The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

The Journal of Immunology, 2008, 180, 5506-5511
Copyright © 2008 by The American Association of Immunologists, Inc.
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, N.
Right arrow Articles by He, Y.-W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, N.
Right arrow Articles by He, Y.-W.

The Long Isoform of Cellular FLIP Is Essential for T Lymphocyte Proliferation through an NF-{kappa}B-Independent Pathway1

Nu Zhang, Kaycie Hopkins and You-Wen He2

Department of Immunology, Duke University Medical Center, Durham, NC 27710


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Although the long isoform of cellular FLIP (c-FLIPL) has been implicated in TCR-mediated signaling, its role in T cell proliferation remains controversial. Some studies have demonstrated that overexpression of c-FLIPL promotes T cell proliferation and NF-{kappa}B activation, whereas others have reported that c-FLIPL overexpression has no effect or even inhibits T cell proliferation. To establish the role of c-FLIPL in T lymphocyte proliferation, we have generated a conditional knockout mouse strain specifically lacking c-FLIPL in T lymphocytes. c-FLIPL–/– mice exhibit severely impaired effector T cell development after Listeria monocytogenes infection in vivo and c-FLIPL-deficient T cells display defective TCR-mediated proliferation in vitro. However, c-FLIPL–/– T cells exhibit normal NF-{kappa}B activity upon TCR stimulation. These results demonstrate that c-FLIPL is essential for T lymphocyte proliferation through an NF-{kappa}B-independent pathway.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The long isoform of cellular FLIP (c-FLIPL)3 is a well-established inhibitor of death receptor signaling (1, 2). Three isoforms of c-FLIP derived from mRNA alternative splicing have been identified in human cells: 55 kDa c-FLIPL, 26 kDa c-FLIPS, and 24 kDa c-FLIPR (2, 3). All three isoforms inhibit death receptor-induced apoptosis by interfering with procaspase-8 recruitment to the adaptor FADD (Fas-associated death domain protein) (1, 2). c-FLIPL is constitutively expressed in developing thymocytes as well as naive and activated T cells (4, 5). In contrast, c-FLIPS and c-FLIPR are up-regulated upon TCR stimulation (3, 6). Deletion of c-FLIP results in a survival defect in both single-positive (SP) thymocytes and mature T cells, indicating that at least one c-FLIP isoform is essential for T cell survival (4, 5).

In addition to its anti-apoptotic function, recent studies have implicated c-FLIPL in T cell proliferation. Overexpression of c-FLIPL enhances T cell proliferation and cytokine production in an NF-{kappa}B-dependent manner (7, 8). The role of c-FLIPL in T cell proliferation is thought to be mediated by its interaction with caspase-8 (1). Caspase-8 is activated upon TCR ligation, and active caspase-8 cleaves c-FLIPL into N-terminal c-FLIPp43 and C-terminal c-FLIPp12 (8). Overexpression studies have shown that c-FLIPp43 is as potent as c-FLIPL in promoting NF-{kappa}B activation (9). In addition, another recently described caspase-8 cleavage product of c-FLIPL, p22-FLIP, has been shown to interact with the I{kappa}B kinase complex and strongly induce NF-{kappa}B activation when overexpressed (10). Thus, c-FLIPL has been proposed to form a signaling complex with caspase-8 and FADD to activate NF-{kappa}B in T cells and to perform its function through the processed c-FLIPp43 or p22-FLIP fragment (1, 10).

Previous studies in which c-FLIPL was overexpressed in T lymphocytes have also generated many conflicting results. Although some studies have shown that transgenic (tg) expression of c-FLIPL results in increased CD3-induced proliferation (7), overexpression of c-FLIPL in Jurkat T cells promotes activation of NF-{kappa}B and ERK signaling pathways (11), and retroviral introduction of c-FLIPL did not affect T lymphocyte proliferation (12). In another study, tg expression of c-FLIPL in T cells was shown to inhibit CD3-induced proliferation as well as activation of ERK and NF-{kappa}B (13). In addition, c-FLIPL has been reported to inhibit activation of p38 MAPK and NF-{kappa}B in other cell types (14, 15, 16). These contradictory results are likely due to differences in the expression levels of c-FLIPL in each overexpression system. A recent report demonstrates that overexpression of c-FLIPL causes impairment of the ubiquitin-proteasome system (17), suggesting that overexpression of c-FLIPL may not be a useful approach in accurately defining its function in T lymphocyte proliferation. To establish the role of c-FLIPL in T lymphocyte proliferation, we have generated conditional knockout mice lacking c-FLIPL in T lymphocytes. c-FLIPL-deficient T cells show severe defects in effector T cell development in vivo and TCR-induced proliferation in vitro, but have normal NF-{kappa}B activity.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Generation of c-FLIPS bacterial artificial chromosome (BAC) tg mice

A c-FLIP wild-type (WT) BAC clone was modified using a system developed by Eberl G. et al. (18). In short, c-FLIPS cDNA, including its own stop codon and poly(A) signal, was fused to the start codon in exon 1 of c-FLIP gene (Fig. 1A). A 60 kb BAC fragment that is 15 kb downstream of the nearest 5' gene (Als2cr12) and 10 kb upstream of the nearest 3' gene (caspase-8) was used for injection. Three founders were obtained for each line and crossed to c-FLIPf/fLck-cre mice (5), and all mice displayed a similar phenotype. Animal usage was conducted according to protocols approved by the Duke University Institutional Animal Care and Use Committee.


Figure 1
View larger version (33K):
[in this window]
[in a new window]

  		FIGURE 1. Generation of c-FLIPL–/– mice. A, Schematic of c-FLIPS BAC tg constructs. A 60 kb BAC fragment was used for injection. B, Western blot analysis of c-FLIPL and c-FLIPS expression in thymocytes from WT, c-FLIP–/–, and c-FLIPL–/– mice. Total thymocytes were blotted with anti-c-FLIP Ab. {gamma}-tubulin serves as a loading control. C, FACS profiles of CD8+ SP and CD4+ SP thymocytes from 5- to 6-wk-old c-FLIPL–/– and control mice. Numbers represent frequency of CD24–, TCRβ+, or Qa-2+ mature SP cells. D, FACS profiles of CD4+ and CD8+ T cells in the spleen and peripheral blood of c-FLIPL–/– mice. Numbers represent frequency of CD4+ or CD8+ T cells. E, Total numbers of splenic CD4+ and CD8+ T cells in 5–8-wk-old c-FLIPL–/– and control mice. Squares and circles represent individual mice. Values of p > 0.1 between control and c-FLIPL–/– T cells. F, Apoptotic rates of c-FLIPL–/– CD8+ T cells with or without anti-CD3 stimulation. Total splenocytes were stimulated for 16 h and stained with anti-CD8, Annexin V, and 7-AAD. Data shown are representative of three experiments.

 
PCR analysis

PCR to assess the presence of the c-FLIPS BAC transgene was performed with 35 cycles of 94°C for 30 s, 52°C for 30 s, and 72°C for 120s. The primers are: forward, 5'- GAGGTTGAGGGACTTGGCATG-3'; and reverse, 5'- TCAGCAGGACCCTATAATCAG-3'.

Bacterial infection, intracellular IFN-{gamma} staining, and CTL assay

The recombinant Listeria monocytogenes strain engineered to secrete chicken OVA and pMHC/peptide tetramers were kindly provided by M. Bevan (University of Washington, Seattle, WA) (19). The recombinant Listeria monocytogenes strain engineered to secrete chicken OVA was grown in brain-heart infusion broth supplemented with 5 µg/ml erythromycin. Bacteria were diluted in PBS and injected i.v. at a dose of 2 x 103 CFU for primary infection. To examine IFN-{gamma} producing T cells, total splenocytes were incubated with 10–7 M OVA256–264 peptide in the presence of 3 µM monensin for 6 h. Alternatively, total splenocytes were incubated with Listeria-infected bone marrow macrophages for 20 h with the last 6 h in the presence of monensin. After ex vivo stimulation, splenocytes were surface stained, fixed, permeablized with 0.1% saponin, and stained for IFN-{gamma}. To examine the CTL activity of infected mice, splenocytes normalized for an equal number of CD8+ T cells were incubated with 51Cr-labeled EL-4 target cells pulsed with 10–7 M SIINFEKL peptide for 6 h at 37°C. Supernatants were collected and counted to determine the amount of 51Cr release. The percentage of specific lysis was calculated as 100 x ((experimental cpm – spontaneous cpm)/(maximum cpm – spontaneous cpm)).

Flow cytometric analysis

Single-cell suspensions of the thymus, spleen, and lymph nodes were incubated with an FcR blocker (2.4G2; eBioscience) after RBC lysis stained on ice for 30 min with FITC-, PE/Cy5-, or allophycocyanin-labeled mAb or biotinylated mAb followed by PE-streptavidin, and washed with PBS containing 2% FCS. A total of 1–5 x 104 events were collected on a FACScan flow cytometer (BD Biosciences) and analyzed using CellQuest (BD Biosciences) software. All fluorescence-labeled Abs, including anti-CD3, -CD4, -CD8, -CD24, -CD25, -CD69, -CD44, -CD62L, -TCR{alpha}β, -Qa-2, -IL-4, and -IFN-{gamma}, were obtained from eBioscience, BioLegend, or BD Biosciences. Apoptotic cells were defined by Annexin V and 7-AAD staining using an Annexin V-PE kit (BD Biosciences).

Lymphocyte activation and Western blot assays

Peripheral T cells were purified from the spleen and lymph nodes using an EasyStep mouse T cell enrichment kit from StemCell Technologies according to the manufacturer’s instructions. T cells were incubated with 10 µg/ml anti-CD3 (2C11) on ice for 30 min, washed with ice-cold RPMI 1640 containing 10% FBS, and cross-linked with 75 µg/ml rabbit anti-hamster IgG (Sigma-Aldrich) at 37°C for the amount of time indicated in the figures. Total cell lysates were generated after TCR stimulation and subjected to Western blot assay. Abs used for Western blots were anti-c-FLIP (clone Dave-2; Alexis Biochemical), anti-{gamma}-tubulin and -Erkp (Santa Cruz Biotechnology), and anti-pJNK, -pp38, -p-I-{kappa}B{alpha}, and -I-{kappa}B{alpha} (Cell Signaling Technology).

EMSA assays

A total of 107 purified T cells were incubated in complete medium or stimulated with 10 µg/ml plate-bound anti-CD3 and 1 µg/ml soluble anti-CD28 for 16 h. Nuclear extracts were prepared using a nuclear extraction kit from Active Motive according to the manufacturer’s instructions. A total of 10 µl of each extract was subjected to bandshift analysis as described (20). In short, EMSAs were performed using the following oligonucleotides and binding buffers: AP-1 oligonucleotide, 5'-CGCTTGATGACTCAGCCGGAA-3'; AP-1 5X binding buffer, 50 mM Tris-HCl (pH 7.5), 500 mM KCl, 2.5 mM MgCl2, 0.5 mM EDTA, 50% glycerol, 250 µg/ml poly(dI:dC), 5 mM DTT, and 1 mg/ml BSA; NF-{kappa}B oligonucleotide, 5'-ACCAAGAGGGATTTCACCTAAATC-3'; and NF-{kappa}B 5x binding buffer, 25 mM Tris-HCl (pH 7.5), 5 mM EDTA, 250 µg/ml poly(dI:dC), 5 mM DTT, and 1 mg/ml BSA. A total of 2 x 104 cpm of labeled probe was used in each reaction, and bandshifts were resolved on 5% polyacrylamide gels in 1x TBE running buffer.

Cell proliferation assays

CFSE-labeled (Molecular Probes) splenocytes were stimulated with plate-bound anti-CD3 (2C11; eBioscience) and/or anti-CD28 (clone 37.51; BioLegend) for 3 days, and proliferation was assessed by measuring CFSE dilution in CD4+ or CD8+ T cells by FACS analysis.

Semiquantitative RT-PCR analysis

A total of 5 x 106 purified peripheral T cells were stimulated with 10 µg/ml plate-bound anti-CD3 Ab for 3 h. Total RNA was extracted and subjected to RT-PCR analysis. The PCR reaction used to measure I-{kappa}B{alpha} expression consisted of 30 cycles of 94°C for 30s, 55°C for 30s, and 72°C for 30s. The primers are: forward, 5'AGGATGAGCTGCCCTATGATGA 3'; and reverse, 5'TGCCACTTTCCACTTATAATGTCAGA 3'.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
Generation of c-FLIPL conditional knockout mice

Conventional c-FLIP-deficient mice die during embryogenesis (21). To examine the role of c-FLIP in T lymphocytes, we generated mice conditionally lacking both c-FLIPL and c-FLIPS isoforms in T lymphocytes (c-FLIPf/fLck-cre, referred to here as c-FLIP–/–) and demonstrated that loss of c-FLIP expression results in a severe defect in the mature T cell compartment due to massive apoptosis at the SP thymocyte stage (5). This lack of mature T cells in c-FLIP–/– mice prevented further analysis of c-FLIP function in mature T cell proliferation and signaling.

As both c-FLIPL and c-FLIPS are expressed in thymocytes and the major function of c-FLIPS is to inhibit apoptosis (1), we reasoned that conditional deletion of c-FLIPL but not c-FLIPS in thymocytes would allow development of mature T cells. To achieve this, we have generated a BAC tg mouse line expressing c-FLIPS (Fig. 1A) and crossed this tg line to the c-FLIP–/– line. The resulting c-FLIP–/–c-FLIPS BAC tg mice lack the expression of c-FLIPL in T lymphocytes but express c-FLIPS under the control of endogenous regulatory elements and, therefore, are referred to as c-FLIPL–/– mice. As expected, c-FLIPL was only detected in WT thymocytes, while c-FLIPS was detected in both WT and c-FLIPL–/– thymocytes (Fig. 1B). As a control, neither isoform was detected in c-FLIP–/– thymocytes.

Expression of the c-FLIPS BAC tg rescued mature T cell development in c-FLIP–/– mice, as indicated by the comparable frequency of mature HSAlowTCRhigh CD8+ SP and HSAlowQa-2+ CD4+ SP thymocytes in c-FLIPL–/– and c-FLIP+/– control mice (Fig. 1C). Furthermore, the absolute numbers of mature CD4+ and CD8+ T cells in the spleen, lymph node, and peripheral blood of c-FLIPL–/– mice were comparable to those in control mice (Fig. 1, D and E; data not shown). Importantly, the apoptotic rates of mature T cells in c-FLIPL–/– mice with or without TCR stimulation were similar to those in control (c-FLIP+/+ or c-FLIPf/f) mice (Fig. 1F), indicating that the lack of c-FLIPL expression in mature T cells does not result in enhanced apoptosis, and further supporting that the major function of c-FLIPS is to inhibit T cells from apoptosis.

Impaired effector T cell development in c-FLIPL–/– mice

We first examined the role of c-FLIPL in the development of CD8+ T effector cells using a L. monocytogenes infection model (22). c-FLIPL–/– and control mice were infected i.v. with 2 x 103 L. monocytogenes expressing chicken OVA (Ova). Seven days later, the primary CD8+ T cell response was examined by intracellular staining of IFN-{gamma} after restimulation with Ova257–264 peptide or L. monocytogenes-infected macrophages. Under both conditions, IFN-{gamma}-producing CD8+ effector T cells were readily detected in control mice (Fig. 2, A and B). Strikingly, only background levels of IFN-{gamma}+ CD8+ T cells were detected in c-FLIPL–/– mice (Fig. 2, A and B). The absolute number of Ova-specific CD8+ effector T cells in c-FLIPL–/– mice was dramatically lower than that in littermate controls (Fig. 2E). Similar results were observed using MHC class I/Ova tetramer staining (data not shown). Furthermore, the frequency of activated/memory CD8+ T cells (CD62L–CD44+) in c-FLIPL–/– mice was significantly lower than that in control mice 7 days after infection (Fig. 2C).


Figure 2
View larger version (37K):
[in this window]
[in a new window]

  		FIGURE 2. Impaired development of effector CD8+ T cells in c-FLIPL–/– mice. A and B, FACS analysis of IFN-{gamma}-producing Ag-specific CD8+ effector T cells in c-FLIPL–/– mice.Seven days after Listeria infection, total splenocytes were incubated with Ova257–264 for 6 h (A) or with Listeria-infected bone marrow-derived macrophages for 20 h (B) and stained with anti-IFN-{gamma} and anti-CD8. Shown are frequencies of Ag-specific CD8+ T cells among total CD8+ T cells. C, FACS profile of splenic CD8+ T cells before and after Listeria infection. Numbers represent frequency of CD44highCD62Llow activated/memory T cells. D, Lack of ex vivo CTL activity in c-FLIPL–/– mice. Data are representative of killing activity from seven individual mice. E, Number of IFN-{gamma}-producing cells in c-FLIPf/f, c-FLIPL–/–, and c-FLIPf/fc-FLIPS BAC tg mice. Mice were infected with Listeria and the number of Ova-specific CD8+ T cells was determined by FACS as in A.

 
A previous study demonstrated that overexpression of c-FLIPS in T cells inhibited T cell proliferation (23). To rule out the possibility that the impaired CD8+ effector T cell differentiation observed in c-FLIPL–/– mice was due to inhibition by the c-FLIPS BAC tg, we compared CD8+ effector T cell development in c-FLIPf/f and c-FLIPf/fc-FLIPS BAC tg mice. The presence of the c-FLIPS BAC tg did not affect CD8+ effector T cell development upon L. monocytogenes infection, indicating that the defect observed in c-FLIPL–/– mice is due to loss of c-FLIPL expression (Fig. 2E). Consistent with this lack of CD8+ effector T cells, no CTL-mediated killing was detected in c-FLIPL–/– mice (Fig. 2D). These results demonstrate that c-FLIPL is essential for CD8+ effector T cell development in vivo.

Next, we examined CD4+ effector T cell development in c-FLIPL–/– mice using L. monocytogenes infection and DNP-keyhole limpet hemocyanin (DNP-KLH) immunization. Seven days after Listeria infection, CD4+ effector T cells were determined by intracellular IFN-{gamma} staining. The percent of CD4+ effector T cells was reduced by ~70% in c-FLIPL–/– mice when compared with that in control mice (Fig. 3A). Furthermore, in vitro Ag restimulation-induced CD4+ effector T cell proliferation was decreased in c-FLIPL–/– mice immunized with DNP-KLH (Fig. 3B). Since c-FLIPL promotes Th2 differentiation in overexpression studies (24), IL-4 production was examined in c-FLIPL–/– CD4+ T cells. As shown in Fig. 3C, both IL-4 and IFN-{gamma} production was impaired in in vitro differentiated c-FLIPL–/– effector CD4+ T cells under neutral condition. These data demonstrate that the development of effector CD4+ T cells also depends on c-FLIPL.


Figure 3
View larger version (29K):
[in this window]
[in a new window]

  		FIGURE 3. Defective CD4+ effector T cell development in c-FLIPL–/– mice. A, FACS analysis of IFN-{gamma}-producing CD4+ effector T cells in c-FLIPL–/– mice 7 days after Listeria infection. Total splenocytes were stimulated with Listeria-infected bone marrow-derived macrophages for 20 h before intracellular cytokine staining. B, Decreased effector CD4+ T cell proliferation in c-FLIPL–/– mice. Eight days after immunization with 100 µg/mouse DNP-KLH, splenocytes were labeled with CFSE and stimulated with DNP-KLH for 3 days in vitro. Cell proliferation was assessed by FACS analysis. Histograms were gated on 7-AAD–CD4+ cells. C, Impaired IL-4 and IFN-{gamma} production in c-FLIPL–/– CD4+ T cells. Purified CD4+ T cells were stimulated by plate-bound anti-CD3 (5 µg/ml) and anti-CD28 (2 µg/ml) in the presence of 50 U/ml IL-2 for 5 days. Cells were restimulated by plate-bound anti-CD3 for 6 h. IL-4 and IFN-{gamma} production was examined by intracellular cytokine staining and FACS analysis.

 
Defective TCR-induced proliferation in c-FLIPL–/– T cells

The defective effector T cell development observed in c-FLIPL–/– mice may be due to defective T cell activation and/or proliferation because apoptosis was not enhanced after TCR activation in c-FLIPL–/– T cells (Fig. 1F). We examined T cell proliferation after stimulation with plate-bound anti-CD3 with or without anti-CD28. The frequencies of proliferating c-FLIPL–/– CD4+ and CD8+ T cells after TCR stimulation were greatly reduced when compared with those of control T cells (Fig. 4). Engagement of costimulatory molecules with mAb against CD28, OX40, 4-1BB, and CD27 did not rescue the proliferative defects in c-FLIPL–/– T cells (Fig. 4; data not shown). Interestingly, in contrast to the complete lack of CD8+ effector T cells in vivo, a fraction of c-FLIPL–/– CD8+ T cells responded to TCR stimulation in vitro (Fig. 4), suggesting that strong stimulation of TCR with anti-CD3 Ab may partially overcome the lack of c-FLIPL.


Figure 4
View larger version (28K):
[in this window]
[in a new window]

  		FIGURE 4. Defective TCR-induced proliferation in c-FLIPL–/– T cells. Total splenocytes from WT and c-FLIPL–/– mice were labeled with CFSE and stimulated with plate-bound Abs for 3 days. Cell proliferation was determined by FACS analysis. Histograms were gated on 7-AAD– CD4+ or CD8+ populations. Numbers represent frequency of T cells that have undergone cell proliferation.

 
The defective proliferation of c-FLIPL–/– T cells may reflect impaired activation. We thus examined the expression of activation markers CD25 and CD69 on c-FLIPL–/– T cells. At 6 h after anti-CD3 stimulation, the expression of CD69 and CD25 on c-FLIPL–/– T cells was slightly lower than that on control T cells (Fig. 5A; data not shown). However, at 24 h after TCR activation, c-FLIPL–/– T cells expressed slightly higher levels of CD69 and CD25 than control cells (Fig. 5B). These results suggest that while c-FLIPL–/– T cells can be activated, activation occurs with slightly delayed kinetics.


Figure 5
View larger version (38K):
[in this window]
[in a new window]

  		FIGURE 5. Activation and IL-2 production in c-FLIPL–/– T cells. Total splenocytes from c-FLIPL–/– and control mice were activated by plate-bound anti-CD3 for 6 h (A) or 24 h (B), and CD25 and CD69 up-regulation was analyzed by flow cytometry. C, Total splenocytes were stimulated with plate-bound or soluble anti-CD3. A total of 16 or 48 h later, IL-2 was detected in supernatants by ELISA.

 
IL-2 production in c-FLIPL–/– T cells

Another possible cause for the impaired proliferation of c-FLIPL–/– T cells is that these cells exhibit defective IL-2 production. To test this, we measured the amount of IL-2 in the supernatants of anti-CD3-stimulated T cells by ELISA. c-FLIPL–/– T cells produced 40–50% less IL-2 than control T cells 16 h after stimulation, but produced comparable levels of IL-2 48 h after stimulation (Fig. 5C). Furthermore, exogenous IL-2 cannot rescue the proliferative defects in c-FLIPL–/– T cells (data not shown). These data indicate that IL-2 production is defective in the early phase but normal in the late phase of activation of c-FLIPL–/– T cells and suggest that the defective proliferation of c-FLIPL–/– T cells is not likely due to defective IL-2 production.

MAPK pathways and NF-{kappa}B activity in c-FLIPL–/– T cells

To examine the mechanisms of c-FLIPL-dependent T cell proliferation, we examined the MAPK pathway in c-FLIPL–/– T cells. Phosphorylation of ERK, JNK, and p38 in c-FLIPL–/– T cells was comparable to that in WT T cells upon anti-CD3 stimulation (Fig. 6A). Furthermore, c-FLIPL–/– T cells exhibit nuclear AP-1 DNA binding activity similar to that in WT T cells upon TCR stimulation (Fig. 6C). These results indicate that c-FLIPL is not essential for activation of the MAPK/AP-1 pathways.


Figure 6
View larger version (53K):
[in this window]
[in a new window]

  		FIGURE 6. Normal MAPK and NF-{kappa}B activity in c-FLIPL–/– T cells. A, Purified T cells were incubated with 10 µg/ml anti-CD3 on ice and then crosslinked with anti-hamster IgG at 37°C for the indicated number of minutes. Cell lysate was analyzed by Western blot. B, Purified T cells were stimulated by 10 µg/ml plate-bound anti-CD3 for 0 or 3 h. Total RNA was extracted and subjected to RT-PCR analysis. Hypoxanthine phosphoribosyltransferase serves as a loading control. C, NF-{kappa}B binding activity in c-FLIPL–/– T cells after activation. Purified T cells were stimulated with 10 µg/ml plate-bound anti-CD3 and 1 µg/ml soluble anti-CD28 for 16 h. Nuclear extract was analyzed by EMSA using NF-{kappa}B and AP-1 binding probes.

 
Next, we examined NF-{kappa}B activity in c-FLIPL–/– T cells. It has been shown that overexpression of c-FLIPL activates NF-{kappa}B through interaction with TRAF2 and receptor interacting protein (9). However, c-FLIPL–/– T cells exhibited normal I-{kappa}B{alpha} degradation, phosphorylation (Fig. 6A), and nuclear NF-{kappa}B DNA binding activity (Fig. 6C) after TCR stimulation. In addition, I-{kappa}B{alpha} mRNA induction after TCR stimulation, which is another well-accepted indicator of NF-{kappa}B function (25), was similar in both c-FLIPL–/– and control T cells (Fig. 6B). Collectively, these results demonstrate that c-FLIPL is not required for TCR-induced NF-{kappa}B activation.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
Most data supporting a role for c-FLIPL in T cell proliferation and NF-{kappa}B activation were generated in overexpression studies using tg mice or cell lines (8, 9, 11). Although our previous study and those of others have used loss-of-function models to examine the role of c-FLIP in SP thymocyte and mature T cell proliferation (4, 5), these results are likely complicated by the fact that T cells lacking both c-FLIPL and c-FLIPS die rapidly after activation. Thus, it is essential to assess the function of c-FLIPL in T cell proliferation in a loss-of-function model without the complication of cell death. Our conditional c-FLIPL knockout mice are ideal for this purpose.

Extensive investigations have been performed to dissect the role of c-FLIP, caspase-8, and FADD in TCR signaling. An attractive model has been proposed in which c-FLIP/caspase-8/FADD form a signaling complex that is critical for TCR-induced NF-{kappa}B activation through c-FLIPp43 and/or p22-FLIP, which are the caspase-8 cleavage products of c-FLIPL (1, 10). However, our results clearly demonstrated c-FLIPL mediated T cell proliferation through an NF-{kappa}B-independent mechanism. Three different well-accepted assays have been performed to test NF-{kappa}B activity in c-FLIPL–/– T cells: I-{kappa}B{alpha} phosphorylation and degradation, nuclear NF-{kappa}B DNA binding activity, and I-{kappa}B{alpha} mRNA induction. Results from all three assays show that NF-{kappa}B activation is not defective in the absence of c-FLIPL. These assays demonstrate that neither NF-{kappa}B nuclear translocation nor the function of nuclear NF-{kappa}B in activating target gene expression are impaired in c-FLIPL–/– T cells. In addition, overexpression of c-FLIPL in tg mice or Jurkat T cells also promotes ERK phosphorylation and AP-1 activation (11, 24). However, our results clearly demonstrate that the MAPK/AP-1 pathway is intact in the absence of c-FLIPL. This result indicates that c-FLIPL-mediated T cell proliferation is not mediated through the MAPK/AP-1 pathway. The activation of Erk, AP-1, and NF-{kappa}B in c-FLIPL overexpressing cells may result from some nonspecific effects caused by interference with other intracellular processes. This notion has been supported by a recent publication showing that ectopically expressed c-FLIPL accumulates in aggregates in the peri-nuclear region in cells (17). Furthermore, the overexpressed c-FLIPL aggregates are refractory to solubilization and inhibit the function of the ubiquitin-proteasome system (17). Thus, intracellular signaling pathways regulated by the ubiquitin-proteasome system may be disrupted by c-FLIPL overexpression. Our conditional c-FLIPL-deficient mice represent an excellent model for determining the intracellular pathway by which c-FLIPL mediates T cell proliferation.


   Acknowledgments
 
We thank T. Matt Holl and Cheryl Bock for help in generating the c-FLIPL BAC tg mice, and Dr. Ivan Dzhagalov and Claire Gordy for critically reading the manuscript.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by National Institutes of Health Grants CA92123 and AI54683. Back

2 Address correspondence and reprint requests to Dr. You-Wen He, Box 3010, Department of Immunology, Duke University Medical Center, Durham, NC 27710. E-mail address: he000004{at}mc.duke.edu Back

3 Abbreviations used in this paper: c-FLIPL, long isoform of cellular FLIP; FADD, Fas-associated death domain protein; BAC, bacterial artificial chromosome; SP, single-positive; tg, transgenic; DNP-KLH, DNP-keyhole limpet hemocyanin; WT, wild type. Back

Received for publication October 3, 2007. Accepted for publication February 10, 2008.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Budd, R. C., W. C. Yeh, J. Tschopp. 2006. cFLIP regulation of lymphocyte activation and development. Nat. Rev. Immunol. 6: 196-204. [Medline]
  2. Thome, M., J. Tschopp. 2001. Regulation of lymphocyte proliferation and death by FLIP. Nat. Rev. Immunol. 1: 50-58. [Medline]
  3. Golks, A., D. Brenner, C. Fritsch, P. H. Krammer, I. N. Lavrik. 2005. c-FLIPR, a new regulator of death receptor-induced apoptosis. J. Biol. Chem. 280: 14507-14513. [Abstract/Free Full Text]
  4. Chau, H., V. Wong, N. J. Chen, H. L. Huang, W. J. Lin, C. Mirtsos, A. R. Elford, M. Bonnard, A. Wakeham, A. I. You-Ten, et al 2005. Cellular FLICE-inhibitory protein is required for T cell survival and cycling. J. Exp. Med. 202: 405-413. [Abstract/Free Full Text]
  5. Zhang, N., Y. W. He. 2005. An essential role for c-FLIP in the efficient development of mature T lymphocytes. J. Exp. Med. 202: 395-404. [Abstract/Free Full Text]
  6. Schmitz, I., H. Weyd, A. Krueger, S. Baumann, S. C. Fas, P. H. Krammer, S. Kirchhoff. 2004. Resistance of short term activated T cells to CD95-mediated apoptosis correlates with de novo protein synthesis of c-FLIPshort. J. Immunol. 172: 2194-2200. [Abstract/Free Full Text]
  7. Lens, S. M., T. Kataoka, K. A. Fortner, A. Tinel, I. Ferrero, R. H. MacDonald, M. Hahne, F. Beermann, A. Attinger, H. A. Orbea, et al 2002. The caspase 8 inhibitor c-FLIP(L) modulates T-cell receptor-induced proliferation but not activation-induced cell death of lymphocytes. Mol. Cell. Biol. 22: 5419-5433. [Abstract/Free Full Text]
  8. Dohrman, A., T. Kataoka, S. Cuenin, J. Q. Russell, J. Tschopp, R. C. Budd. 2005. Cellular FLIP (long form) regulates CD8+ T cell activation through caspase-8-dependent NF-{kappa}B activation. J. Immunol. 174: 5270-5278. [Abstract/Free Full Text]
  9. Kataoka, T., J. Tschopp. 2004. N-terminal fragment of c-FLIP(L) processed by caspase 8 specifically interacts with TRAF2 and induces activation of the NF-{kappa}B signaling pathway. Mol. Cell. Biol. 24: 2627-2636. [Abstract/Free Full Text]
  10. Golks, A., D. Brenner, P. H. Krammer, I. N. Lavrik. 2006. The c-FLIP-NH2 terminus (p22-FLIP) induces NF-{kappa}B activation. J. Exp. Med. 203: 1295-1305. [Abstract/Free Full Text]
  11. Kataoka, T., R. C. Budd, N. Holler, M. Thome, F. Martinon, M. Irmler, K. Burns, M. Hahne, N. Kennedy, M. Kovacsovics, J. Tschopp. 2000. The caspase-8 inhibitor FLIP promotes activation of NF-{kappa}B and Erk signaling pathways. Curr. Biol. 10: 640-648. [Medline]
  12. Van Parijs, L., Y. Refaeli, A. K. Abbas, D. Baltimore. 1999. Autoimmunity as a consequence of retrovirus-mediated expression of C-FLIP in lymphocytes. Immunity 11: 763-770. [Medline]
  13. Tai, T. S., L. W. Fang, M. Z. Lai. 2004. c-FLICE inhibitory protein expression inhibits T-cell activation. Cell Death Differ. 11: 69-79. [Medline]
  14. Grambihler, A., H. Higuchi, S. F. Bronk, G. J. Gores. 2003. cFLIP-L inhibits p38 MAPK activation: an additional anti-apoptotic mechanism in bile acid-mediated apoptosis. J. Biol. Chem. 278: 26831-26837. [Abstract/Free Full Text]
  15. Kreuz, S., D. Siegmund, J. J. Rumpf, D. Samel, M. Leverkus, O. Janssen, G. Hacker, O. Dittrich-Breiholz, M. Kracht, P. Scheurich, H. Wajant. 2004. NF{kappa}B activation by Fas is mediated through FADD, caspase-8, and RIP and is inhibited by FLIP. J. Cell Biol. 166: 369-380. [Abstract/Free Full Text]
  16. Bannerman, D. D., K. T. Eiting, R. K. Winn, J. M. Harlan. 2004. FLICE-like inhibitory protein (FLIP) protects against apoptosis and suppresses NF-{kappa}B activation induced by bacterial lipopolysaccharide. Am. J. Pathol. 165: 1423-1431. [Abstract/Free Full Text]
  17. Ishioka, T., R. Katayama, R. Kikuchi, M. Nishimoto, S. Takada, R. Takada, S. Matsuzawa, J. C. Reed, T. Tsuruo, M. Naito. 2007. Impairment of the ubiquitin-proteasome system by cellular FLIP. Genes Cells 12: 735-744. [Abstract/Free Full Text]
  18. Sparwasser, T., S. Gong, J. Y. Li, G. Eberl. 2004. General method for the modification of different BAC types and the rapid generation of BAC transgenic mice. Genesis 38: 39-50. [Medline]
  19. Sun, J. C., M. J. Bevan. 2003. Defective CD8 T cell memory following acute infection without CD4 T cell help. Science 300: 339-342. [Abstract/Free Full Text]
  20. Sun, Z., C. W. Arendt, W. Ellmeier, E. M. Schaeffer, M. J. Sunshine, L. Gandhi, J. Annes, D. Petrzilka, A. Kupfer, P. L. Schwartzberg, D. R. Littman. 2000. PKC-theta is required for TCR-induced NF-{kappa}B activation in mature but not immature T lymphocytes. Nature 404: 402-407. [Medline]
  21. Yeh, W. C., A. Itie, A. J. Elia, M. Ng, H. B. Shu, A. Wakeham, C. Mirtsos, N. Suzuki, M. Bonnard, D. V. Goeddel, T. W. Mak. 2000. Requirement for Casper (c-FLIP) in regulation of death receptor-induced apoptosis and embryonic development. Immunity 12: 633-642. [Medline]
  22. Zhang, N., Y. W. He. 2005. The antiapoptotic protein Bcl-xL is dispensable for the development of effector and memory T lymphocytes. J. Immunol. 174: 6967-6973. [Abstract/Free Full Text]
  23. Oehme, I., F. Neumann, S. Bosser, M. Zornig. 2005. Transgenic overexpression of the Caspase-8 inhibitor FLIP(short) leads to impaired T cell proliferation and an increased memory T cell pool after staphylococcal enterotoxin B injection. Eur. J. Immunol. 35: 1240-1249. [Medline]
  24. Wu, W., L. Rinaldi, K. A. Fortner, J. Q. Russell, J. Tschopp, C. Irvin, R. C. Budd. 2004. Cellular FLIP long form-transgenic mice manifest a Th2 cytokine bias and enhanced allergic airway inflammation. J. Immunol. 172: 4724-4732. [Abstract/Free Full Text]
  25. Suzuki, N., S. Suzuki, D. G. Millar, M. Unno, H. Hara, T. Calzascia, S. Yamasaki, T. Yokosuka, N. J. Chen, A. R. Elford, et al 2006. A critical role for the innate immune signaling molecule IRAK-4 in T cell activation. Science 311: 1927-1932. [Abstract/Free Full Text]

Related articles in The JI:

IN THIS ISSUE

The JI 2008 180: 5155-5156. [Full Text]  



This article has been cited by other articles:


Home page
 J. Immunol.Home page
N. Zhang, K. Hopkins, and Y.-W. He
c-FLIP Protects Mature T Lymphocytes from TCR-Mediated Killing
J. Immunol., October 15, 2008; 181(8): 5368 - 5373.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, N.
Right arrow Articles by He, Y.-W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, N.
Right arrow Articles by He, Y.-W.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS