sakai for providing the pDR5-Luc reporter plasma.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
M.P. is an employee of Nereus Pharmaceuticals, Inc.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported in part by Grants CA107023 and CA107023-02S1. Back

2 S.B. and E.S. contributed equally to this work. Back

3 Address correspondence and reprint requests to Dr. Benjamin Bonavida, Department of Microbiology, Immunology, and Molecular Genetics, University of California, 10833 Le Conte Avenue, A2-060 CHS, Los Angeles, CA 90095. E-mail address: bbonavida{at}mednet.ucla.edu Back

4 Abbreviations used in this paper: XIAP, X-linked inhibitor of apoptosis; IAP, inhibitor of apoptosis protein; MM, multiple myeloma; CT-L, chymotrypsin-like proteolytic activity; DR, death receptor; CFU-E, CFU-erythroid; BFU-E, burst-forming unit erythroid; CFU-GEMM, CFU granulocyte/erythrocyte/macrophage/megakaryocyte multilineage colony; siRNA, small interfering RNA; 2MAM-A3, 2-methoxyantimycin A3; YY1, Yin Yang 1; DHMEQ, dehydroxymethylepoxyquinomicin; DiOC6, 3,3'-dihexyloxacarbocyanine; qRT-PCR, quantitative RT-PCR. Back

Received for publication September 13, 2007. Accepted for publication March 4, 2008.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Aggarwal, B. B.. 2004. Nuclear factor-{kappa}B: the enemy within. Cancer Cell 6: 203-208. [Medline]
  2. Adams, J.. 2004. The development of proteasome inhibitors as anticancer drugs. Cancer Cell 5: 417-421. [Medline]
  3. Cusack, J. C., Jr, R. Liu, M. Houston, K. Abendroth, P. J. Elliott, J. Adams, A. S. Baldwin, Jr. 2001. Enhanced chemosensitivity to CPT-11 with proteasome inhibitor PS-341: implications for systemic nuclear factor-{kappa}B inhibition. Cancer Res. 61: 3535-3540. [Abstract/Free Full Text]
  4. Russo, S. M., J. E. Tepper, A. S. Baldwin, Jr, R. Liu, J. Adams, P. Elliott, J. C. Cusack, Jr. 2001. Enhancement of radiosensitivity by proteasome inhibition: implications for a role of NF-{kappa}B. Int. J. Radiat. Oncol. Biol. Phys. 50: 183-193. [Medline]
  5. Richardson, P. G., B. Barlogie, J. Berenson, S. Singhal, S. Jagannath, D. Irwin, S. V. Rajkumar, G. Srkalovic, M. Alsina, R. Alexanian, et al 2003. A phase 2 study of bortezomib in relapsed, refractory myeloma. N. Engl. J. Med. 348: 2609-2617. [Abstract/Free Full Text]
  6. Feling, R. H., G. O. Buchanan, T. J. Mincer, C. A. Kauffman, P. R. Jensen, W. Fenical. 2003. Salinosporamide A: a highly cytotoxic proteasome inhibitor from a novel microbial source, a marine bacterium of the new genus Salinospora. Angew. Chem. Int. Ed. Engl. 42: 355-357.
  7. Macherla, V. R., S. S. Mitchell, R. R. Manam, K. A. Reed, T. H. Chao, B. Nicholson, G. Deyanat-Yazdi, B. Mai, P. R. Jensen, W. F. Fenical, et al 2005. Structure-activity relationship studies of salinosporamide A (NPI-0052), a novel marine derived proteasome inhibitor. J. Med. Chem. 48: 3684-3687. [Medline]
  8. Chauhan, D., L. Catley, G. Li, K. Podar, T. Hideshima, M. Velankar, C. Mitsiades, N. Mitsiades, H. Yasui, A. Letai, et al 2005. A novel orally active proteasome inhibitor induces apoptosis in multiple myeloma cells with mechanisms distinct from bortezomib. Cancer Cell 8: 407-419. [Medline]
  9. Cusack, J. C., Jr, R. Liu, L. Xia, T. H. Chao, C. Pien, W. Niu, V. J. Palombella, S. T. Neuteboom, M. A. Palladino. 2006. NPI-0052 enhances tumoricidal response to conventional cancer therapy in a colon cancer model. Clin. Cancer Res. 12: 6758-6764. [Abstract/Free Full Text]
  10. Yagita, H., K. Takeda, Y. Hayakawa, M. J. Smyth, K. Okumura. 2004. TRAIL and its receptors as targets for cancer therapy. Cancer Sci. 95: 777-783. [Medline]
  11. Kelley, S. K., A. Ashkenazi. 2004. Targeting death receptors in cancer with Apo2L/TRAIL. Curr. Opin. Pharmacol. 4: 333-339. [Medline]
  12. Liabakk, N. B., T. Espevik. 2004. Monoclonal antibodies against TRAIL. Vitam. Horm. 67: 65-79. [Medline]
  13. Keane, M. M., S. A. Ettenberg, M. M. Nau, E. K. Russell, S. Lipkowitz. 1999. Chemotherapy augments TRAIL-induced apoptosis in breast cell lines. Cancer Res. 59: 734-741. [Abstract/Free Full Text]
  14. Ohtsuka, T., D. Buchsbaum, P. Oliver, S. Makhija, R. Kimberly, T. Zhou. 2003. Synergistic induction of tumor cell apoptosis by death receptor antibody and chemotherapy agent through JNK/p38 and mitochondrial death pathway. Oncogene 22: 2034-2044. [Medline]
  15. An, J., Y. P. Sun, J. Adams, M. Fisher, A. Belldegrun, M. B. Rettig. 2003. Drug interactions between the proteasome inhibitor bortezomib and cytotoxic chemotherapy, tumor necrosis factor (TNF) {alpha}, and TNF-related apoptosis-inducing ligand in prostate cancer. Clin. Cancer Res. 9: 4537-4545. [Abstract/Free Full Text]
  16. He, Q., Y. Huang, M. S. Sheikh. 2004. Proteasome inhibitor MG132 upregulates death receptor 5 and cooperates with Apo2L/TRAIL to induce apoptosis in Bax-proficient and -deficient cells. Oncogene 23: 2554-2558. [Medline]
  17. Sayers, T. J., A. D. Brooks, C. Y. Koh, W. Ma, N. Seki, A. Raziuddin, B. R. Blazar, X. Zhang, P. J. Elliott, W. J. Murphy. 2003. The proteasome inhibitor PS-341 sensitizes neoplastic cells to TRAIL-mediated apoptosis by reducing levels of c-FLIP. Blood 102: 303-310. [Abstract/Free Full Text]
  18. Chen, S., X. Liu, P. Yue, A. H. Schonthal, F. R. Khuri, S. Y. Sun. 2007. CCAAT/enhancer-binding protein homologous protein-dependent death receptor 5 induction and ubiquitin/proteasome-mediated cellular FLICE-inhibitory protein down-regulation contribute to enhancement of tumor necrosis factor-related apoptosis ligand-induced apoptosis by dimethyl-celecoxib in human non-small cell lung cancer cells. Mol. Pharmacol. 72: 1269-1279. [Abstract/Free Full Text]
  19. La Ferla-Bruhl, K., M. A. Westhoff, S. Karl, H. Kasperczyk, R. M. Zwacka, K. M. Debatin, S. Fulda. 2007. NF-{kappa}B-independent sensitization of glioblastoma cells for TRAIL-induced apoptosis by proteasome inhibition. Oncogene 26: 571-582. [Medline]
  20. Liu, X., P. Yue, S. Chen, L. Hu, S. Lonial, F. R. Khuri, S. Y. Sun. 2007. The proteasome inhibitor PS-341 (bortezomib) up-regulates DR5 expression leading to induction of apoptosis and enhancement of TRAIL-induced apoptosis despite up-regulation of c-FLIP and survivin expression in human NSCLC cells. Cancer Res. 67: 4981-4988. [Abstract/Free Full Text]
  21. Kabore, A. F., J. Sun, X. Hu, K. McCrea, J. B. Johnston, S. B. Gibson. 2006. The TRAIL apoptotic pathway mediates proteasome inhibitor induced apoptosis in primary chronic lymphocytic leukemia cells. Apoptosis 11: 1175-1193. [Medline]
  22. Nencioni, A., L. Wille, G. Dal Bello, D. Boy, G. Cirmena, S. Wesselborg, C. Belka, P. Brossart, F. Patrone, A. Ballestrero. 2005. Cooperative cytotoxicity of proteasome inhibitors and tumor necrosis factor-related apoptosis-inducing ligand in chemoresistant Bcl-2-overexpressing cells. Clin. Cancer Res. 11: 4259-4265. [Abstract/Free Full Text]
  23. Yoshida, T., T. Shiraishi, S. Nakata, M. Horinaka, M. Wakada, Y. Mizutani, T. Miki, T. Sakai. 2005. Proteasome inhibitor MG132 induces death receptor 5 through CCAAT/enhancer-binding protein homologous protein. Cancer Res. 65: 5662-5667. [Abstract/Free Full Text]
  24. Baritaki, S., S. Huerta-Yepez, T. Sakai, D. A. Spandidos, B. Bonavida. 2007. Chemotherapeutic drugs sensitize cancer cells to TRAIL-mediated apoptosis: up-regulation of DR5 and inhibition of Yin Yang 1. Mol. Cancer Ther. 6: 1387-1399. [Abstract/Free Full Text]
  25. Huerta-Yepez, S., M. Vega, A. Jazirehi, H. Garban, F. Hongo, G. Cheng, B. Bonavida. 2004. Nitric oxide sensitizes prostate carcinoma cell lines to TRAIL-mediated apoptosis via inactivation of NF-{kappa}B and inhibition of Bcl-xL expression. Oncogene 23: 4993-5003. [Medline]
  26. Wang, H., E. Hertlein, N. Bakkar, H. Sun, S. Acharyya, J. Wang, M. Carathers, R. Davuluri, D. C. Guttridge. 2007. NF-{kappa}B regulation of YY1 inhibits skeletal myogenesis through transcriptional silencing of myofibrillar genes. Mol. Cell. Biol. 27: 4374-4387. [Abstract/Free Full Text]
  27. Yoshida, T., A. Maeda, N. Tani, T. Sakai. 2001. Promoter structure and transcription initiation sites of the human death receptor 5/TRAIL-R2 gene. FEBS Lett. 507: 381-385. [Medline]
  28. Suzuki, E., K. Umezawa, B. Bonavida. 2007. Rituximab inhibits the constitutively activated PI3K-Akt pathway in B-NHL cell lines: involvement in chemosensitization to drug-induced apoptosis. Oncogene 26: 6184-6193. [Medline]
  29. Vega, M. I., A. R. Jazirehi, S. Huerta-Yepez, B. Bonavida. 2005. Rituximab-induced inhibition of YY1 and Bcl-xL expression in Ramos non-Hodgkin’s lymphoma cell line via inhibition of NF-{kappa}B activity: role of YY1 and Bcl-xL in Fas resistance and chemoresistance, respectively. J. Immunol. 175: 2174-2183. [Abstract/Free Full Text]
  30. Berenbaum, M. C.. 1981. Criteria for analyzing interactions between biologically active agents. Adv. Cancer Res. 35: 269-335. [Medline]
  31. Ravi, R., G. C. Bedi, L. W. Engstrom, Q. Zeng, B. Mookerjee, C. Gelinas, E. J. Fuchs, A. Bedi. 2001. Regulation of death receptor expression and TRAIL/Apo2L-induced apoptosis by NF-{kappa}B. Nat. Cell. Biol. 3: 409-416. [Medline]
  32. Ng, C. P., B. Bonavida. 2002. X-linked inhibitor of apoptosis (XIAP) blocks Apo2 ligand/tumor necrosis factor-related apoptosis-inducing ligand-mediated apoptosis of prostate cancer cells in the presence of mitochondrial activation: sensitization by overexpression of second mitochondria-derived activator of caspase/direct IAP-binding protein with low pl (Smac/DIABLO). Mol. Cancer Ther. 1: 1051-1058. [Abstract/Free Full Text]
  33. Jazirehi, A. R., M. I. Vega, D. Chatterjee, L. Goodglick, B. Bonavida. 2004. Inhibition of the Raf-MEK1/2-ERK1/2 signaling pathway, Bcl-xL down-regulation, and chemosensitization of non-Hodgkin’s lymphoma B cells by rituximab. Cancer Res. 64: 7117-7126. [Abstract/Free Full Text]
  34. Aggarwal, B. B., U. Bhardwaj, Y. Takada. 2004. Regulation of TRAIL-induced apoptosis by ectopic expression of anti-apoptotic factors. Vitam. Horm. 67: 453-483. [Medline]
  35. Nencioni, A., F. Grunebach, F. Patrone, A. Ballestrero, P. Brossart. 2007. Proteasome inhibitors: antitumor effects and beyond. Leukemia 21: 30-36. [Medline]
  36. Mitsiades, N., C. S. Mitsiades, V. Poulaki, K. C. Anderson, S. P. Treon. 2002. Intracellular regulation of tumor necrosis factor-related apoptosis-inducing ligand-induced apoptosis in human multiple myeloma cells. Blood 99: 2162-2171. [Abstract/Free Full Text]
  37. Leverkus, M., M. R. Sprick, T. Wachter, T. Mengling, B. Baumann, E. Serfling, E. B. Brocker, M. Goebeler, M. Neumann, H. Walczak. 2003. Proteasome inhibition results in TRAIL sensitization of primary keratinocytes by removing the resistance-mediating block of effector caspase maturation. Mol. Cell. Biol. 23: 777-790. [Abstract/Free Full Text]
  38. Conticello, C., L. Adamo, R. Giuffrida, L. Vicari, A. Zeuner, A. Eramo, G. Anastasi, L. Memeo, D. Giuffrida, G. Iannolo, et al 2007. Proteasome inhibitors synergize with tumor necrosis factor-related apoptosis-induced ligand to induce anaplastic thyroid carcinoma cell death. J. Clin. Endocrinol. Metab. 92: 1938-1942. [Abstract/Free Full Text]
  39. Saulle, E., A. Petronelli, L. Pasquini, E. Petrucci, G. Mariani, M. Biffoni, G. Ferretti, G. Scambia, P. Benedetti-Panici, F. Cognetti, et al 2007. Proteasome inhibitors sensitize ovarian cancer cells to TRAIL induced apoptosis. Apoptosis 12: 635-655. [Medline]
  40. Nagy, K., K. Szekely-Szuts, K. Izeradjene, L. Douglas, M. Tillman, H. Barti-Juhasz, M. Dominici, C. Spano, G. Luca Cervo, P. Conte, et al 2006. Proteasome inhibitors sensitize colon carcinoma cells to TRAIL-induced apoptosis via enhanced release of Smac/DIABLO from the mitochondria. Pathol. Oncol. Res. 12: 133-142. [Medline]
  41. Wang, S., W. S. El-Deiry. 2003. TRAIL and apoptosis induction by TNF-family death receptors. Oncogene 22: 8628-8633. [Medline]
  42. Sheikh, M. S., A. J. Fornace, Jr. 2000. Death and decoy receptors and p53-mediated apoptosis. Leukemia 14: 1509-1513. [Medline]
  43. Liu, X., P. Yue, Z. Zhou, F. R. Khuri, S. Y. Sun. 2004. Death receptor regulation and celecoxib-induced apoptosis in human lung cancer cells. J. Natl. Cancer Inst. 96: 1769-1780. [Abstract/Free Full Text]
  44. Higuchi, H., A. Grambihler, A. Canbay, S. F. Bronk, G. J. Gores. 2004. Bile acids up-regulate death receptor 5/TRAIL-receptor 2 expression via a c-Jun N-terminal kinase-dependent pathway involving Sp1. J. Biol. Chem. 279: 51-60. [Abstract/Free Full Text]
  45. Yamaguchi, H., H. G. Wang. 2004. CHOP is involved in endoplasmic reticulum stress-induced apoptosis by enhancing DR5 expression in human carcinoma cells. J. Biol. Chem. 279: 45495-45502. [Abstract/Free Full Text]
  46. Austen, M., B. Luscher, J. M. Luscher-Firzlaff. 1997. Characterization of the transcriptional regulator YY1: the bipartite transactivation domain is independent of interaction with the TATA box-binding protein, transcription factor IIB, TAFII55, or cAMP-responsive element-binding protein (CPB)-binding protein. J. Biol. Chem. 272: 1709-1717. [Abstract/Free Full Text]
  47. Gordon, S., G. Akopyan, H. Garban, B. Bonavida. 2006. Transcription factor YY1: structure, function, and therapeutic implications in cancer biology. Oncogene 25: 1125-1142. [Medline]
  48. Ahn, K. S., G. Sethi, T. Chao, S. T. C. Neuteboom. 2007. Salinosporamide A (NPI-0052) potentiates apoptosis, suppresses osteoclastogenesis, and inhibits invasion through down-modulation of NF-{kappa}B-regulated gene products. Blood 110: 2286-2295. [Abstract/Free Full Text]
  49. Miller, C. P., K. Ban, M. E. Dujka, D. J. McConkey, M. Munsell, M. Palladino, J. Chandra. 2007. NPI-0052, a novel proteasome inhibitor, induces caspase-8 and ROS-dependent apoptosis alone and in combination with HDAC inhibitors in leukemia cells. Blood 110: 267-277. [Abstract/Free Full Text]
  50. Kurbanov, B. M., L. F. Fecker, C. C. Geilen, W. Sterry, J. Eberle. 2007. Resistance of melanoma cells to TRAIL does not result from up-regulation of anti-apoptotic proteins by NF-{kappa}B but is related to down-regulation of initiator caspases and DR4. Oncogene 26: 3364-3377. [Medline]
  51. Hideshima, T., P. Richardson, D. Chauhan, V. J. Palombella, P. J. Elliott, J. Adams, K. C. Anderson. 2001. The proteasome inhibitor PS-341 inhibits growth, induces apoptosis, and overcomes drug resistance in human multiple myeloma cells. Cancer Res. 61: 3071-3076. [Abstract/Free Full Text]
  52. Richardson, P. G., P. Sonneveld, M. W. Schuster, D. Irwin, E. A. Stadtmauer, T. Facon, J. L. Harousseau, D. Ben-Yehuda, S. Lonial, H. Goldschmidt, et al 2005. Bortezomib or high-dose dexamethasone for relapsed multiple myeloma. N. Engl. J. Med. 352: 2487-2498. [Abstract/Free Full Text]
  53. Jagannath, S., B. G. Durie, J. Wolf, E. Camacho, D. Irwin, J. Lutzky, M. McKinley, E. Gabayan, A. Mazumder, D. Schenkein, J. Crowley. 2005. Bortezomib therapy alone and in combination with dexamethasone for previously untreated symptomatic multiple myeloma. Br. J. Haematol. 129: 776-783. [Medline]
  54. Aghajanian, C., S. Soignet, D. S. Dizon, C. S. Pien, J. Adams, P. J. Elliott, P. Sabbatini, V. Miller, M. L. Hensley, S. Pezzulli, et al 2002. A phase I trial of the novel proteasome inhibitor PS341 in advanced solid tumor malignancies. Clin. Cancer Res. 8: 2505-2511. [Abstract/Free Full Text]
  55. Scagliotti, G.. 2006. Proteasome inhibitors in lung cancer. Crit. Rev. Oncol. Hematol. 58: 177-189. [Medline]
  56. Papandreou, C. N., C. J. Logothetis. 2004. Bortezomib as a potential treatment for prostate cancer. Cancer Res. 64: 5036-5043. [Abstract/Free Full Text]
  57. Ruiz, S., Y. Krupnik, M. Keating, J. Chandra, M. Palladino, D. McConkey. 2006. The proteasome inhibitor NPI-0052 is a more effective inducer of apoptosis than bortezomib in lymphocytes from patients with chronic lymphocytic leukemia. Mol. Cancer Ther. 5: 1836-1843. [Abstract/Free Full Text]
  58. Williamson, M. J., J. L. Blank, F. J. Bruzzese, Y. Cao, J. S. Daniels, L. R. Dick, J. Labutti, A. M. Mazzola, A. D. Patil, C. L. Reimer, et al 2006. Comparison of biochemical and biological effects of ML858 (salinosporamide A) and bortezomib. Mol. Cancer Ther. 5: 3052-3061. [Abstract/Free Full Text]
  59. Khanbolooki, S., S. T. Nawrocki, T. Arumugam, R. Andtbacka, M. S. Pino, R. Kurzrock, C. D. Logsdon, J. L. Abbruzzese, D. J. McConkey. 2006. Nuclear factor-{kappa}B maintains TRAIL resistance in human pancreatic cancer cells. Mol. Cancer Ther. 5: 2251-2260. [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Cancer Res.Home page
S. Baritaki, K. Yeung, M. Palladino, J. Berenson, and B. Bonavida
Pivotal Roles of Snail Inhibition and RKIP Induction by the Proteasome Inhibitor NPI-0052 in Tumor Cell Chemoimmunosensitization
Cancer Res., November 1, 2009; 69(21): 8376 - 8385.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Baritaki, S.
Right arrow Articles by Bonavida, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Baritaki, S.
Right arrow Articles by Bonavida, B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS