The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


The Journal of Immunology, 2008, 180, 5946-5955
Copyright © 2008 by The American Association of Immunologists, Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gorczynski, R.
Right arrow Articles by Boudakov, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gorczynski, R.
Right arrow Articles by Boudakov, I.

An Interaction between CD200 and Monoclonal Antibody Agonists to CD200R2 in Development of Dendritic Cells That Preferentially Induce Populations of CD4+CD25+ T Regulatory Cells1

Reg Gorczynski2, Ismat Khatri, Lydia Lee and Ivo Boudakov

Transplant Research Division, University Health Network, Toronto, Ontario, Canada


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
In previous studies we reported that while interaction between the relatively ubiquitously expressed molecule CD200 and one of its receptors, CD200R1, resulted in direct suppression of alloreactivity, engagement of alternate receptors led instead to altered differentiation of dendritic cells (DCs) from marrow precursors, which could in turn foster development of Foxp3+ regulatory T cells. We have explored this effect of engagement of alternate receptors by using a monoclonal agonist Ab to CD200R2 and investigating expression of TLRs on DCs induced in vivo and in vitro after CD200 stimulation in mice in which the gene encoding CD200R1 was deleted. CD200 stimulation was achieved by using either a soluble form of CD200 (CD200Fc) or overexpression of CD200 as a doxycycline-inducible transgene. Although broadly similar effects were seen, consistent with the hypothesis that triggering of CD200R2 does produce DCs with a characteristic TLR repertoire, there are subtle differences in suppression of alloreactivity achieved by CD200 delivered in these two manners, which is consistent with a complexity of CD200:CD200R engagement not previously appreciated.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The relatively ubiquitously expressed molecule CD200 interacts with members of the CD200R family (CD200R1–R5) to produce multiple immunologic effects (1, 2). The dominant (high avidity) interaction with CD200R1 results in direct suppression of both inflammation and graft rejection (3, 4, 5, 6). These interactions produce altered graft rejection and suppress inflammation in a mouse model of collagen-induced arthritis (7). In contrast, CD200 interacting with alternate CD200R isoforms expressed at the cell surface of myeloid-derived cells fails to produce direct immunosuppression in similar assays (8), and distinct biochemical signaling pathways have been reported to be activated following interaction of CD200 with different CD200R family members (9, 10). Triggering of alternate CD200R isoforms seems to be instrumental in directing differentiation of bone marrow precursors in vitro into dendritic cell (DC)3 populations that are able in turn to induce development of CD4+CD25+Foxp3+ regulatory T cells (Treg) with immunoregulatory properties in a mouse transplant model (skin graft rejection) (11).

A number of different regulatory populations have been implicated in the control of graft rejection. These populations have been characterized in part in relation to their expression of the regulatory cytokines IL-10 and/or TGF-β (Tr1, Th3), or of the regulatory costimulator molecule CTLA4 (12, 13). Foxp3-expressing CD4+CD25+ Treg regulate transplant rejection, autoimmunity, and cancer (14, 15, 16, 17, 18, 19). Other populations of Treg, independent of Foxp3 for function, include, but are not limited to, NKT cells (20), {gamma}{delta}TCR+ cells (21, 22), and CD4CD8 (DN) T cells (23). Both effector T cell populations and Treg populations express and respond to triggering of TLRs by, among other stimuli, LPS (24, 25, 26). DC differentiation/maturation can be regulated in such a way that the DCs activate either effector T cell or Treg subpopulations (27). Although Fallarino et al. (28) have documented an important role for CD200:CD200R in IDO induction in plasmacytoid DCs in this process, the full extent of the role of CD200:CD200R interactions in control of Treg remains to be elucidated (8, 29).

We recently generated a BL/6 mouse with deletion of the exons encoding the extracellular domains of CD200R1 (30), as well as mice overexpressing CD200 under control of a doxycycline-inducible promoter (CD200tg (31)). Using FACS analysis and real-time PCR, neither spleen nor bone marrow cells from CD200R1KO mice expressed mRNA or cell-surface protein for CD200R1, unlike littermate (wild-type, (wt)) controls (30). Given our studies supporting the hypothesis that CD200 triggering of alternate CD200R isoforms (not CD200R1) on DC precursors preferentially led to the induction of "tolerogenic" DCs (29), we designed studies using cells from homozygous CD200R1KO, CD200tg, and CD200R1KO x CD200tg mice to investigate this hypothesis. We cultured bone marrow cells from KO and wt mice in vitro in the presence of GM-CSF + IL-4 with/without addition of a soluble form of CD200, CD200Fc, a new mAb to CD200R2 (4B9), or with doxycycline to induce endogenous overexpression of CD200 from CD200tg cells and to compare the capacity of treated DCs to induce either CTL or Treg in naive allogeneic T lymphocytes. Additionally, we analyzed the effect of combined treatment with anti-CD200R2 and endogenous overexpression of CD200 in BL/6 mice on a wt or CD200R1KO background. The numbers and function of various CD4+ Treg populations from wt and CD200R1KO mice before/after exposure to CD200 in vivo and in vitro were assayed.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Mice

Stock 8-wk-old C57BL/6 and BALB/c mice were purchased from Charles River Laboratories. Mice were housed 5/cage and allowed food and water ad libitum. Mice were used within 2 wk of arrival from the supplier. CD200tg mice (overexpressing CD200 under control of a doxycycline-sensitive inducer) and CD200R1KO mice (BL/6 background), lacking the extracellular domains of CD200R1, were produced as described elsewhere and maintained in our own animal colony (30, 31). KO mice have been shown by Southern gel analysis, PCR, and FACS to lack expression of DNA, mRNA, or cell-surface protein, respectively, encoding a full-length CD200R1. Suppression by CD200 of TNF-{alpha} production in LPS-stimulated cells is abolished in CD200R1KO mice (30). A "second generation" CD200tg mouse, using a less "leaky" CMV promoter (rtTASM2 (32)), was bred to homozygosity on a wt BL/6 background for these studies, and it was also subsequently crossed to homozygous CD200R1KO mice to produce dual homozygous R1KO x CD200tg mice.

TLR ligand activation of bone marrow-derived DCs (BMDCs)

A number of ligands known to discriminate activation of different TLRs were purchased from Sigma-Aldrich, including peptidoglycan (PGN), a TLR2 ligand; a viral double-stranded RNA-like molecule, poly(I:C), a preferential ligand for TLR3; LPS from Escherichia coli, which activates TLR4 vs TLR2 preferentially; and unmethylated CpG, a TLR9 agonist. All were used at concentrations shown in vitro to be optimal for induction of TNF-{alpha} and/or IFN-{gamma} from mature DCs from control wt mice.

Cell preparation, cytotoxicity, and cytokine assays

Bone marrow and splenocytes were prepared as described elsewhere (33). T depletion of splenocytes used anti-mouse T cell serum and rabbit complement from Cedarlane Laboratories. Mature DCs were obtained from T-depleted plastic-adherent spleen cells by incubation of cells (1 x 106/ml in alpha minimal essential medium with 10% FCS, {alpha}F10) in tissue culture dishes for 90 min at 37°C, before exhaustive washing with {alpha}F10, followed by overnight incubation to release mature DCs (33). BMDCs were obtained by 7 days of culture in recombinant GM-CSF + IL-4, with recombinant TNF-{alpha} (10 ng/ml) added as a maturation signal during the last 8 h of culture (8, 33). All recombinant cytokines were purchased from Sigma-Aldrich.

MLCs contained 1.5 x 106 responder C3H spleen cells, enriched for T cells by passage over nylon wool (Polysciences) and stimulated with mitomycin C-treated (45 min at 37°C) allogeneic BL/6 or BALB/c BMDCs in triplicate in {alpha}F10. Cells harvested from MLCs stimulated with BALB/c or BL/6 cells for 5 days were titrated for killing 51Cr-labeled P815 or EL4 tumor targets, respectively.

In some assays, DCs (5 x 105 cells/500 µl medium in flat-bottom 24-well culture plates) were stimulated in triplicate with various TLR agonists (LPS, poly(I:C), CpG, or PGN). Supernatants were pooled at 40 h from replicate wells and assayed in triplicate in ELISA (eBioscience) for TNF-{alpha} using recombinant TNF-{alpha} (eBioscience) as a standard. The sensitivity of detection was ~10 pg/ml.

Skin allograft rejection in vivo

Homozygous CD200R1KO, CD200tg, or R1KO x CD200tg mice or wt controls received C3H skin allografts (30). In some cases, mice received i.v. CD200Fc, anti-CD200R2, or control IgG2a (30 µg/mouse) at 60-h intervals until rejection. When CD200tg mice on a BL/6 background were used, mice received doxycycline in their drinking water throughout, beginning 7 days before transplantation (31). A new anti-CD200R2 mAb used, 4B9, was produced in association with ImmunoPrecise Antibodies, following immunization of rats (4x at 3-wk intervals in CFA) with purified mouse CD200R2Fc (100 µg/rat/injection), and selecting mAbs that failed to react with CD200Fc and CD200R1(R3/R4)Fc, but stained by FACS CD200R2-transduced HEK293 cells (>80% cells stained), and not cells transduced by CD200 or CD200R1 (R3/R4).

Normal goat serum and goat anti-TGF-β and anti-IL-10 Abs used for neutralization of cytokine function were a kind gift from Dr. A. Teng (University of Rochester School of Dentistry, Rochester, NY).

FACS analysis of spleen and bone marrow cells

FITC-conjugated commercial Abs to CD4, CD8, CD3, CD11c, MHC class II, B220, CD40, CD80, CD86, and CD54 were purchased from Cedarlane Laboratories. PE-rat anti-mouse CD200 and FITC-anti-CD200R1 were purchased from Serotec. All FACS analysis used cells incubated in 2% mouse serum to block FcR binding.

Magnetic cell sorting

Dual-stained CD4+ cells in cell preparations were stained with FITC-anti-CD4 and PE-anti-CD25 using Abs obtained from BD Biosciences unless otherwise specified. CD4+ T cells were purified from splenocytes by negative selection using a CD4+ T cell isolation kit according to the manufacturer’s recommendations (StemCell Technologies). In general, cells were >97% pure, as determined by subsequent FACS analysis. As discussed elsewhere (34), to physically isolate CD4+CD25+, negatively selected CD4+ T cells were incubated with PE-anti-CD25 (BD Biosciences) and then separated into subpopulations by incubation with anti-PE magnetic beads (StemCell Technologies). PE-anti-Foxp3 (clone FJK-16s) for staining as per manufacturer’s instructions was purchased from eBioscience.

Real-time PCR

Primer pairs were designed in all cases to detect ~100-bp amplicons for the genes of interest (see below: RpL13A, ribosomal protein L13a; CypA, cyclophilin A (peptidylprolyl isomerase A)). Gene expression in real-time PCR was normalized to a composite of the geometric mean expression of the three housekeeping genes (GAPDH, RpL13a, and CypA) to account for the >100-fold variability in expression even in housekeeping genes (35, 36). The sequences are as follows: TLR1, forward, GGAAAAAGAAGACCCCGAATCT, and reverse, CTCTTTTCGACGGGAAAACAAT; TLR2, forward, GCTAGTCTTCTTGGAACCCATTTC, and reverse, CTCGGGCCACAGACAGTAGTC; TLR3, forward, CCAGCCTTCAAAGACTGATGCT, and reverse, TACGAAGAGGGCGGAAAGGT; TLR4, forward, TCTGATCATGGCACTGTTCTTCTC, and reverse, TGATCCATGCATTGGTAGGTAATATT; TLR5, forward, TTCCTTCCACCTGGGATATTTAAC, and reverse, GAGAGAGCACGGTCAGCTTGT; TLR6, forward, TCGGAGACAGCACTGAAGTCA, and reverse, CGAGTATAGCGCCTCCTTTGAA; TLR7, forward, TGGCTTTTGTCCTAATGCTCAA, and reverse, TATCGGAAATAGTGTAAGGCCTCAA; TLR8, forward, ACAGATTATTCCTCTTGGCGAAAT, and reverse, AATTCACGTGTGGATCAAACTCA; TLR9, forward, ATGCCTTCGTGGTGTTCGAT, and reverse, CACCCGCAGCTCGTTATACA; TLR11, forward, GACCACTCATCTCCTGCTGTTG, and reverse, ACGGGATAGGCGATGGTAACT; GAPDH, forward, TGC CAA GTA TGA TGA CAT CAA GAA G, and reverse, TGA AGT CGC AGG AGA CAA CCT; CypA, forward, TCG AGC TCT GAG CAC TGG AG, and reverse, GTA AAG TCA CCA CCC TGG CAC; RpL13a, forward, TCC CTC CAC CCT ATG ACA AGA, and reverse, GCC CCA GGT AAG CAA ACT TTC.

Statistical analyses

All data are reported as the mean values ± SEM, with sample sizes (n) stated throughout.

p values <0.05 were considered significant, using ANOVA for multiple group comparison. For skin graft survival, Mann-Whitney U tests were used for comparison (see individual Figs.).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Both CD200Fc and anti-CD200R2 mAb 4B9 polarizes BMDCs from CD200R1KO mice preferentially to induce Treg populations in vitro

In our first series of studies we sought to confirm the effect of anti-CD200R2 mAb on the functional capabilities of BMDCs derived from wt or CD200R1KO mice (29), and to compare those effects with that produced by CD200Fc. BMDCs were used after 7 days of culture to stimulate induction of CTL over 5 days in culture with allogeneic (C3H) responder splenocytes, or they were used to induce Treg in CD4+ C3H splenocytes. The latter cells were assayed for their ability to suppress CTL induction in fresh C3H cells incubated with wt splenic C57BL/6 DCs or BALB/c DCs as a third-party specificity control. In some cultures anti-TGF-β and or anti-IL-10 was added to modulate function of Treg (see legend to Fig. 1 and Refs. 11, 29). An aliquot of these Treg was also stained (FACS) for Foxp3 expression. Data pooled from three studies of each type are shown in Fig. 1, a and b, respectively.


Figure 1
View larger version (24K):
[in this window]
[in a new window]

 
FIGURE 1. BMDCs from CD200R1KO, but not wt, mice become polarized to induce Ag-specific Foxp3+CD4+ Treg after culture in the presence of anti-CD200R2 mAb (4B9) or CD200Fc (5 µg/ml). a, BMDCs were obtained at 7 days after culture of cells from wt or CD200R1KO mice with GM-CSF + IL-4 (see Materials and Methods). All DCs were stimulated with TNF-{alpha} (10 ng/ml) for the last 8 h of culture. DCs were treated with mitomycin C (100 µg/ml; 45 min at 37°C) washed three times with PBS, and used as stimulator cells (1.5 x 105/well) in 5-day MLC cultures in triplicate with 1.5 x 106 responder C3H splenocytes. Lysis of EL4 target cells was assayed at 5 days, with data showing specific lysis at a 20:1 E:T ratio (mean ± SD). Data are pooled from three studies. b, Harvested BMDCs, after mitomycin C treatment, were cultured in triplicate (1.5 x 105/well) with 1.5 x 106 CD4+ splenocytes pooled from three normal C3H mice. Cells (Treg) were harvested from these latter cultures after 3 days, washed twice, an aliquot was stained with an anti-Foxp3 Ab (FACS), and 4 x 105 cells/well added in triplicate to MLC cultures of fresh C3H splenocytes (1.5 x 106/well) stimulated with mature splenic wt BL/6 or BALB/c DCs (1.5 x 105/well). Data show mean (±SD) for three studies. In control MLCs, Treg were added from a CD4+ population incubated for 3 days in the absence of added BMDCs (left side, lower panel). Data in parentheses show the percentage Foxp3+ cells in the harvested Treg population (FACS). When Treg induced by 4B9-treated DCs from KO mice were used in MLCs in the presence of anti-TGF-β, anti-IL-10, or a combination of the two, significant loss of Treg function was seen (% lysis of 21 ± 3.2, 19 ± 2.3, and 31 ± 3.3, respectively). *, p < 0.05 compared with control knockout DCs.

 
Confirming our previously reported data (29, 30), BMDCs taken from both wt and CD200R1KO mice were relatively equally active in induction of CTL in vitro (Fig. 1a), unless anti-CD200R2 (4B9) was added during the development of those DCs. In this latter case, BMDCs from CD200R1KO mice were clearly less efficient at induction of CTL. A similar but somewhat less pronounced effect was observed when CD200Fc was added (not 4B9). In contrast, while BMDCs from neither wt nor CD200R1KO mice were efficient at inducing Treg in CD4+ C3H splenocytes under control conditions, when 4B9 or CD200Fc was added during development of those DCs, cells from CD200R1KO mice were preferentially able to induce an Ag-specific Foxp3+ Treg population that suppressed CTL induction for EL4 (H-2b) tumor targets (but not P815 (H-2d) targets) in fresh MLCs (Fig. 1b). As reported in earlier publications, as judged by neutralization of functional activity by anti-TGF-β and/or anti-IL-10 (see legend to Fig. 1), these Foxp3+ Treg were dependent upon expression of TGF-β (and IL-10) for function (11, 29).

CD200Fc infused into CD200R1KO mice can induce Treg populations in vivo

To examine whether there existed an in vivo equivalent of the phenomenon described in Fig. 1, we infused CD200Fc or mouse IgG2a (30 µg/mouse) i.v. into wt or CD200R1KO mice at 60-h intervals for 14 or 28 days. Thereafter, mature splenic DCs in the different groups were isolated by initial adherence to culture dishes for 60 min, followed by release into the supernatant after overnight incubation (>90% CD11c+ by FACS). The DCs were again compared for induction of CTL or CD4+Foxp3+ Treg as described in the methodology for Fig. 1. Data for one of two equivalent experiments are shown in Fig. 2. Note that only for the CD200R1KO mice receiving CD200Fc are data shown for both 14 and 28 days of treatment. In all other groups no difference was seen in results using cells from mice after 14 or 28 days of treatment, and thus in these groups only data for 28 day-treated mice are shown.


Figure 2
View larger version (23K):
[in this window]
[in a new window]

 
FIGURE 2. Same as data in Fig. 1, a and b, except that all DCs were derived from mature splenocytes of wt or CD200R1KO mice given repeated infusions of IgG2a or CD200Fc (30 µg/mouse/injection) at 60-h intervals for 14 or 28 days before harvesting of DCs. Three mice/group were used as donors. All data represent mean (±SD) from three studies. Data for CD200R1KO mice are shown after both 14 and 28 days of treatment. Data for all other groups represent 28 days of treatment. Equivalent results were seen after 14 days of treatment (data not shown). *, p < 0.05 compared with control knockout DCs (mice treated with IgG2a).

 
As before, using DCs isolated from wt or CD200R1KO groups receiving mouse IgG2a only, there was no clear difference in induction of CTL by the different DC populations (Fig. 2a). The same was the case following CD200Fc infusion into wt mice. However, DCs isolated after infusion of CD200Fc into CD200R1KO mice were significantly impaired in CTL induction (Fig. 2a), with a greater effect following 28 days of treatment in vivo compared with 14 days. Additionally, and as discussed in the description of Fig. 1b, these same DCs isolated from CD200Fc-treated CD200R1KO mice were preferentially able to induce Ag-specific Foxp3+ Treg in culture (Fig. 2b). The quantitative suppression seen (and the percentage of Foxp3+ Treg) was less than that induced by in vitro-derived BMDCs (Fig. 1b), although once again a superior effect was seen after 28 days of in vivo treatment compared with 14 days of treatment.

DCs induced by CD200Fc infusion into CD200R1KO mice suppress graft rejection in vivo

There has been considerable interest in the possibility that immature DCs induced by a variety of treatments may be able to transfer adoptively to naive recipients a "tolerogenic" phenotype that can be manifest, for instance, in increased survival of tissue/organ allografts. To examine whether the DCs induced in CD200R1KO mice following CD200Fc infusion would function similarly on adoptive transfer, we performed the following study. Groups of 5 CD200R1KO or wt mice received either 30 µg of CD200Fc or mouse IgG2a i.v. at 60-h intervals for 28 days. Thereafter, mature splenic DCs were isolated from the four pools of spleen samples (mean recovery 25 ± 3.6 x 106/group). Five normal C3H recipient mice received 4 x 106 DCs i.v. in 250 µl PBS, followed by a BL/6 skin allograft. Three control groups received either no DCs or DCs from untreated wt or CD200R1KO mice. Skin graft survival was followed daily, with data pooled from two independent studies (10 mice/group) shown in Fig. 3.


Figure 3
View larger version (13K):
[in this window]
[in a new window]

 
FIGURE 3. BL/6 skin graft survival in groups of 10 C3H mice infused at the time of skin transplantation with 4 x 106 DCs i.v. derived from wt or CD200R1KO. These DC donors had themselves been treated for 28 days in vivo by infusion of IgG2a or CD200Fc, as described in Fig. 2. Control transplant groups received no DCs or DCs from untreated wt or CD200R1KO mice. *, p < 0.05 by comparison with all other groups (Mann-Whitney U test).

 
It is clear from the data in Fig. 3 that adoptive transfer of DCs obtained from CD200R1KO mice treated with CD200Fc, but no other population of DCs used, could improve skin allograft survival significantly. Although earlier studies in vitro had failed to show any distinct phenotype from DCs developing following engagement of alternate CD200Rs by CD200Fc (8), it was nevertheless important to explore whether there was a unique phenotype associated with the DCs derived from these CD200R1KO mice. Accordingly, mature DCs were taken from mice treated for 28 days in vivo (as in Fig. 3). An aliquot of cells was stained for FACS analysis, while mRNA was extracted from the remainder of the cells and real-time PCR measurements for various TLRs were assessed. Note that no preliminary division of the mature splenic DCs was made (e.g., into CD8{alpha}+/CD8{alpha}, B220+). Data in Fig. 4 are pooled from three identical studies.


Figure 4
View larger version (38K):
[in this window]
[in a new window]

 
FIGURE 4. Comparison of mature DCs taken from mice after 28 days of stimulation in vivo (as in Fig. 2), using staining in FACS with specific mAbs (a) or real-time PCR expression of mRNAs for individual TLRs (b). In the latter case, all data were normalized to a composite control of three individual "housekeeping" genes, as discussed in detail elsewhere (36 ). Data represent means (±SD) of six individual measurements pooled over three identical studies. *, p < 0.05 by comparison with all other DCs by ANOVA.

 
These intriguing data both support our previous observations from in vivo studies (8) and add significant information. First, as judged by FACS analysis with the mAbs shown in Fig. 4a, there is no clear phenotype associated with the mature splenic DCs isolated from CD200Fc-treated CD200R1KO mice. However, when expression of mRNAs for various TLRs was investigated in these same DC subsets, quite different conclusions were reached. The cells obtained from CD200Fc-treated CD200R1KO mice showed preferential expression of mRNAs for TLR2 and TLR3, and they decreased expression of TLR7 and TLR9, phenotypic profiles that imply a relatively immature DC differentiation state, with decreased plasmacytoid DCs (37).

Effect of TLR ligand or cytokine stimulation on function of DCs from CD200Fc-treated CD200R1KO mice

A number of different stimulation conditions have been used to induce maturation and immune stimulatory capacity in so-called immature DCs. TLR ligand activation and the use of cytokines, including IFN-{gamma} and/or TNF-{alpha}, are prominent among these approaches (38, 39, 40). Given the different TLR mRNA expression profile of DCs obtained from CD200Fc-treated CD200R1KO mice (see previous Figs.), we next investigated the effect of 36-h TLR ligand stimulation of DCs obtained from mice after 28 days of treatment in vivo (as in previous Figs.) on their subsequent functional activity in two assays. In one assay (Fig. 5a) we used the stimulated DCs to induce CTL, assaying lysis of EL4 target cells as in Figs. 1 and 2. In the second assay we measured the TNF-{alpha} released into the culture supernatant after the 36-h stimulation of the DCs used for CTL induction. Data pooled from two such studies are shown in Fig. 5.


Figure 5
View larger version (37K):
[in this window]
[in a new window]

 
FIGURE 5. a, Effect of stimulation of mature DCs taken from mice after 28 days of stimulation in vivo (as in Fig. 2) with different TLR ligands on subsequent functional activity of DCs. Mature DCs were obtained as in previous Figs. and cultured in vitro (x40 h) with the various TLR ligands shown, at concentrations determined to be optimal in preliminary studies. Cell supernatants from DC cultures were analyzed in ELISA for TNF-{alpha} (b). The harvested DCs were washed three times with PBS and used to stimulate CTL from C3H splenocytes (see Figs. 1 and 2). CTL were assayed at 5 days using EL4 target cells (data show lysis at a 20:1 E:T ratio). Results shown represent arithmetic means (±SD) from triplicate cultures and are pooled from two identical studies. *, p < 0.05 by comparison with other DCs by ANOVA.

 
Consistent with data in Fig. 2, DCs taken from CD200Fc-treated CD200R1KO mice were deficient in CTL induction, but following treatment of those DCs with LPS or PGN in vitro, that deficiency was attenuated (Fig. 5a, far right columns). This was not the case if stimulation was with poly(I:C) or CpG. The two latter TLR ligands were also relatively ineffective in inducing TNF-{alpha} production from this DC pool during the 40 h of culture (see Fig. 5b), consistent with the TLR mRNA expression profile in Fig. 4b.

As an alternative approach to induction of functional maturation in the various DC populations discussed, we next investigated the effect of combined stimulation of DCs from pretreated mice (see Figs. 2–4) for 40 h in vitro with a mixture of recombinant TNF-{alpha} + IFN-{gamma} before use either for induction of CTL or Treg in assays identical with those used in Figs. 1 and 2. Data pooled from two such identical studies are shown in Fig. 6. Intriguingly, stimulation of DCs from CD200Fc-treated CD200R1KO mice with the TNF-{alpha} + IFN-{gamma} mixture (Fig. 6, far right) attenuated the deficiency in those cells in terms of CTL induction, and also abolished their preferential capacity to induce Foxp3+ Treg (Fig. 6b).


Figure 6
View larger version (25K):
[in this window]
[in a new window]

 
FIGURE 6. Effect of stimulation of mature DCs taken from mice after 28 days of stimulation in vivo (as in Fig. 2) with TNF-{alpha} + IFN-{gamma} on subsequent functional activity of DCs (see also Figs. 2 and 5). Mature DCs were obtained as in previous Figs. and cultured in vitro (x40 h) in medium alone (untreated) or with TNF-{alpha} + IFN-{gamma} at concentrations determined to be optimal in preliminary studies (see Materials and Methods). The harvested DCs were washed three times with PBS and used to stimulate CTL from C3H splenocytes (a) or to induce Treg during 3 days in culture (b) (see Figs. 1 and 2). CTL were assayed at 5 days using EL4 target cells (a), while Treg were assayed for suppression of CTL induction using fresh C3H splenocytes stimulated with fresh splenic BL/6 DCs from wt mice (b). Data show are means (±SD) from triplicate cultures and are pooled from two identical studies. Note that in b, when Treg were added to cultures stimulated with BALB/c cells, no suppression was seen from any group (see also Figs. 1 and 2). Data in parentheses in b represent Foxp3+ cells in the added Treg pool, as assayed by FACS. *, p < 0.05 by comparison with other DCs by ANOVA.

 
Treatment of DCs harvested from CD200R1KO mice after CD200Fc infusion, and matured in vitro with TLR ligands or TNF-{alpha} + IFN-{gamma}, no longer suppress graft rejection in vivo

We next asked whether the tolerogenic DCs induced by CD200Fc treatment in CD200R1KO mice that prolong survival of skin allografts (Fig. 3) would lose this functional capacity if pretreated as in Figs. 5 and 6 by either TLR ligands or the TNF-{alpha} + IFN-{gamma} mixture. As a control, DCs were harvested from 4/group of wt mice treated with IgG2a or CD200Fc, or from CD200R1KO mice treated with IgG2a. All DCs were cultured for 40 h in vitro with either medium alone or with LPS, poly(I:C), or TNF-{alpha} + IFN-{gamma}. Thereafter, DCs were washed with PBS and 4 x 106 cells/mouse infused into 5 C3H mice/group, which received BL/6 skin allografts. Survival was followed daily, with pooled results from two independent studies (total of 10 mice/group) shown in Fig. 7. Note that (see also Fig. 3) only DCs from CD200Fc-treated CD200R1KO mice induced prolonged survival in these studies, with graft survival in all other groups being equivalent to groups receiving no DCs. Accordingly, in Fig. 7 only the latter control group is shown for the sake of simplicity, with all other groups shown representing DCs from CD200Fc-treated CD200R1KO mice. Mean survival times for grafts using DCs from wt mice are shown in the legend to Fig. 7.


Figure 7
View larger version (12K):
[in this window]
[in a new window]

 
FIGURE 7. Reversal of increased BL/6 skin graft survival in C3H mice infused at the time of skin transplantation with 4 x 106 DCs i.v. derived from CD200Fc-treated CD200R1KO (Fig. 4) following pretreatment of DCs with different TLR ligands or a mixture of TNF-{alpha} + IFN-{gamma} (Figs. 5 and 6). The single control group shown received no DCs. Ten mice were used per group. *, p < 0.05 by comparison with control group (Mann-Whitney U test). Mean survival times (days) for grafts in mice given DCs from CD200Fc-treated wt mice (with/without TLR ligands) were as follows: control (wt DCs: IgG2a treated), 12.5 ± 2.2; wt DCs, CD200Fc treated, 12.9 ± 2.4; wt DCs, CD200Fc (+LPS), 12.1 ± 2.3; wt DCs, CD200Fc (poly(I:C)), 12.6 ± 2.4; wt DCs, CD200Fc (TNF-{alpha} + IFN-{gamma}), 11.9 ± 2.6.

 
These data provide an in vivo correlate of those shown in Figs. 5 and 6. Untreated DCs from CD200-infused KO mice attenuated graft rejection as reported in Fig. 3, while culture of those DCs with the TLR4 ligand, LPS, or with the cytokine mixture (TNF-{alpha} + IFN-{gamma}) abolished this suppression of rejection. The TLR3 ligand poly(I:C), which produced no modulation of functional activity of the same DCs as assayed by in vitro studies (Fig. 5), was also unable to reverse suppression of rejection by these DCs.

Augmented induction of Treg, with/without anti-CD200R2 mAb (4B9), in wt and CD200R1KO mice following forced overexpression of a CD200tg

We have interpreted the effects of CD200Fc and anti-CD200R2 mAbs (4B9) as being contingent upon their altering development of DC precursors lacking expression of CD200R1 (29). Because it has been suggested that the highest avidity interaction of CD200 is for CD200R1 (3), we had anticipated that there would be a minimal effect of CD200Fc in wt mice (as seen in Fig. 1) and that there would be a minimal interaction seen when using both CD200Fc and 4B9 with cells of CD200R1KO mice. As an alternative approach to investigating the interaction of CD200 and 4B9, instead of using exogenous CD200Fc added to cultures with 4B9, we forced overexpression of endogenous CD200 using doxycycline and newly generated homozygous rtTASM2CD200tg mice on a wt or CD200R1KO background. Data in Fig. 8 are for equivalent studies to those in Fig. 1, but using these animals.


Figure 8
View larger version (20K):
[in this window]
[in a new window]

 
FIGURE 8. Same as data in Fig. 1, except that DCs used were derived from CD200tg mice on a BL/6 background (wt CD200tg) or a CD200R1KO background (R1KOCD200tg). Once again, data in a show CTL activity induced by DCs from these mice, while b represents data assaying evidence for Treg induced (during 3 days) by the same DCs.

 
There are two important observations here that were not evident from data in Fig. 1 and that were not anticipated from our previous studies. First, using doxycycline and a CD200tg mouse rather that exogenous CD200Fc in BM cultures from wt mice, overexpression of CD200 alone on a wt background (in CD200R1+/+ mice) modulated production of immunogenic DCs for CTL (Fig. 8a) and produced DCs with the ability to induce Treg in vitro (Fig. 8b). There was no further effect of added 4B9 in these cultures. One interpretation of these apparently contradictory findings (with data in Fig. 1) is that by using the transgenic system, higher (local) levels of CD200 are achieved than when using exogenous CD200Fc, and that these higher levels are responsible for the difference (following interaction with CD200Rs or interaction with non-CD200R receptors).

Moreover, and again unexpectedly, combined treatment with 4B9 and endogenous overexpression of CD200 using R1KO mice on the CD200tg background resulted in a significantly enhanced effect that was not observed using 4B9 with CD200Fc (Fig. 1). One possible explanation for these data is that a cooperative stimulation of CD200R2 is mediated by 4B9 and high levels of endogenous CD200 acting through different CD200R2 epitopes. Alternatively, higher levels of endogenous CD200 in CD200tg mice may produce effects through other receptors besides CD200R.

Superior induction of resistance to transplant rejection following transfer of mature splenic DCs from CD200R1KO mice with forced over-expression of a CD200tg

Data in Fig. 3 had shown that mature splenic DCs harvested from CD200R1KO mice receiving 30 µg CD200Fc i.v. at 60-h intervals for 28 days were able to transfer resistance to rejection of BL/6 skin allografts to naive C3H mice, unlike similar DCs harvested from wt mice. We next asked whether the superior induction of tolerogenic DCs seen in vitro from R1KO cells with simultaneous overexpression of an endogenous CD200 transgene (Fig. 8) would be seen in vivo in an equivalent fashion. In this case, homozygous R1KO x rtTASM2CD200tg mice received either water or doxycyline in their drinking supply for 14 days. A control group of CD200R1KO mice received treatment (as in Fig. 3) with CD200Fc or IgG2a i.v. (30 µg/mouse/injection at 60-h intervals) for 28 days. Thereafter, mature splenic DCs were isolated from the four pools of spleen samples (mean recovery 26 ± 5 x 106/group). As before, 5 normal C3H recipient mice received 4 x 106 DCs i.v. in 250 µl PBS, followed by a BL/6 skin allograft. A control group received no DCs. Skin graft survival was followed daily, with data pooled from two independent studies (10 mice/group) shown in Fig. 9. Additional groups of mice receiving DCs from doxycycline-treated homozygous R1KO x rtTASM2CD200tg mice were designed to confirm the importance of TGF-β and/or IL-10 in the function of Treg induced by tolerogenic DCs in vivo, by infusing anti-TGF-β, anti-IL-10, or a combination of the two Abs into mice receiving Treg. Mice received 100 µg i.v. into the tail vein of each Ab at 60-h intervals for a total of six injections.


Figure 9
View larger version (15K):
[in this window]
[in a new window]

 
FIGURE 9. BL/6 skin graft survival in groups of 10 C3H mice. Control mice (*) received no other treatment. Other groups of mice were infused at the time of skin transplantation with 4 x 106 DCs i.v. derived from CD200R1KO mice treated for 28 days in vivo by infusion of IgG2a or CD200Fc, as described in Fig. 2. Alternatively, recipients received DCs from homozygous R1KO x rtTASM2CD200tg mice given either water or doxycycline to drink for 14 days before sacrifice. *, p < 0.05 by comparison with three control groups (Mann-Whitney U test). **, p < 0.05 by comparison with R1KO + CD200Fc group (Mann-Whitney U test).

 
These data confirm the observations made in Fig. 8 regarding the superior effect of endogenous overexpression of CD200 (in CD200tg cells) to exogenous addition of CD200 on induction of tolerogenic DCs in cells of CD200R1KO mice. Additionally, and in accord with previous data from in vitro studies (see text above and Ref. 11, 29), the functional activity in Treg induced by DCs derived following activation of CD200R2 on DC precursors was abolished optimally by combined treatment with anti-TGF-β and anti-IL-10, although treatment with either Ab alone also significantly impaired graft prolongation.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
From studies described in an earlier report we had concluded that immunoregulation induced by CD200 ligand binding of non-CD200R1 isoforms of the CD200R receptor family reflected the induction of tolerogenic DCs by activation of the alternate isoforms (8, 11). The notion that up-regulation of CD200 may represent a novel mechanism to suppress immune reactivity to apoptosis-associated self-Ags under steady-state conditions was suggested independently by Rosenblum et al. (41), although the possibility that regulation of DC development was implicated in this phenomenon was not investigated. There is intense interest in the notion that subsets of tolerogenic DCs may be crucial to the regulation of immunity/tolerance to self and acquired Ags (42, 43). These hypotheses have been tested in transplantation models (44, 45). The underlying concept is that immature developmental stages of DC differentiation induce T cell anergy or Treg, whereas activated DCs that have been transformed into mature DCs represent immunogenic DCs that initiate primary T cell responses. Two distinct observations have challenged this simplistic notion, namely 1) the demonstration of Treg expansion by Ag-bearing, fully mature DCs, and 2) the evidence that semimature DCs with a distinct cytokine production profile are endowed with tolerogenic functions. Both observations suggest that DC maturation per se is not necessarily the distinguishing feature of immunogenic as opposed to tolerogenic DCs (46). Despite these reservations, data suggest that immature myeloid precursors of DC suppress T cell activation while immature DCs support Treg development, and mature DCs can override Treg-mediated suppression in vitro and in vivo (47, 48, 49). We had reported that preferential induction of Treg by DCs activated by alternate CD200Rs was an important feature of the effect of CD200 interaction with alternate CD200R isoforms (29).

Studies exploring the identification of unique phenotypes for DC subsets have focused not merely on classical cell-surface molecules (CD4/CD8a/CD11c/B220), but also on TLRs. Investigations of TLR expression on human DC precursors (pre-DCs), including monocytes (pre-DC1), plasmacytoid DC precursors (pre-DC2), and CD11c+ immature DCs and comparison of their responses to microbial Ags revealed that monocytes preferentially expressed TLR1, TLR2, TLR4, TLR5, and TLR8, while plasmacytoid pre-DCs strongly express TLR7 and TLR9. Consistent with the TLR expression profiles, monocytes respond to TLR2 and TLR4 ligands (PGN, LPS) by producing TNF-{alpha} and IL-6, while plasmacytoid pre-DCs responded only to the TLR9 ligand, CpG containing unmethylated CpG motifs, producing IFN-{alpha}. CD11c+ immature DCs, which preferentially express TLR1, TLR2, and TLR3, responded to PGN by producing TNF-{alpha} and to the viral double-stranded RNA-like molecule poly(I:C) by producing IFN-{alpha} and IL-12 (50, 51).

Note, however, as implied by the data in this manuscript, expression patterns of TLRs on DC subsets is not static, but can be modified by exogenous stimuli, including TLR ligands themselves and cytokines. Stimulation of myeloid DCs with IFN-{gamma} up-regulates TLR9 expression in myeloid-derived DCs to a level comparable with expression in plasmacytoid DCs, and results in their expression of mRNAs for IL-12 and IL-6, along with IL-12 p70 secretion in response to CpG (52). Combination treatment with CpG + anti-IL-10R modifies functional activity in DCs (53). Mature DCs activated through TLR pattern recognition receptors produce proinflammatory cytokines, including IL-6, which can render responder T cells refractory to the suppressive effect of Treg (54). Independent studies have demonstrated that activation of APCs via innate immune receptors can break self tolerance (55), and that even in vivo manipulation of DCs (by CpG) can overcome tolerance to unmodified (tumor-associated) self-Ags and induces potent immunity (56). Once again a conflicting report concluded that DC-specific CD4 T cell help activation by TLR ligands was insufficient to break peripheral cross-tolerance (57). Our data suggest that while tolerogenic DCs induced following activation of alternate CD200R isoforms can induce Treg and promote graft survival in vivo, maturation of those DCs by TLR ligands and/or cytokines can abolish this functional activity.

One model used to help explain the preferential "tolerizing" effect of immature DCs considered that the suppressive function of Treg was critically dependent on immature DCs and would thus be reversed by the maturation of DCs induced by GM-CSF. This model suggested that such reversal might not require TLR activation of either DCs or Treg. In contrast, reversal of Treg anergy was hypothesized to be dependent on TLR activation of DCs, involving the potentiation of Treg responsiveness to IL-2 by the cooperative effects of IL-6 and IL-1 produced by the TLR-activated, mature DCs. Proinflammatory cytokines produced by TLR-activated, mature DCs would then be required for reversal of Treg anergy, but not to overcome Treg suppression (48). Although not directly addressing questions concerning the regulation of function of Treg themselves, but more to the role of TLR ligands/cytokines on the functional properties of DCs involved in Treg development, our data speak somewhat to this question. We suggest that immature/tolerogenic DCs (as produced by simulation by alternate CD200Rs) preferentially support development of Treg, and that TLR activation and/or cytokine administration influences DC developmental processes primarily, and Treg development (and thus immune status) secondarily. Interestingly, a recent study has suggested that immature DCs induced in the presence of chronic glucocorticoid treatment are unable to immunize, but unlike the data reported above, they are refractory to TLR stimulation (58).

There is another feature of interest in the data discussed above as seen in the context of previous data from our group and other groups. We had suggested that in the absence of CD200R1, triggering of alternate CD200Rs (particularly CD200R2) by cross-linking Abs resulted in development of tolerogenic DCs, which fostered development of Treg (29). In contrast, engagement of CD200R1 by either CD200 or anti-CD200R1 mAbs directly induced Treg that suppressed MLC responses (29, 59). Other groups have speculated that the difference in signaling by CD200R1 vs alternate CD200Rs reflected a possible role for ligands other than CD200 as natural stimulants for alternate CD200Rs (3). We have shown in studies above that while CD200Fc (a soluble form of CDE200) produced a modest diminution in the ability of DCs to induce CTL, and led to induction of Treg in vitro and in vivo (Figs. 1 and 2), this effect was more pronounced if CD200 overexpression was in the context of endogenous CD200 from transgenic mice (Figs. 8 and 9). Moreover, in the latter case, further loss of CTL production and increased induction of Treg occurred when the CD200 transgene was expressed along with use of an anti-CD200R2 mAb (Fig. 8). There are several possible explanations for these unexpected findings. The soluble form of CD200 used may be an inferior ligand for all CD200Rs than the natural cell surface CD200 (endogenous or the transgene). As a variant of this hypothesis, it may be that the cell-surface endogenous (or transgenic) form of CD200 has a different (or another) ligand responsible for the effects seen, which is not engaged by CD200Fc. It may also be the case that the actual local concentration and or conformation (for CD200Rs) of CD200 expressed at the cell surface may be different from that apparent when using soluble CD200. Note, however, that to date (in limited studies) we have found no further increased immunoregulation in vivo using i.v. doses of CD200Fc up to 150 µg/mouse/injection (R. M. Gorczynski, unpublished); nevertheless, the question of the physiological importance of CD200 engagement of CD200R2 in normal mice (CD200R1+) remains somewhat unresolved. Another possibility is that the monoclonal anti-CD200R2 used (4B9) engages a different epitope of the CD200R2 molecule than CD200 itself, and this might help explain the cooperative effect seen (although not why the transgenic CD200 is superior to CD200Fc). However, in limited studies with another new anti-CD200R2 mAb (6E4), similar results to those described in Figs. 8 and 9 were obtained (R. M. Gorczynski, unpublished). We are currently in the process of generating mice in which either the region encoding all alternate CD200Rs (CD200R2–5) or all CD200Rs (CD200R1–5) is deleted as one tool to investigate these anomalies in more detail. Despite these reservations, however, the data in the current manuscript support a hypothesis that engagement of CD200R2 by either ligand or an anti-CD200R2 mAb leads to characteristic changes in development of DC in vivo and in vitro, which can be followed by altered TLR expression and that eventually results in induction of Foxp3+ Treg in vitro and in vivo, which can suppress allogeneic skin graft rejection.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflicts of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by Heart and Stroke association of Ontario. Back

2 Address correspondence and reprint requests to Dr. R. Gorczynski, Room 2-805, MaRS Tower, 101 College Street, Toronto, Ontario, Canada M5G 1L7. E-mail address: reg.gorczynski{at}utoronto.ca Back

3 Abbreviations used in this paper: DC, dendritic cell; {alpha}F10, alpha minimal essential medium with 10% FCS; BMDC, bone marrow-derived DC; CypA, cyclophilin A; PGN, peptidoglycan; RpL13A, ribosomal protein L13a; Treg, regulatory T cells; wt, wild type. Back

Received for publication January 3, 2008. Accepted for publication February 28, 2008.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Gorczynski, R., Z. Q. Chen, Y. Kai, L. Lee, S. Wong, P. A. Marsden. 2004. CD200 is a ligand for all members of the CD200R family of immunoregulatory molecules. J. Immunol. 172: 7744-7749. [Abstract/Free Full Text]
  2. Wright, G. J., H. Cherwinski, M. Foster-Cuevas, G. Brooke, M. J. Puklavec, M. Bigler, Y. L. Song, M. Jenmalm, D. Gorman, T. McClanahan, et al 2003. Characterization of the CD200 receptor family in mice and humans and their interactions with CD200. J. Immunol. 171: 3034-3046. [Abstract/Free Full Text]
  3. Hatherley, D., H. M. Cherwinski, M. Moshref, A. N. Barclay. 2005. Recombinant CD200 protein does not bind activating proteins closely related to CD200 receptor. J. Immunol. 175: 2469-2474. [Abstract/Free Full Text]
  4. Gorczynski, R. M., M. S. Cattral, Z. G. Chen, J. A. Hu, J. Lei, W. P. Min, G. Yu, J. Ni. 1999. An immunoadhesin incorporating the molecule OX-2 is a potent immunosuppressant that prolongs allo- and xenograft survival. J. Immunol. 163: 1654-1660. [Abstract/Free Full Text]
  5. Fallarino, F., C. Orabona, C. Vacca, R. Bianchi, S. Gizzi, C. Asselin-Paturel, M. C. Fioretti, G. Trinchieri, U. Grohmann, P. Puccetti. 2005. Ligand and cytokine dependence of the immunosuppressive pathway of tryptophan catabolism in plasmacytoid dendritic cells. Int. Immunol. 17: 1429-1438. [Abstract/Free Full Text]
  6. Copland, D. A., C. J. Calder, B. J. E. Raveney, L. B. Nicholson, J. Phillips, H. Cherwinski, M. Jenmalm, J. D. Sedgwick, A. D. Dick. 2007. Monoclonal antibody-mediated CD200 receptor signaling suppresses macrophage activation and tissue damage in experimental autoimmune uveoretinitis. Am. J. Pathol. 171: 580-588. [Abstract/Free Full Text]
  7. Gorczynski, R. M., Z. Q. Chen, K. Yu, J. Hu. 2001. CD200 immunoadhesin suppresses collagen-induced arthritis in mice. Clin. Immunol. 101: 328-334. [Medline]
  8. Gorczynski, R. M., Z. Q. Chen, Y. Kai, S. Wong, L. Lee. 2004. Induction of tolerance-inducing antigen-presenting cells in bone marrow cultures in vitro using monoclonal antibodies to CD200R. Transplantation 77: 1138-1144. [Medline]
  9. Boudakov, I., P. Chang, R. M. Gorczynski. 2005. Mechanisms involved in suppression induced by CD200:CD200R interaction. S. G. Pandalai, ed. In Recent Research Developments in Immunology Vol. 7: 9-24. Research Signpost, Kerala, India.
  10. Zhang, S. L., H. Cherwinski, J. D. Sedgwick, J. H. Phillips. 2004. Molecular mechanisms of CD200 inhibition of mast cell activation. J. Immunol. 173: 6786-6793. [Abstract/Free Full Text]
  11. Gorczynski, R. M., L. Lee, I. Boudakov. 2005. Augmented induction of CD4+CD25+ Treg using monoclonal antibodies to CD200R. Transplantation 79: 488-491. [Medline]
  12. Cottrez, F., H. Groux. 2004. Specialization in tolerance: innate CD4+CD25+ versus acquired TR1 and TH3 regulatory T cells. Transplantation 77: S12-S15. [Medline]
  13. Tang, Q. Z., E. K. Boden, K. J. Henriksen, H. BourJordan, M. Y. Bi, J. A. Bluestone. 2004. Distinct robes of CTLA-4 and TGF-β in CD4+CD25+ regulatory T cell function. Eur. J. Immunol. 34: 2996-3005. [Medline]
  14. Liu, J. W., Z. R. Liu, P. Witkowski, G. Vlad, J. S. Manavalan, L. Scotto, S. Kim-Schulze, R. Cortesini, M. A. Hardy, N. Suciu-Foca. 2004. Rat CD8+FOXP3+ T suppressor cells mediate tolerance to allogeneic heart transplants, inducing PIR-B in APC and rendering the graft invulnerable to rejection. Transpl. Immunol. 13: 239-247. [Medline]
  15. Cohen, J. L., B. L. Salomon. 2005. Therapeutic potential of CD4+CD25+ regulatory T cells in allogeneic transplantation. Cytotherapy 7: 166-170. [Medline]
  16. Jaeckel, E., H. von Boehmer, M. P. Manns. 2005. Antigen-specific FoxP3-transduced T-cells can control established type 1 diabetes. Diabetes 54: 306-310.
  17. Wildin, R. S., A. Freitas. 2005. IPEX and FOXP3: clinical and research perspectives. J. Autoimmun. 25: 56-62. [Medline]
  18. Banham, A. H., F. M. Powrie, E. Suri-Payer. 2006. FOXP3+ regulatory T cells: current controversies and future perspectives. Eur. J. Immunol. 36: 2832-2836. [Medline]
  19. Linehan, D. C., P. S. Goedegebuure. 2005. CD25+CD4+ regulatory T-cells in cancer. Immunol. Res. 32: 155-168. [Medline]
  20. Kronenberg, M.. 2005. Toward an understanding of NKT cell biology: progress and paradoxes. Annu. Rev. Immunol. 23: 877-900. [Medline]
  21. Kapp, J. A., L. M. Kapp, K. C. McKenna. 2004. {gamma}{delta} T cells play an essential role in several forms of tolerance. Immunol. Res. 29: 93-102. [Medline]
  22. Girardi, M.. 2006. Immunosurveillance and immunoregulation by {gamma}{delta} T cells. J. Invest. Dermatol. 126: 25-31. [Medline]
  23. Chen, W., M. S. Ford, K. J. Young, L. Zhang. 2003. Infusion of in vitro-generated DN T regulatory cells induces permanent cardiac allograft survival in mice. Transplant. Proc. 35: 2479-2480. [Medline]
  24. Sutmuller, R. P. M., M. E. Morgan, M. G. Netea, O. Grauer, G. J. Adema. 2006. Toll-like receptors on regulatory T cells: expanding immune regulation. Trends Immunol. 27: 387-393. [Medline]
  25. Liu, H. Y., M. Komai-Koma, D. Xu, F. Y. Liew. 2006. Toll-like receptor 2 signaling modulates the functions of CD4+CD25+ regulatory T cells. Proc. Natl. Acad. Sci. USA 103: 7048-7053. [Abstract/Free Full Text]
  26. Gorczynski, R. M., Y. Kai, K. Miyake. 2006. MD1 expression regulates development of regulatory T cells. J. Immunol. 177: 1078-1084. [Abstract/Free Full Text]
  27. Grohmann, U., F. Fallarino, P. Puccetti. 2003. Tolerance, DCs, and tryptophan: much ado about IDO. Trends Immunol. 24: 242-248. [Medline]
  28. Fallarino, F., C. Asselin-Paturel, C. Vacca, R. Bianchi, S. Gizzi, M. C. Fioretti, G. Trinchieri, U. Grohmann, P. Puccetti. 2004. Murine plasmacytoid dendritic cells initiate the immunosuppressive pathway of tryptophan catabolism in response to CD200 receptor engagement. J. Immunol. 173: 3748-3754. [Abstract/Free Full Text]
  29. Gorczynski, R. M.. 2005. Thymocyte/splenocyte-derived CD4+CD25+ Treg stimulated by anti-CD200R2 derived dendritic cells suppress MLCs and skin graft rejection. Transplantation 81: 1027-1034.
  30. Boudakov, I., J. Liu, N. Fan, P. Gulay, K. Wong, R. M. Gorczynski. 2007. Mice lacking CD200R1 show absence of suppression of lipopolysaccharide-induced tumor necrosis factor-{alpha} and mixed leukocyte culture responses by CD200. Transplantation 84: 251-257. [Medline]
  31. Yu, K., Z. Q. Chen, S. N. Wang, R. Gorczynski. 2005. Decreased alloreactivity using donor cells from mice expressing a CD200 transgene under control of a tetracycline-inducible promoter. Transplantation 80: 394-401. [Medline]
  32. Freundlieb, S., C. Schirra-Muller, H. Bujard. 1999. A tetracycline controlled activation/repression system with increased potential for gene transfer into mammalian cells. J. Gene Med. 1: 4-12. [Medline]
  33. Gorczynski, L., Z. Chen, J. Hu, G. Kai, V. Ramakrishna, R. M. Gorczynski. 1999. Evidence that an OX-2 positive cell can inhibit the stimulation of type-1 cytokine production by bone-marrow-derived B7-1 (and B7-2) positive dendritic cells. J. Immunol. 162: 774-781. [Abstract/Free Full Text]
  34. Gorczynski, R. M., C. Alexander, W. Bessler, K. Brandenburg, K. Fournier, J. P. Mach, S. Mueller, E. T. Rietschel, A. J. Ulmer, T. Waelli, et al 2007. An alteration in the levels of populations of CD4+ Treg is in part responsible for altered cytokine production by cells of aged mice which follows injection with a fetal liver extract. Immunol. Lett. 109: 101-112. [Medline]
  35. Gorczynski, R. M., C. P. Gorczynski, L. Y. Gorczynski, J. Hu, J. Lu, J. Manuel, L. Lee. 2005. Neutral buoyancy and sleep-deprived serum factors alter expression of cytokines regulating osteogenesis. Acta Astronaut. 56: 890-899. [Medline]
  36. Lee, L., J. Liu, J. Manuel, R. M. Gorczynski. 2006. A role for the immunomodulatory molecules CD200 and CD200R in regulating bone formation. Immunol. Lett. 105: 150-158. [Medline]
  37. Munz, C., R. M. Steinman, S. I. Fujii. 2005. Dendritic cell maturation by innate lymphocytes: coordinated stimulation of innate and adaptive immunity. J. Exp. Med. 202: 203-207. [Abstract/Free Full Text]
  38. Watts, C., R. Zaru, A. R. Prescott, R. P. Wallin, M. A. West. 2007. Proximal effects of Toll-like receptor activation in dendritic cells. Curr. Opin. Immunol. 19: 73-78. [Medline]
  39. Gomez, J., F. E. Borras, R. Singh, P. Rajananthanan, N. English, S. C. Knight, C. V. Navarrete. 2004. Differential up-regulation of HLA-DM, invariant chain, and CD83 on myeloid and plasmacytoid dendritic cells from peripheral blood. Tissue Antigens 63: 149-157. [Medline]
  40. Jin, Y., L. Fuller, G. Ciancio, G. W. Burke, A. G. Tzakis, C. Ricordi, J. Miller, V. Esquenzai. 2004. Antigen presentation and immune regulatory capacity of immature and mature-enriched antigen presenting (dendritic) cells derived from human bone marrow. Hum. Immunol. 65: 93-103. [Medline]
  41. Rosenblum, M. D., E. Olasz, J. E. Woodliff, B. D. Johnson, M. C. Konkol, K. A. Gerber, R. J. Orentas, G. Sandford, R. L. Truitt. 2004. CD200 is a novel p53-target gene involved in apoptosis-associated immune tolerance. Blood 103: 2691-2698. [Abstract/Free Full Text]
  42. Ferguson, T. A., H. Kazama. 2005. Signals from dying cells: tolerance induction by the dendritic cell. Immunol. Res. 32: 99-108. [Medline]
  43. Orabona, C., P. Puccetti, C. Vacca, S. Bicciato, A. Luchini, F. Fallarino, R. Bianchi, E. Velardi, K. Perruccio, A. Velardi, et al 2006. Toward the identification of a tolerogenic signature in IDO-competent dendritic cells. Blood 107: 2846-2854. [Abstract/Free Full Text]
  44. Coates, P. T. H., F. J. Duncan, B. L. Colvin, Z. L. Wang, A. F. Zahorchak, W. J. Shufesky, A. E. Morelli, A. W. Thomson. 2004. In vivo-mobilized kidney dendritic cells are functionally immature, subvert alloreactive T-cell responses, and prolong organ allograft survival. Transplantation 77: 1080-1089. [Medline]
  45. Tiao, M. M., L. Lu, R. Tao, L. Wang, J. J. Fung, S. G. Qian. 2005. Prolongation of cardiac allograft survival by systemic administration of immature recipient dendritic cells deficient in NF-{kappa}B activity. Ann. Surg. 241: 497-505. [Medline]
  46. Rutella, S., S. Danese, G. Leone. 2006. Tolerogenic dendritic cells: cytokine modulation comes of age. Blood 108: 1435-1440. [Abstract/Free Full Text]
  47. DePaz, H. A., O. O. Oluwole, A. O. Adeyeri, P. Witkowski, M. X. Jin, M. A. Hardy, S. F. Oluwole. 2003. Immature rat myeloid dendritic cells generated in low-dose granulocyte macrophage-colony stimulating factor prolong donor-specific rat cardiac allograft survival. Transplantation 75: 521-528. [Medline]
  48. Kubo, T., R. D. Hatton, J. Oliver, X. F. Liu, C. O. Elson, C. T. Weaver. 2004. Regulatory T cell suppression and anergy are differentially regulated by proinflammatory cytokines produced by TLR-activated dendritic cells. J. Immunol. 173: 7249-7258. [Abstract/Free Full Text]
  49. Tan, J. K. H., H. C. ONeill. 2005. Maturation requirements for dendritic cells in T cell stimulation leading to tolerance versus immunity. J. Leukocyte Biol. 78: 319-324. [Abstract/Free Full Text]
  50. Kadowaki, N., S. Ho, S. Antonenko, R. D. Malefyt, R. A. Kastelein, F. Bazan, Y. J. Liu. 2001. Subsets of human dendritic cell precursors express different Toll-like receptors and respond to different microbial antigens. J. Exp. Med. 194: 863-869. [Abstract/Free Full Text]
  51. Naik, S. H., A. I. Proietto, N. S. Wilson, A. Dakic, P. Schnorrer, M. Fuchsberger, M. H. Lahoud, M. OKeeffe, Q. X. Shao, W. F. Chen, et al 2005. Cutting edge: Generation of splenic CD8+ and CD8 dendritic cell equivalents in fms-like tyrosine kinase 3 ligand bone marrow cultures. J. Immunol. 174: 6592-6597. [Abstract/Free Full Text]
  52. Uchijima, M., T. Nagata, T. Aoshi, Y. Koide. 2005. IFN-{gamma} overcomes low responsiveness of myeloid dendritic cells to CpG DNA. Immunol. Cell Biol. 83: 92-95. [Medline]
  53. Vicari, A. P., C. Chiodoni, C. Vaure, S. Ait-Yahia, C. Dercamp, F. Matsos, O. Reynard, C. Taverne, P. Merle, M. P. Colombo, et al 2002. Reversal of tumor-induced dendritic cell paralysis by CpG immunostimulatory oligonucleotide and anti-interleukin 10 receptor antibody. J. Exp. Med. 196: 541-549. [Abstract/Free Full Text]
  54. Warger, T., P. Osterloh, G. Rechtsteiner, M. Fassbender, V. Heib, B. Schmid, E. Schmitt, H. Schild, M. P. Radsak. 2006. Synergistic activation of dendritic cells by combined Toll-like receptor ligation induces superior CTL responses in vivo. Blood 108: 544-550. [Abstract/Free Full Text]
  55. Waldner, H., M. Collins, V. K. Kuchroo. 2004. Activation of antigen-presenting cells by microbial products breaks self tolerance and induces autoimmune disease. J. Clin. Invest. 113: 990-997. [Medline]
  56. Okano, F., M. Miriam, K. Furumoto, E. G. Engleman. 2005. In vivo manipulation of dendritic cells overcomes tolerance to unmodified tumor-associated self antigens and induces potent antitumor immunity. J. Immunol. 174: 2645-2652. [Abstract/Free Full Text]
  57. HamiltonWilliams, E. E., A. Lang, D. Benke, G. M. Davey, K. H. Wiesmuller, C. Kurts. 2005. Cutting edge: TLR ligands are not sufficient to break cross-tolerance to self-antigens. J. Immunol. 174: 1159-1163. [Abstract/Free Full Text]
  58. Rozkova, D., R. Horvath, J. Bartunkova, R. Spisek. 2006. Glucocorticoids severely impair differentiation and antigen presenting function of dendritic cells despite upregulation of Toll-like receptors. Clin. Immunol. 120: 260-271. [Medline]
  59. Gorczynski, R. M.. 2001. Transplant tolerance modifying antibody, to CD200 receptor, but not CD200, alters cytokine production profile from stimulated macrophages. Eur. J. Immunol. 31: 2331-2337. [Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gorczynski, R.
Right arrow Articles by Boudakov, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gorczynski, R.
Right arrow Articles by Boudakov, I.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS