|
|
||||||||


* Fox Chase Cancer Center, Philadelphia, PA 19111;
Department of Microbiology and Immunology, Jefferson Medical College, Thomas Jefferson University, Philadelphia, PA 19107; and
University of Tennessee, College of Medicine, Department of Molecular Sciences, Memphis, TN 38163
| Abstract |
|---|
|
|
|---|
x) in the serum of engrafted recipients. Finally, we also report evidence for ongoing L chain editing in sIgMlow transitional splenic B cells of wild-type mice. | Introduction |
|---|
|
|
|---|
L chain receptor editing appears to be initiated as soon as immature B cells encounter self-Ag. For example, in the anti-MHC class I-transgenic mouse model (8), developing B cells that encounter self-Ag show reduced expression of surface IgM (sIgM), elevated RAG expression, and secondary L chain gene rearrangement (1, 9, 10, 11). In the anti-hen egg lysozyme (HEL)/soluble HEL (sHEL)-transgenic mouse model (12), the level of IgM surface expression was shown to correlate inversely with the strength of signaling through the BCR, i.e., the stronger the self-Ag (sHEL) signal, the lower the abundance of sIgM (13). Moreover, cells with the lowest sIgM showed the highest level of secondary L chain rearrangement (13, 14). Even low surface expression of a non-self-reactive BCR has been reported to result in secondary L chain rearrangement (15). In a more recent study, Tze et al. (16) reported that interruption of basal signaling through the BCR results in apparent reversion of affected B cells to an earlier developmental stage and secondary L chain rearrangement. Reversion of immature B cells to an earlier stage during the course of normal B cell differentiation was actually suggested earlier by Mehr et al. (17) based on mathematical modeling of the kinetics of developing B cell subsets in BM.
The above findings have led to the suggestion that down-regulation of sIgM on immature B cells may directly trigger secondary L chain rearrangement (15, 16). Accordingly, one would predict that dsDNA breaks indicative of ongoing secondary L chain gene rearrangement would be present in sIgM–/low autoreactive B cells. Indeed, using a transgenic mouse model (56RV
8 mice) with tgs coding for anti-DNA Ab (4, 18), we demonstrate in this report that sIgM–/low anti-DNA B cells in BM and spleen (SPL) of 56RV
8 mice contain dsDNA breaks at their wild-type (wt)
and
L chain loci. Splenic sIgM–/low anti-DNA B cells with dsDNA breaks included those with an immature/transitional T3 cell surface phenotype (B220+CD23highCD93+sIgM–/lowsIgD+) (19) and a T3-like (T3') phenotype (B220+CD23–/lowCD93+sIgM–/lowsIgD+). T3/T3' splenic B cells were greatly overrepresented in 56RV
8 mice as these mice contained 3- to 5-fold more such cells than nontransgenic control mice. The observed dsDNA breaks in anti-DNA splenic B cells with a T3/T3' phenotype suggested that L chain editing is still ongoing outside of the BM relatively late in B cell differentiation. Consistent with such editing, we found that engraftment of SCID mice with T3/T3' splenic B cells from 56RV
8 mice along with T cells from mice lacking B cells (JH–/– mice) resulted in the appearance of a L chain editor (V
x) in the serum of engrafted recipients. Importantly, T3/T3' splenic B cells from nontransgenic wt mice were also found to contain dsDNA breaks indicative of ongoing L chain rearrangement. This finding is of particular interest because T3 splenic B cells from wt mice have been reported to represent anergic self-reactive B cells unable to give rise to mature B cells (20, 21).
| Materials and Methods |
|---|
|
|
|---|
C.B-17 scid/+ mice hemizygous for the site-directed transgenes, 3H9 or 3H9(56R) and V
8 (4, 22, 23), were produced by crossing C.B-17 scid/scid mice doubly homozygous for these tgs (e.g., 3H9/3H9, V
8/V
8, scid/scid mice) with C.B-17 wt mice. The resulting C.B-17 scid/+ mice, hemizygous for 3H9 or 3H9(56R) and V
8, are simply designated as 3H9V
8 and 56RV
8 mice, respectively. To produce mice homozygous for 56R and hemizygous for V
8 (56R/56R, V
8/+ mice), we crossed 56R/56R, V
8/V
8 wt mice with 56R/56R, scid/scid mice. Similarly, to produce mice hemizygous for 56R and homozygous for V
8 (56R/+, V
8/V
8 mice), we crossed 56R/56R, V
8/V
8, scid/scid mice with V
8/V
8 wt mice. C.B-17 scid/+ mice served as nontransgenic controls. Genotyping of transgenic mice was done by PCR as described previously (22, 23, 24). Investigators interested in obtaining mice homozygous for the tgs reported here should contact the Mutant Mouse Regional Resource Center (www.mmrrc.org). All of the mice used in this study, including BALB/c scid/scid (SCID mice), C57BL/6, (C57BL/6 x BALB/c)F1 mice, and C.B-17 mice with deleted JH loci (JH–/– mice) (25), were raised and maintained behind a barrier as specific pathogen-free mice in the Laboratory Animal Facility of the Fox Chase Cancer Center. Mice were used between 8 and 12 wk of age (unless otherwise stated) according to the protocols approved by the Animal Care and Use Committee of this institution.
B cell hybridomas
SPL cells from a 5-mo-old 56RV
8 mouse were stimulated with LPS (50 µg/ml) for 2 days and then fused with Sp2/0 cells (26) as described previously (27). Screening of culture supernatants by ELISA showed all hybridomas to produce IgM. The IgM protein in hybridoma supernatants was purified by precipitation in 60% saturated (NH4)2SO4 followed by size fractionation of the precipitated IgM using Amicon Ultra-15 Centrifugal Filter Units (Millipore). Purified hybridoma proteins were used for IgM allotyping, anti-dsDNA-binding assays and mass spectrometry. The anti-V
x-producing hybridoma, 10C5 (28) was generously provided by P.-A. Cazenave (Institute Pasteur, Paris, France). It was grown in a CELLine Bioreactor System (Integra Biosciences) and the Ab was purified using a Melon Gel IgG Purification Kit (Pierce) as directed by the manufacturer.
Flow cytometry
Cell suspensions of BM and SPL were prepared and stained in the manner previously described (29, 30). Cells were stained for CD43, CD45 (B220), IgM, IgMa, IgMb, IgDa, CD23, CD93, and V
x using combinations of the following reagents: fluorescein (FL)-anti-CD43 (S7), allophycocyanin-anti-B220 (RA3–6B2), FL-anti-IgDa (AMS9.1), FL-anti-IgM (331.12), biotin-anti-IgM (331.12), FL-anti-IgMa (RS3.1), biotin-anti-IgMb (AF6-78), biotin-anti-V
x (10C5), Cy7PE-anti-CD23 (B3B4), and PE-anti-CD93 (AA4.1). Biotin-conjugated reagents were visualized by a second-step incubation with QDot605-streptavidin (Invitrogen). Biotin-anti-IgMb (AF6-78), Cy7PE-anti-CD23, PE-anti-CD93, and FL-anti-IgDa were obtained from BD Pharmingen. All other Ab reagents were prepared in this laboratory. Analyses were performed with FACSVantageSE/Diva and LSRII flow cytometers (BD Biosciences) using FlowJo software (Tree Star). All cytometric dot plots are based on the analysis of 105 cells for the indicated gates. Forward and side scatter were set to exclude nonlymphoid cells. Propidium iodide staining was used to exclude dead cells.
Induction of apoptosis and confocal microscopy
Apoptosis of Jurkat cells was induced for 4 h by the addition of 2.0 µM camptothecin (Sigma-Aldrich). At the end of the incubation period, 5 x 105 cells were collected and used in each binding reaction. Cells were washed in HBSS (Mediatech) with 3 mM CaCl2 and fixed in freshly prepared, ice-cold 6% paraformaldehyde (Electron Microscopy Sciences) in the same buffer for 15 min. Fixed cells were washed in HBSS and 3 mM CaCl2, pelleted at 1600 rpm for 5 min. and blocked by resuspension in wash buffer (HBSS containing 3 mM CaCl2, 3% FBS, and 0.02% azide) for 5 min. Cells were pelleted again and resuspended in 20 µg/ml of the primary Ab in wash buffer. Following a 30-min incubation with the primary Ab, cells were washed in wash buffer, pelleted as above, and incubated in a mixture of Alexa Fluor 647 goat anti-mouse IgM (µ-chain- specific) antisera (1/100 dilution), SYTOX Orange DNA stain (1/10,000 dilution), and Alexa Fluor 488/annexin V (1/70 dilution). All secondary reagents and stains were obtained from Invitrogen. Following incubation on ice for 20 min., cells were washed and resuspended in wash buffer containing 50% glycerol before mounting on 24-well, Teflon-printed microscope slides (Electron Microscopy Sciences).
Samples were viewed on a Zeiss LSM 510 laser scanning microscope by using a x40 Plan-Apochromat oil-immersion lens and excitation at 488, 543, and 633 nm. Detection channels recorded fluorescence emission above 650 nm for Alexa Fluor 647 (displayed as red for consistency with our previous experiments), between 560 and 615 nm for SYTOX Orange (displayed as blue), and between 505 and 530 nm for Alexa Fluor 488 (displayed as green). Stacks of images were collected using between 20 and 30 optical sections taken at intervals of between 0.4 and 0.8 µm.
Serological assays
Hybridoma supernatants were screened by ELISA for the expression of IgM, IgMa, IgMb, Ig
, Ig
1 (from BD Pharmingen), and V
x using purified mAbs. Assays were performed as described earlier (24) using solutions, buffers, and standards prescribed by BD Pharmingen. Hybridomas secreting IgM molecules that reacted with both anti-IgMa (RS 3.1) and IgMb (AF6-78) were detected using a sandwich ELISA protocol. The protocol involved coating plates with anti-IgMa to allow the binding of IgMa; this was followed by the addition of biotinylated anti-IgMb. To detect IgM anti-dsDNA Ab, we used the ELISA protocol previously described (24). To assay for serum IgV
x, plates were coated with purified anti-V
x (10C5) followed by the addition of 5-fold diluted sera and biotinylated anti-V
x. Purified IgM from the hybridoma C6 (see Fig. 9A) was used as the standard for quantitation of serum V
x.
|
DNA was prepared from B cell hybridomas: Briefly, cells grown in 24-well plates were harvested by spinning the plates at 1200 rpm for 3 min and washing the cells in 500 µl of PBS (pH 7.4). Washed cells were resuspended in 300 µl of lysis buffer (31) and incubated overnight at 56°C. The next day, lysed cell samples were boiled for 15 min and stored at 4°C. PCR assays were done in a 50-µl volume containing 2 µl of template DNA and 1 U of Platinum TaqDNA polymerase (Invitrogen). For PCR amplification of the 56R tgs, we used the protocol described by Erikson et al. (32) and primers specific for the 56R leader (5'-CTGTCAGGAACTGCAGGTAAGG) and 56R CDR3 region (5'-CATAACATAGGAATATTTACTCCTCGC). To amplify recombining sequence (RS)-mediated rearrangements at the
locus. a combination of primers was used as described by Retter and Nemazee (6) including primers specific for regions 3' of the RS element (MB 619; 5'-ACATGGAAGTTTTCCCGGGAGAATATG) and 5' of the IRS1 element (5'-CAACCTCTTCTTTACAACTGGGTGACC) and primers specific for the V
framework region 3 (5'-GGCTGCAGSTTCAGTTGGCAGTGGRTCWGGRAC) (31) and the V
8 leader (GGTACCTGTGGGGACATTGTG) (32). To score for DH to JH rearrangement at the wt H chain allele, we used a degenerate primer (5'-GGAATTCGMTTTTTGTSAAGGGATCTACTACTGTG) for DH (33) and primers 3' of JH2 (5'-GGCTCCCAATGACCCTTTCTGA) or JH4 (5'-CTGTCCTAAAGGCTCTGAGATCC). Unrearranged wt H chain alleles were scored by retention of germline sequence upstream of JH1 using the forward (5' JH1) and reverse (3' JH1) primers, 5'-GCCAAGGACTTACCAAGAGG and 5'-GATGCAGGACTCACCTGACC (22), respectively.
Ligation-mediated PCR (LM-PCR)
Genomic DNA samples for LM-PCR were prepared from cells embedded in agarose as described previously (34). Linker ligation was performed with one-quarter of an agarose block (35). Broken molecules with recombination signal ends were amplified from linker-ligated DNA using one-tenth of the linker ligation reaction and the linker primer (5'-GCTATGTACTACCCGGGAATTCGTG) and a locus-specific primer. J
signal ends were amplified with the 5' J
-specific primer (5'-AGTGCCACTAACTGCTGAGCCACCT) and V
x signal ends were amplified with a 3' V
x-specific primer (MB719; 5'-AACATTGTGGCTGTCTCAGTGGCTCA). J
coding ends were amplified with a 3' J
1-specific primer (5'-TCTCCAGAGAACATGTCTAGCC) using DNA pretreated with T4 DNA polymerase. RS
-associated breaks were amplified with a 5' RS
-specific primer (MB615; 5'-CAGAAATGAAGGCAGACTCTCTCTAAC). The PCR conditions were 35 of 20 s at 95°C and 30 s at 63°C for DNA breaks at J
or 65°C for DNA breaks at V
x and 30 s at 72°C, with a final 5-min extension at 72°C (see Figs. 3B and 4B). To control for the amount of DNA in each linker-ligated sample, the β2-microglobulin (β2m) gene was amplified for 25 cycles using a 5' (5'-GAATGGGAAGCCGAACATACTGAACTG) and 3' (5'-TGCTGATCACATGTCTCGATCC) primers with a cycle profile of 30 s at 95°C, 30 s at 61°C, and 45 s at 72°C.
|
|
LM-PCR products were subjected to agarose gel electrophoresis, transferred to nylon membranes, and hybridized to random-primed 32P-labeled probes generated from gel-purified DNA fragments in the manner described earlier (35). The J
probe was a 1.7-kb fragment from pJ
and spans the J
region (36). The V
x probe, containing
500 bp of 3' flanking sequence and confirmed by DNA sequence analysis, was a 745-bp fragment amplified from genomic liver DNA with oligonucleotides 5'-ACCTTGAGTAGTCAGCACAG (specific for the V
x exon) and MB719. The RS
probe was a 398-bp fragment amplified from genomic liver DNA with oligonucleotides MB615 and MB619. The β2m probe was made using the β2m- specific primers indicated above and gel purified. Clones for nucleotide sequence analysis were produced using the TOPO TA cloning kit (Invitrogen) and underwent plasmid recovery using a Perfectprep plasmid mini kit (Brinkman Instruments). Plasmids were submitted for cycle sequencing using the Applied Biosystems Prism dye terminator reaction kit and a model 3100 genetic analyzer (Applied Biosystems).
Quantitative RT-PCR assay
Total RNA was prepared using a Micro RNAeasy kit according to the manufacturers protocol (Qiagen). cDNA was synthesized by adding 2 µl of oligo(dT)18 primer (50 µM; Ambion) to 10 µl of total RNA, heating at 70°C for 3 min, cooling on ice, adding 2 µl of reverse transcriptase (RT) buffer (Ambion), 1 µl of dNTPs (each dNTP at 10 mM; Invitrogen), 0.6 µl of Superase-in (20 U/µl; Ambion), and 1 µl of ArrayScript RT (200 U/µl; Ambion), and then incubating at 42°C for 1 h. Gene expression was quantitated by real-time PCR. Analyses were performed in triplicate in 25-µl volumes using an Applied Biosystems I7500 thermal cycler. The cDNA was typically diluted 1/3. All probes were purchased from Applied Biosystems. Applied Biosystems software was used to quantify/calculate cycle threshold values and to determine relative gene expression levels using β-actin values for standardization.
SMART 5' RACE assay
Total RNA from 1 x 106 hybridoma cells was obtained using RNAeasy (Qiagen) and mRNA was isolated using Oligotex (Qiagen) according to the manufacturers instructions. Full-length cDNA was synthesized using a modified version of the SMART (switching mechanism at 5' end of RNA transcript) technique (37) with one-tenth of the mRNA, PowerScript RT (BD Biosciences), 1.2 mM SMART oligonucleotide (5'-d(AAGCAGTGGTAACAACGCAGAGTAdCGC)ggg; Biosearch Technologies), 1 mM dNTP mixture (Invitrogen), and 5 µM oligo(dT) primer (Ambion) in a 10-µl reaction volume. The Ig cDNA was amplified via 5' RACE-anchored RT-PCR using an Advantage 2 PCR kit (BD Clontech), 5' Universal primer mix (40 nM 5'-CTAATACGACTCACTATAGGGCAAGCAGTGGTAAACAACGCAGAGT and 200 nM 5'-CTAATACGACTCACTATAGGGC) along with a reverse primer complementary to the constant region of the µ (5'-ATGCTCTTGGGAGACAGCAAGACCTGCG)- or
(5'-CTCGTCCTTGGTCAACGTGAGGGTGCTG)- chain. The 5' RACE RT-PCR conditions were: 95°C, 30 s, 5 cycles of 95°C for 5 s and 72°C for 1 min, then 5 cycles of 95°C for 5 s, 70°C for 10 s, 72 °C for 1 min, and finally 25 cycles of 95°C for 5 s, 68°C for 10 s, and 72°C for 1 min with a final extension time of 5 min at 72°C.
Mass spectrometry
Purified IgM from supernatants of B cell hybridomas was reduced and subjected to 10% SDS-PAGE. The gels were stained with colloidal Coomassie blue and the L chains were excised and digested with trypsin after destaining, reduction, and alkylation (38, 39). Recovered peptides were prepared for MALDI-TOF mass spectrometry by mixing 1 µl of the peptide mixture with 2 µl of 30 µg/ml
-cyano-4-hydroxycinnamic acid and 0.4% trifluoroacetic acid in a 2:1 ethanol:acetone mixture and allowing the droplet to dry on the MALDI sample plate (40). In some cases, the
-cyano-4-hydroxycinnamic acid-affinity sample preparation was used to improve sensitivity (41). Peptide mass maps were obtained using a Bruker Daltonics Reflex IV MALDI-TOF mass spectrometer operated in positive ion reflectron mode. Proteins were identified from the peptide mass maps using Mascot (Matrix Science) (42) to search the protein sequence databases. A special protein database comprised of all know mouse L chain V, J, and C regions was constructed using the ImMunoGeneTics (IMGT) database (http://imgt.cines.fr/textes/IMGTrepertoire/Proteins/#1).
| Results |
|---|
|
|
|---|
In 3H9(56R)/+, V
8/+-transgenic mice, the model system used in this study, the J regions of one H and L (
) chain allele have been replaced with VDJH and VJ
coding sequences of the 3H9(56R) and V
8 tgs (4, 23, 43). H chains coded by 3H9(56R) differ from those coded by 3H9 by one amino acid; the 3H9 chain contains aspartate at position 56, whereas 3H9(56R) has arginine at this position (4). Together, 3H9(56R) and V
8 code for a relatively high-affinity anti-DNA Ab, whereas 3H9 and V
8 code for a low-affinity anti-DNA Ab (18). In this study, we used H/L chain-transgenic C.B-17 scid/+ mice hemizygous for the above tgs; i.e., 3H9(56R)/+, V
8/+, scid/+ and 3H9/+, V
8/+, scid/+ mice. The mice are simply designated with the prefix 56RV
8 and 3H9V
8, respectively. C.B-17 scid/+ mice were used as the nontransgenic control; the scid mutation is recessive and these mice have a wt phenotype (44, 45). In some experiments, we included H/L chain-transgenic C.B-17 scid/+ mice homozygous for 56R (56R/56R, V
8/+, scid/+ mice) or V
8 (56R/+, V
8/V
8, scid/+ mice).
Skewed representation of B cell subsets in 56RV
8 mice
The primary question posed in this study was: when and where do developing anti-DNA B cells in 56RV
8 mice undergo L chain receptor editing? To address this question, it was of interest to know whether the normal representation of pro-B, pre-B, and immature/transitional B cell subsets in BM and SPL is markedly altered in 56RV
8 mice. As shown in Figs. 1 and 2, there were marked differences in the representation of these B cell subsets in 56RV
8 mice vs 3H9V
8 and nontransgenic control mice (wt mice). Such differences were most striking in the SPL. For example, in 56RV
8 mice,
10% of the sIgM– gated lymphocytes (arrow in Fig. 1) stained positive for B220 (B220+CD43–sIgM– cells). In contrast, in wt and 3H9V
8 mice, the corresponding B220+CD43–sIgM– cell population represented
0.5% of sIgM– gated lymphocytes. Using the additional B cell lineage markers, CD23 (46), CD93 (47), and surface IgD (sIgD), we found most B220+sIgM–/low cells in the SPL of 56RV
8 mice to display a T3 or T3-like immature/transitional phenotype (Fig. 2). Transitional splenic B cells can be defined as T1, T2, or T3 according to their relative surface expression of IgM, IgD, CD21, CD23, CD24, and CD93 (19, 47, 48, 49). We used the markers B220, CD23, CD93, sIgM, and sIgD to delineate T1, T2, and T3 splenic B cells as designated by Allman et al. (19). The gates used to define B220+CD93+ transitional B cells in the SPL of 3H9V
8, 56RV
8, 56RV
8 RAG1–/– and wt mice are shown in Fig. 2, A and B. The CD93 staining of splenic B220+ cells (horizontal bar in Fig. 2B) in wt and transgenic mice was less uniform and intense than that of pre-B cells from wt BM (denoted by the dashed histogram).
|
|
8 mice displayed a T3 (CD23highIgM–/lowsIgD+) or T3-like (CD23–/lowIgM–/lowsIgD+) transitional phenotype (Fig. 2C). Cells displaying the latter phenotype will be simply referred to as T3' cells, although it remains to be determined whether this novel cell population corresponds to an additional subset of nondividing transitional cells. Both T3 and T3' cells were RAG active (Fig. 3A) and, consistent with the phenotype of T3 cells (19), were also CD21+ and CD24+ (our unpublished results in collaboration with R. Hardy). Note that sIgD, unlike sIgM, showed little down-regulation in T3 and T3' splenic B cells of 56RV
8 mice and was displayed at a level only slightly less than that of sIgD on T2 cells of 3H9V
8 mice (see histograms in lower row of Fig. 2C). This finding is similar to that reported earlier by Goodnow et al. (12) in the anti-HEL/sHEL-transgenic mouse model in which anti-HEL splenic B cells showed persisting sIgD despite markedly reduced levels of sIgM. Finally, it should be noted that T1/T2 cells were underrepresented and T3/T3' cells were overrepresented in 56RV
8 SPL compared with 3H9V
8 and wt controls (Fig. 2C). The mean percentages (±SEM) of T1, T2, T3, and T3' splenic B cells for all mice analyzed, including C57BL/6 wt mice, are given in Table I. As discussed later, one possible explanation of these results is that expression of the strongly self-reactive 56RV
8 receptor may cause most arising T1 and T2 B cells in C.B-17 mice to down-regulate their sIgM and display a T3' and T3 cell surface phenotype.
|
8 mice is ongoing in BM and SPL
To test whether L chain receptor editing was ongoing in both BM and SPL of 56RV
8 mice, we sorted pro-B (B220+CD43+IgM–), pre-B (B220+CD43–IgM–), and B (B220+IgMlow) cells from BM and immature/transitional T3 (B220+CD23highCD93+ IgM–/low), T3' (B220+CD23–/lowCD93+IgM–/low) and B (B220+IgM+) cells from SPL. These B cell subsets were first compared for RAG expression relative to that in sorted pro-B cells from wt mice using real-time quantitative RT-PCR. Since similar results were obtained for both RAG1 and RAG2 expression, we show the results for RAG1 only in Fig. 3A. Strikingly, RAG expression in B lineage cells of 56RV
8 BM was strongly up-regulated in the pre-B but not the pro-B subset. The basis for relatively low RAG expression in 56RV
8 pro-B cells is not clear. However, because these cells contain a prerearranged H chain gene, there would be no need for strong up-regulated RAG expression at the pro-B cell stage. RAG expression in B cells of 56RV
8 BM was
7% of the level of that in the wt pro-B cells. In the SPL, RAG expression was strongly up-regulated in T3' B cells and
8-fold higher than in T3 B cells. In splenic B cells of 56RV
8 mice, RAG expression was
1% of that in wt BM pro-B cells.
We next tested sorted B cell subsets from 56RV
8 mice for ongoing secondary L chain rearrangement as indicated by the presence of dsDNA breaks at the wt
allele and the V
x gene. V
x is a known editor of 56R anti-dsDNA Ab (18, 50). LM-PCR (51, 52) was used to detect dsDNA breaks at the borders of J
and V
x coding elements and their associated recombination signal sequences. RAG-mediated cleavage of DNA results in two species of broken molecules (recombination intermediates): those with signal ends and those with coding ends (reviewed in Ref. 53). In 56RV
8 BM, J
signal ends appeared most abundant in the pre-B and B cell fractions; the pro-B cell fraction contained relatively few J
signal ends (Fig. 3B, bracket I). Similar results were obtained for J
coding ends (Fig. 3B, bracket II). Note, however, that coding ends were not detectable in the pro-B cell fraction, a finding that may in part reflect the shorter half-life of coding vs signal ends (54). J
signal and coding ends were also detectable in T3 and T3' splenic B cells (and the less stringently sorted cell fraction of splenic B220+sIgM– cells). Coding ends are rapidly joined during V(D)J recombination (55, 56). Thus, the presence of coding ends in RAG-active T3/T3' splenic B cells is taken as evidence that the observed recombination intermediates were directly generated in these cell populations as opposed to being carried over from an earlier stage of differentiating B cells.
As expected, no J
signal or coding ends were detected in the pre-B cell subset from 56R/+, V
8/V
8 mice (see BM V
8/V
8 lane in Fig. 3B, brackets I and II). In these mice, the J
region of both alleles contains the inserted V
8J
5 coding segment (23); thus, there is no J
substrate available for RAG targeting. Nonetheless, the
locus in 56R/+, V
8/V
8 mice was clearly targeted by the recombinase machinery as indicated by dsDNA breaks at the RS downstream of C
(57, 58) (Fig. 3B, bracket III). dsDNA breaks were not limited to the
locus because we also found dsDNA breaks at the V
x gene in BM pre-B/B cells and T3/T3' splenic B cells (Fig. 3B, bracket IV). Sequencing of V
x products amplified by LM-PCR confirmed that they corresponded to DNA molecules cleaved at the V
x coding/signal border (our unpublished data). From the results of Fig. 3 it is clear that, in 56RV
8 mice, secondary L chain rearrangement is not only ongoing in BM cells with a pre-B/B cell phenotype, but also outside of the BM in splenic B cells with a T3/T3' phenotype.
To test for possible ongoing L chain rearrangement in T3/T3' splenic B cells of nontransgenic wt mice, we sorted these cell populations from the SPL of C57BL/6 mice and tested for dsDNA breaks at the signal/coding border of J
elements (Fig. 4). We chose C57BL/6 mice because T3 splenic B cells in these mice have been reported to represent mainly anergic self-reactive B cells (20, 21). As indicated in Fig. 4A, T3/T3' splenic B cells from C57BL/6 mice were less abundant and showed less down-regulation of sIgM than from 56RV
8 mice. Following three independent sorts for T3/T3' splenic B cells from C57BL/6 mice, we obtained sufficient material to assay for J
recombination intermediates. Fig. 4B shows that J
signal ends were present in the T3/T3' splenic B cell populations of C57BL/6 mice at a level comparable to that seen in the 56RV
8 controls. We interpret these results to indicate that the T3/T3' splenic B cell populations in wt mice, as in 56RVk8 mice, contain B cells undergoing L chain editing. As discussed later, some of these B cells may succeed in editing their Ag receptor and give rise to mature B cells. Splenic B cells with a T1 and T2 phenotype were also sorted from C57BL/6 mice and found to contain J
signal ends (Fig. 4B), consistent with a recent report of J
signal ends in the T1 and T2 splenic B cells of nontransgenic C.B-17 mice (59). Thus, with respect to the presence of J
recombination intermediates, the splenic B cell populations T1 and T2 appear similar to T3 and T3'. As functionally immature B cells, members of the T1-T3 subsets also appear similar with respect to their unresponsiveness to BCR stimulation and rapid turnover (19).
Detection of L chain-edited B cells in SPL but not BM of 56RV
8 mice
Consistent with the detection of dsDNA breaks at the wt
allele and V
x gene, two distinct populations of L chain-edited B cells were readily detectable in the SPL but not the BM of 56RV
8 mice. One population expressed V
x (see diagonal profile marked with an arrow in Fig. 5A) and represented
6% of the B220+ gated cells and
14% of all IgMa-expressing splenic B cells. Note that
3% of V
x-expressing cells displayed little or no sIgMa; these cells were found to be sIgDhigh for the IgDa allotype (our unpublished data). V
x-expressing B cells were not detectable in 3H9V
8 mice or in wt mice. Thus, the development of V
x-expressing B cells in 56RV
8 mice is clearly dependent on the 56R tg.
|
x-expressing B cells can differentiate into V
x-producing plasma cells is shown in Fig. 5B. 56RV
8 mice contained very low, but detectable levels of serum V
x (0.42–1.42 µg/ml), whereas most 3H9V
8 mice lacked detectable serum V
x (
0.02 µg/ml; Fig. 5B). No serum V
x was detectable in C.B-17 scid/+ mice, the nontransgenic control (our unpublished results), consistent with previous reports of little or no detectable V
x protein in normal mice (28, 50). To test whether the T3 and T3' subsets contained cells able to differentiate into V
x-producing plasma cells, we transferred sorted T3 and T3' cells into SCID recipients in the manner previously described (24). Recipients also received a mixture of BM and thymus cells from C.B-17 JH–/– mice to provide a source of T cell help for any successfully V
x-edited B cells that might arise from the T3 and T3' cell populations. Serum V
x was detectable 5 wk after cell transfer and, as shown in Fig. 5B, all but one recipient was found to contain low levels of serum V
x (0.15–9.8 µg/ml) at 7 and 9 wk after cell transfer. No serum V
x was found in the SCID controls engrafted with C.B-17 JH–/– donor cells only. These results indicate that the T3 and T3' splenic B cell populations contain cells capable of giving rise to edited V
x-producing B cells.
The SPL of 56RV
8 mice also contained a V
-edited cell population that was evident from an unexpected cross-reaction with the AF6-78 monoclonal anti-IgMb reagent (Fig. 6). In the course of testing for possible H chain editing (i.e., expression of the wt allotype (IgHb) instead of the tg allotype (IgHa)), we found
14% of B220+ gated SPL cells in 56RV
8 mice (designated as 56R/+, V
8/+ mice in Fig. 6) to stain positive for both sIgMa and sIgMb; 35–43% of the remaining B220+ gated cells stained for sIgMa only and 8–9% stained for sIgMb only. The doubly stained cells represented 25–30% of cells expressing the sIgMa allotype; B cells staining positive for both sIgMa and sIgMb or for sIgMb alone were not detectable in 56RV
8 BM or in SPL of 3H9V
8 mice. Further analysis revealed the presence of the doubly stained B cell population in mice homozygous for 56R and hemizygous for V
8 (56R/56R, V
8/+ mice). The genetic makeup of these mice would preclude any ability to express the IgMb allotype. Strikingly, no doubly stained B cells were detected in mice genetically competent to express both IgMa and IgMb allotypes, i.e., in mice hemizygous for 56R and homozygous for V
8 (56R/+, V
8/V
8 mice). From these results, we inferred that B cells doubly stained for sIgMa and sIgMb express an IgMa molecule with a L chain editor coded by the wt
allele and that expression of this editor makes such molecules cross-reactive with the AF6-78 anti-IgMb reagent. Validation of this inference and identification of the L chain editor as V
21D is given in the next section. It is important to note here that V
21D appears not to be used in 3H9V
8 mice even though it has been shown to edit (veto) the ability of 3H9-coded H chains to bind dsDNA (4). Splenic B cells doubly stained for sIgMa and sIgMb were not detectable in 3H9V
8 mice (Fig. 6). We interpret these results and those of Fig. 5 to reflect little or no L chain editing in 3H9V
8 mice, consistent with an earlier report by Casellas et al. (7) showing 3H9V
8 mice to lack
- and
-edited B cells.
|
8 splenic B cell hybridomas
To test for the representation and identity of L chain editors in individual B cells, we fused SPL cells from a single 56RV
8 mouse with the SP2 cell line (26). Twenty-six hybridomas were obtained and all secreted IgM (Table II). Hybridoma culture supernatants were screened by ELISA for expression of the H chain allotype of the 56R (IgMa) and wt (IgMb) alleles; 13 typed positive for IgMa (groups A and C) and 6 for IgMb (group D). Seven hybridomas typed positive with both anti-IgMa and anti-IgMb (group B). Purified IgM from culture supernatants was analyzed by ELISA to confirm the cross-reactivity of secreted IgM molecules recognized by both anti-IgMa and anti-IgMb (results shown in Table II). Extensive analysis of the hybridomas in group B showed they all retained an unaltered 56R tg (see B1–7 in Fig. 8B) and lacked a productive VDJ rearrangement at their wt H chain allele (our unpublished data). Thus, they could not have actually produced IgMb; instead, they appeared to produce IgMa molecules that cross-reacted with the anti-IgMb reagent as was also inferred for splenic B cells doubly stained for IgMa and IgMb in Fig. 6.
|
|
8 and the two major L chain editors of anti-dsDNA Ab: V
x and V
21D (4, 18, 50). Screening was done by mass spectrometric analysis of the L chains in purified IgM molecules from each hybridoma. Distinguishing mass spectra "signature" peptides for V
8, V
21D. and V
x are shown in Fig. 7A. As indicated, the IgM secreted by hybridomas A1–4, B1–7, and C1–7 contained L chains with V
8, V
21D, and V
x variable regions, respectively. Two hybridomas produced IgM molecules containing two L chains, one with V
8 and V
x and the other with V
x and V
1 (our unpublished results). To confirm our mass spectrometric typing results, we used the SMART 5' RACE assay to synthesize full-length cDNA from members of groups B and C and sequenced the expressed rearranged
gene in B3, B4, and B5 and the rearranged V
x gene in C1–7. Among all tested members of groups B and C, we recovered L chain sequences corresponding to a V
21D and V
x gene, respectively (Fig. 7B). Thus, all seven hybridomas (B1–7) that secreted IgMa molecules cross-reactive with AF6-78 anti-IgMb (shown in Table II) were found to express V
21D instead of V
8. Based on the results in Figs. 4–6, we estimate that V
x- and V
21D-edited B cells represent
40% of IgMa-expressing splenic B cells in 56RV
8 mice.
|
constant region gene (57, 58). Using primers specific for the V
8 leader, J
C
intronic recombining sequence (IRS1) and RS (see Materials and Methods), we recovered PCR products corresponding to an IRS1-RS rearrangement at the tg allele in all V
x-expressing hybridomas of group C (Table III). We also recovered V
-RS rearrangements at the wt
allele in four members of group C using primers specific for RS and the V
framework 3 region. Thus, expression of V
x in the 56RV
8 B cell hybridomas was found to correlate with a RS-mediated deletion of C
at the V
8 allele, consistent with earlier findings that
-expressing B cells frequently show RS-mediated deletions of C
(57, 58). Rearrangements involving RS were also observed in four of seven V
21D-expressing hybridomas (Table III).
|
21D- and 56RV
x-expressing hybridomas represent multiple B cell clones
Because most of the hybridomas in groups B and C showed indistinguishable V
21D-J
and V
x-J
rearrangements, respectively (Fig. 7B), and all retained an unaltered 56R tg (Fig. 8B), we considered that they may have represented only a few clones of expanded B cells. However, when we examined the status of the wt H chain allele in these hybridomas, we found clear evidence of multiclonality (Fig. 8A). Five distinct B cell clones were represented among the seven hybridomas in the V
21D series; i.e., three showed different DJ rearrangements or junctions (B1, B4, and B5b), four were clonally related and contained the same DJ rearrangement (B2, B3, B5a, and B6), and one retained a germline H chain allele (B7). Seven distinct cell clones were represented among the hybridomas in the V
x series; six contained different DJ rearrangements or junctions (C1, C2, C4a, C4b, C5, and C7) and one retained a germline H chain allele (C6). Therefore, most V
21D- and V
x-expressing B cell hybridomas were clonally distinct and represented independently edited B cells.
IgM molecules secreted by 56RV
21D- and 56RV
x-expressing hybridomas retain specificity for DNA
To test the effect of V
21D and V
x on the ability of the 56R H chain to bind dsDNA, we compared the relative anti-dsDNA binding of IgM from hybridomas in groups A, B, and C. This comparison was done with the same purified IgM preparations used for ELISA and mass spectrometric analysis of L chains in Table I and Fig. 7. The relative binding of IgM to dsDNA was plotted as a function of the concentration of IgM added to wells containing biotinylated dsDNA attached to avidin D. As shown in Fig. 9A, all tested IgM preparations from the V
21D and V
x series retained binding specificity for dsDNA but showed less affinity for dsDNA than IgM preparations from members of the V
8 group (A1–4). The binding curves for members of the V
21D group (B1–7) were displaced
5- to 8-fold to the right of those for the V
8 group. IgM from B2 and B6 gave similar binding curves consistent with our evidence that these hybridomas represented one and the same clone (Fig. 8). With one exception, the binding curves for members of the V
x group (C1–7) were displaced
50- to 100-fold to the right of those for members of the V
8 group. The one exceptional member (C2) showed much stronger binding to dsDNA than other members in this group. Interestingly, the V
x-J
2 junction of C2 contained two additional amino acids (tyrosine and asparagine) not present in other members of the group (Fig. 7B). Thus, the lengthening of the V
x-J
2 junction by these two amino acids correlated with an increased strength of anti-dsDNA binding. IgM from all six of the 56RV
8 hybridomas that produced IgMb failed to bind dsDNA; this is illustrated for two such hybridomas in the top panel of Fig. 9A. Our binding results are consistent with those of Doyle et al. (60) who also found 56RV
x-expressing B cell hybridomas to produce Ab with specificity for dsDNA, but they differ from those of earlier reports showing the V
21D and V
x editors to inhibit completely the binding of 56R to dsDNA (4, 18, 50). The basis for the difference is unclear.
IgM molecules secreted by 56RV
21D- and 56RV
x-expressing hybridomas bind apoptotic cells
Because 56RV
21D- and 56RV
x-expressing hybridomas secreted IgM Abs that bind dsDNA, albeit with low affinity, it was of interest to know whether these Abs would also bind to apoptotic Jurkat cells since anti-dsDNA Abs often bind to apoptotic cells (61). Specific targets of anti-dsDNA Abs include blebs formed by the protrusion of nuclear fragments from the cell surface. Anti-dsDNA Abs may also cross-react with phospholipid structures associated with the inner plasma membrane that become externalized during apoptosis (61, 62, 63, 64, 65). As shown in Fig. 9B, IgM Abs from 56RV
8-, 56RV
21D-, and 56RV
x-expressing hybridomas showed preferential binding to apoptotic cells over live cells, although the pattern of Ab binding to apoptotic cells was distinct for each group of hybridomas. No appreciable IgM binding to apoptotic (or live) cells was evident with the nonspecific IgM
control (11E10). 56RV
8 Abs seemed to bind focal sites on apoptotic plasma membranes, possibly reflecting the recognition of phospholipid domains whose distribution in the membrane was altered by apoptosis (see A4, Fig. 9B). In contrast, 56RV
21D Abs displayed a preference for individual apoptotic blebs surrounding nuclear fragments or associated with the plasma membrane (B1 and B7, Fig. 9B). 56RV
x Abs showed relatively sparse binding to the plasma membrane, yet bound dispersed sites in the cytoplasm (C2 and C3, Fig. 9B). Unlike authentic anti-DNA autoantibodies (61), none of the above Abs bound to the surface of nuclear fragments, implying that these Abs do not recognize DNA-histone, subnucleosomal complexes, or intact nucleosomes.
| Discussion |
|---|
|
|
|---|
Using sorted B cell subsets from 56RV
8 mice and scoring for dsDNA breaks at the wt
allele and V
x gene, we obtained direct evidence for ongoing secondary L chain rearrangement in BM and splenic anti-DNA B cells. In the BM, dsDNA breaks were prominent in the B cell fraction (B220+sIgMlow) and in cells displaying a pre-B phenotype (B220+CD43–IgM–). With little or no cell surface Ag receptor, it is not obvious how sIgM–lo cells in 56RV
8 BM could have been directly induced by self-Ag to undergo L chain rearrangement. Thus, we suggest these cells represent immature anti-DNA B cells that down-regulated their expression of sIgM due to encounter with self-Ag and then greatly elevated RAG expression. L chain editing may be initiated at the onset of Ag encounter and then continue in cells with down-regulated sIgM, consistent with our finding of abundant dsDNA breaks in both B220+sIgMlow and B220+sIgM– BM B lineage cells (Fig. 3B). Cells that fail to edit their Ag receptor successfully are presumably deleted, consistent with earlier evidence for deletion of anti-DNA B cells at the pre-B/B transitional stage (66).
In the SPL, dsDNA breaks were detectable in sIgM–low anti-DNA B cells with a T3 and T3' phenotype. The immediate source of T3/T3' splenic B cells in 56RV
8 mice is not clear and could be BM and/or SPL. These cells might, for example, represent immature/transitional anti-DNA B cells that encountered self-Ag in the BM, down-regulated their sIgM, and then emigrated to SPL where they continued to undergo secondary L chain rearrangement as T3/T3' cells. Alternatively, these cells could derive from immature/transitional anti-DNA B cells that encountered self-Ag in the SPL and then rapidly down-regulated expression of their sIgM (e.g., from that of a T1 cell to that of a T3' cell). Although T3/T3' anti-DNA B cells were deficient for sIgM, they nonetheless expressed intermediate levels of sIgD (Fig. 2C), consistent with the previously described phenotype for T3 cells (19). Since this IgD receptor (sIgDa) would have the same anti-self specificity as sIgMa, it remains an open question as to whether it plays a role in signaling L chain editing in transitional anti-DNA splenic B cells.
RAG expression and L chain editing in the SPL have been reported earlier in immunized mice (67, 68, 69, 70, 71) and in LPS/IL-4-stimulated splenic B cells (72). However, such RAG expression and L chain editing may not occur, as initially thought, in mature splenic (germinal center) B cells. Using transgenic mice with a RAG2-GFP fusion gene inserted into the RAG2 locus (RAG2-GFP mice), Gartner et al. (73) found that most RAG2+ cells appearing in the SPL after immunization corresponded to migrant pre-B/immature B cells (B220lowCD43lowsIgMlow) from the BM. No GFP expression was detectable in sIgMhigh transitional splenic B cells or mature B cells (73, 74). In transgenic mice with GFP under the control of RAG2 regulatory genes, Yu et al. (75) reported that GFP expression does not occur in mature B cells during an immune response although it does occur in immature/transitional splenic B cells (B220low CD24+CD93+). The highest GFP expression was seen in sIgMlow transitional splenic B cells; sIgMhigh transitional splenic B cells showed lower GFP expression (75). Low RAG expression in sIgMhigh transitional splenic B cells has been reported in Ig-transgenic mice (6-1/V
1A mice) (59). Anti-Igβ stimulation of sIgMhigh transitional splenic B cells from 6-1/V
1A mice was found to result in slight to moderate up-regulation of RAG expression but not L chain rearrangement as scored by dsDNA breaks at J
coding elements (59). However, when BCR-induced apoptosis of cultured sIgMhigh transitional splenic B cells is inhibited by coculture with Thy1dullDX5+ cells from normal BM, up-regulated expression of both RAG and dsDNA breaks at J
coding elements is observed (76, 77). These results suggest that BCR-stimulated sIgMhigh transitional splenic B cells may undergo apoptosis or receptor editing, depending on the microenvironment in which these cells encounter Ag (76, 77). Our findings with 56RV
8 and nontransgenic C57BL/6 mice extend the studies cited above and show that sIgMlow T3 transitional SPL B cells contain dsDNA breaks indicative of ongoing L chain rearrangement. Similar results were obtained with T3' splenic B cells. Some T3/T3' cells may successfully edit their receptor based on our detection of a L chain editor (V
x) in the serum of SCID mice engrafted with sorted T3/T3' splenic B cells from 56RV
8 mice.
L chain editing in 56RV
8 mice is dependent on the 56R H chain
The presence of V
21D- and V
x-edited B cells in the SPL of 56RV
8 but not 3H9V
8 mice is attributable to the single amino acid substitution in the H chains encoded by 56R and 3H9 (arginine for aspartate at position 56 in the VH region) and correlates with the known difference in affinity of these H chains for DNA. The 56RV
8 Ab has high affinity for DNA (binds both ssDNA and dsDNA), whereas the 3H9V
8 Ab has low affinity for DNA (binds ssDNA but not dsDNA) (18). Using a human
polymorphism to detect L chain editing at the wt
allele in 3H9V
8 mice, Casellas et al. (7) also found that
(as well as
)-edited B cells were not detectable in these mice. In contrast,
- and
-edited B cells were readily detectable in 3H9V
4 mice (7), which express an anti-dsDNA Ab with comparable affinity for dsDNA as that of the 56RV
8 Ab (18). Yachimovich et al. (78) reported a lack of L chain editing in anti-DNA double-transgenic mice bearing the D42H (79) and V
8 tgs, but not in mice bearing the tgs, D42H and V
4 or V
1. L chain editing at the active tg allele in the D42H model correlated with the number of available J
gene segments on the tg alleles (three in V
1J
1, one in V
4J
4, and none in V
8J
5). All of these mice expressed anti-DNA Abs with moderate affinity for dsDNA (78). Although the V
8 tg can be inactivated by secondary RS-mediated rearrangements (Table II), it cannot express an edited L chain because there are no available J
coding segments (23). However, when the V
8 L chain is paired with the strongly self-reactive 56R H chain, as in 56RV
8 mice, L chain editing readily occurs at the wt
allele and the
locus.
Representation of V
21D- and V
x-edited B cells in 56RV
8 mice
No edited B cells expressing V
21D or V
x L chains were detectable in 56RV
8 BM despite clear evidence that L chain editing is ongoing in this tissue. This finding is not really surprising. There are 96 known functional VL genes in the mouse genome (80) and, given that the RAG proteins do not preferentially target V
21D and V
x genes, one would not expect a high frequency of 56RV
21D- and 56RV
x-expressing B cells to arise in the BM. Moreover, given that edited B cells rapidly exit the BM, there would not be sufficient time for them to accumulate to detectable numbers. V
x- and V
21D-edited B cells were, however, detectable in the SPL and represented
40% of all IgMa-expressing splenic B cells in 56RV
8 mice. A higher percentage of edited B cells expressing V
21D or V
x (
70%) were recovered in our relatively small sample of IgMa-expressing splenic hybridomas. Strikingly, most of the hybridomas were clonally unrelated as evidenced by distinct DJ rearrangements at their wt H chain allele (Fig. 8). Thus, we infer that most V
21D- and V
x-expressing cells in the SPL represent independently edited B cells.
IgM proteins from 56RV
21D- and 56RV
x-expressing B cell hybridomas showed binding specificity for apoptotic cells (Fig. 9B). The same proteins were also able to bind to dsDNA, albeit with much less affinity than unedited 56RV
8 Ab as the binding curves of IgM to dsDNA for 56RV
21D- and 56RV
x-expressing B cell hybridomas were displaced
5- to 8- and 50- to 100-fold, respectively, to the right of those for 56RV
8-expressing B cell hybridomas (Fig. 9A). Whether the edited B cells represented by these hybridomas retained sufficient autoreactivity to be positively selected by self-Ag is open to question. Low self-reactivity could be essential for the survival and maintenance of 56RV
21D- and 56RV
x-expressing B cells. Others have previously shown that functional autoreactive cells can be generated in the presence of self-Ag (81, 82) and positively selected (82). Moreover, there is evidence most peripheral B cells may be positively selected by internal and external ligands (83) and that signaling through the BCR is essential for maintenance of mature B cells (84). With the previous findings of others serving as precedent, we suggest that edited anti-DNA B cells expressing V
21D or V
x may retain sufficient self-reactivity to allow for their positive selection and maintenance in the presence of self-Ag.
Autoreactive T3 splenic B cells
T3 (and T3') splenic B cells were 3- to 10-fold more frequent in 56RV
8 mice than in 3H9V
8 and nontransgenic C.B-17 scid/+ mice. Overrepresentation of T3 splenic B cells has also been observed in transgenic B6.56R mice (85) and in two other Ig-transgenic models with autoreactive B cells (20, 86). In the latter two models, anti-Ars/A1 and anti-HEL/sHEL-transgenic mice, maintenance of the T3 phenotype was found to depend on continuous exposure to self-Ag. Moreover, the T3 cells in anti-HEL/sHEL C57BL/6 mice were shown to be anergic in that they did not mobilize calcium and initiate tyrosine phosphorylation in response to BCR stimulation (20). The T3 cell population in nontransgenic C57BL/6 mice has also been reported to consist mainly of anergic B cells (20, 21).
Does the anergic phenotype of T3 cells necessarily imply that these cells are (all) inactivated and unable to give rise to mature B cells? We think not based on our finding that the splenic B cell population with a T3 (and T3') phenotype in 56RV
8 and C57BL/6 normal mice contained cells with dsDNA breaks indicative of ongoing L chain rearrangement. Thus, we infer that these B cell populations contain cells attempting to edit their Ag receptor. Assuming T3 splenic B cells undergoing L chain rearrangement in normal wt mice are self-reactive, only those cells that successfully edit their Ag receptor would be expected to survive and give rise to mature B cells. As many L chain rearrangements presumably fail to result in expression of a suitable L chain editor, most T3 splenic B cells would be deleted, consistent with their rapid turnover and anergic phenotype (19, 20, 21).
| Acknowledgments |
|---|
8 sd-tgs; R. Hardy for JH–/– mice; D. Douek for help with the SMART 5'RACE technique; D. Allman, R. Hardy, D. Kappes, and T. Manser for review of this manuscript; and R. Brooks and K. Trush for help in formatting the text and figures. Assistance from personnel in the following CORE facilities of the Fox Chase Cancer Center is gratefully acknowledged: the Flow Cytometry and Cell Sorting Facility, Laboratory Animal Resources, DNA Sequencing Facility, Biochemistry and Biotechnology Facility, and the Hybridoma Facility. | Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by National Institutes of Health Grants CA06927 and CA04946 and an appropriation from the Commonwealth of Pennsylvania. ![]()
2 K.K. and P.B.N. contributed equally to this work. ![]()
3 Address correspondence and reprint requests to Dr. Melvin J. Bosma, Fox Chase Cancer Center, 333 Cottman Avenue, Philadelphia, PA 19111. E-mail address: MJ_Bosma{at}fccc.edu ![]()
4 Abreviations used in this paper: BM, bone marrow; tg, transgene; HEL, hen egg lysosome; sHEL, soluble hen egg lysozyme; sIgM, surface IgM; wt, wild type; FL, fluorescein; LM-PCR, ligation-mediated PCR; RS, recombining sequence; β2m, β2-microglobulin; RT, reverse transcriptase; SPL, spleen; IRS1, intronic recombining sequence 1. ![]()
Received for publication November 28, 2007. Accepted for publication February 20, 2008.
| References |
|---|
|
|
|---|
allelic inclusion is a consequence of receptor editing. J. Exp. Med. 204: 153-160.
-J
rearrangements are restricted within a V-J-C recombination unit in the mouse. Eur. J. Immunol. 21: 907-911. [Medline]
gene rearrangement correlates with induction of germline
gene transcription. Cell 58: 1001-1007. [Medline]
locus in mouse thymocytes of the
β lineage. Immunity 3: 609-621. [Medline]
-Cyano-4-hydroxycinnamic acid affinity sample preparation: a protocol for MALDI-MS peptide analysis in proteomics. Anal. Chem. 73: 434-438. [Medline]
8 L chain transgene on endogenous rearrangements and the immune response to the HA(Sb) determinant on influenza virus. J. Immunol. 147: 2024-2033. [Abstract]
rearrangement signals. Cell 69: 41-53. [Medline]
light-chain gene rearrangements in mouse
light chain-producing B lymphocytes. Nature 307: 749-752. [Medline]
chain constant region genes in mouse
chain-producing B cells involve intrachromosomal DNA recombinations similar to V-J joining. Proc. Natl. Acad. Sci. USA 82: 6211-6215.
light chain genes in mature B cells in vitro and in vivo: function of reexpressed recombination-activating gene (RAG) products. J. Exp. Med. 187: 795-799.
(IGK) genes. Exp. Clin. Immunogenet. 18: 255-279. [Medline]This article has been cited by other articles:
![]() |
L. Yunk, W. Meng, P. L. Cohen, R. A. Eisenberg, and E. T. Luning Prak Antibodies in a Heavy Chain Knock-In Mouse Exhibit Characteristics of Early Heavy Chain Rearrangement J. Immunol., July 1, 2009; 183(1): 452 - 461. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. B. Nakajima, K. Kiefer, A. Price, G. C. Bosma, and M. J. Bosma Two Distinct Populations of H Chain-Edited B Cells Show Differential Surrogate L Chain Dependence J. Immunol., March 15, 2009; 182(6): 3583 - 3596. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Y. Tsao, J. Jiao, M. Q. Ji, P. L. Cohen, and R. A. Eisenberg T Cell-Independent Spontaneous Loss of Tolerance by Anti-Double-Stranded DNA B Cells in C57BL/6 Mice J. Immunol., December 1, 2008; 181(11): 7770 - 7777. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |