The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


The Journal of Immunology, 2008, 180, 5187 -5200
Copyright © 2008 by The American Association of Immunologists, Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rynda, A.
Right arrow Articles by Pascual, D. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rynda, A.
Right arrow Articles by Pascual, D. W.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH

Low-Dose Tolerance Is Mediated by the Microfold Cell Ligand, Reovirus Protein {sigma}11

Agnieszka Rynda*, Massimo Maddaloni*, Dagmara Mierzejewska{dagger}, Javier Ochoa-Repáraz*, Tomasz Maslanka*, Kathryn Crist*, Carol Riccardi*, Beata Barszczewska*, Kohtaro Fujihashi{ddagger}, Jerry R. McGhee{ddagger} and David W. Pascual2,*

* Veterinary Molecular Biology, Montana State University, Bozeman, MT 59718; {dagger} Department of Food Chemistry, Institute of Food Research, Polish Academy of Science, Olsztyn, Poland; and {ddagger} Departments of Pediatric Dentistry and Microbiology, Immunobiology Vaccine Center, University of Alabama at Birmingham, Birmingham AL 35294


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Mucosal tolerance induction generally requires multiple or large Ag doses. Because microfold (M) cells have been implicated as being important for mucosal tolerance induction and because reovirus attachment protein {sigma}1 (p{sigma}1) is capable of binding M cells, we postulated that targeting a model Ag to M cells via p{sigma}1 could induce a state of unresponsiveness. Accordingly, a genetic fusion between OVA and the M cell ligand, reovirus p{sigma}1, termed OVA-p{sigma}1, was developed to enhance tolerogen uptake. When applied nasally, not parenterally, as little as a single dose of OVA-p{sigma}1 failed to induce OVA-specific Abs even in the presence of adjuvant. Moreover, the mice remained unresponsive to peripheral OVA challenge, unlike mice given multiple nasal OVA doses that rendered them responsive to OVA. The observed unresponsiveness to OVA-p{sigma}1 could be adoptively transferred using cervical lymph node CD4+ T cells, which failed to undergo proliferative or delayed-type hypersensitivity responses in recipients. To discern the cytokines responsible as a mechanism for this unresponsiveness, restimulation assays revealed increased production of regulatory cytokines, IL-4, IL-10, and TGF-β1, with greatly reduced IL-17 and IFN-{gamma}. The induced IL-10 was derived predominantly from FoxP3+CD25+CD4+ T cells. No FoxP3+CD25+CD4+ T cells were induced in OVA-p{sigma}1-dosed IL-10-deficient (IL-10–/–) mice, and despite showing increased TGF-β1 synthesis, these mice were responsive to OVA. These data demonstrate the feasibility of using p{sigma}1 as a mucosal delivery platform specifically for low-dose tolerance induction.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Mucosal tolerance is a dose-dependent process (1, 2, 3) requiring either high doses or multiple administrations of Ag typically applied orally. The former mode induces tolerance by clonal anergy/deletion of effector cells, whereas the latter, based on repeated low-dose administration, causes active suppression of effector cells (3, 4, 5, 6, 7). Such suppression occurs via activation of specific regulatory cells, among which CD25+CD4+ T regulatory (Treg)3 cells have been best described (2, 6). Although the phenotypic characteristics of Treg cells are still being investigated, currently, this naturally anergic peripheral CD25+CD4+ T cell population is thought to normally constitute not more than 5–10% of total peripheral CD4+ T cells (8, 9). Specific Treg cells are known to express the nuclear forkhead box P3 (FoxP3) transcription factor and suppress the immune response in an IL-10- and/or TGF-β-dependent fashion (10).

Peyer’s patches (PPs) are thought to be required for induction of oral tolerance (1, 6, 11) based upon the findings that treatment of female mice with soluble lymphotoxin-β receptor-Ig fusion protein during gestation results in the disruption of the peripheral lymph nodes (LNs) and PPs in their offspring, leaving the mesenteric, sacral, and cervical LNs (CLNs) intact (12). Offspring of such PPnull mice subjected to a high-dose OVA oral tolerance regimen do not respond to peripheral OVA challenge (11). The PPs (1, 6, 11) and an analogous structure in the upper respiratory tract, the nasopharyngeal - associated lymphoid tissue (NALT; Refs. 13 and 14), actively facilitate immunity or unresponsiveness by luminal Ag sampling (2, 14, 15) via a specialized epithelium containing microfold (M) cells (16). Ags are subsequently transported from the luminal surface via M cells, which localize in the follicle-associated epithelium to the subepithelial dome area for eventual presentation to mucosal B and T cells (15, 17). A number of pathogens, such as reovirus and Salmonella, specifically target this specialized follicle-associated epithelium to infect the host (18, 19, 20, 21, 22). Reovirus infects the host via its cell adhesin, protein {sigma}1 (p{sigma}1), that is responsible for reovirus attachment to M cells (14, 18, 19, 20). Previous studies demonstrated binding of recombinant fusion p{sigma}1 to NALT, suggesting that a p{sigma}1-based vehicle can be applied for genetic vaccination of mucosal tissues (14, 23). A modified version of p{sigma}1 obtained by chemically conjugating p{sigma}1 to poly-L-lysine significantly enhanced immunity to the encoded DNA vaccine following nasal administration (14, 24). Due to these targeting capabilities, we queried whether recombinant p{sigma}1 could ferry soluble proteins to mucosal tissues as well.

To test this possibility, a cDNA encoding for the model Ag, OVA, was cloned 5' to p{sigma}1 as a histidine-tag fusion protein and termed OVA-p{sigma}1. We demonstrated here that mice nasally immunized with the OVA-p{sigma}1 fusion protein become tolerogenic to OVA and resistant to peripheral challenge as a result of the generation of Ag-specific Treg cells, which, in turn, actively suppress effector T cells. Immunization with OVA-p{sigma}1 significantly increased the numbers of IL-4-producing CD25CD4+ T cells, together with IL-10-producing Treg cells, which inhibited the proliferation of OVA-specific CD4+ T cells in vivo and successfully suppressed production of proinflammatory cytokines. In the absence of IL-10, OVA-p{sigma}1-mediated tolerance was lost. Thus, these studies show that nasal p{sigma}1-Ag delivery is an effective means to induce systemic tolerance.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Preparation of OVA-p{sigma}1

Protein {sigma}1 was recloned without its fusion maltose-binding protein partner (23) to allow expression in the yeast Pichia pastoris vector pPICB bearing a his-tag C terminus for protein purification (Invitrogen Life Technologies), referred to as p{sigma}1. To obtain the fusion protein OVA-p{sigma}1, OVA was amplified with appropriate pairs of primers from an OVA cDNA. The 5' primer encoded an EcoRI site and an ATG initiation codon embedded into an optimal Kozak’s sequence. The 3' primer provided a SalI site. The PCR product was gel-purified and cloned into an intermediate topocloning vector. The insert was excised by cutting with EcoRI and SalI and gel-purified again, resulting in EcoRI and SalI ends. The upstream primer for p{sigma}1 contained a SalI site designed to frame the OVA SalI end; the downstream primer contained a KpnI primer designed to frame the fused protein to the his tag present in the P. pastoris expression vector pPICB. The PCR products were gel-purified and cloned into a topocloning vector. The inserts were then excised by cutting with SalI and KpnI and gel-purified again, thus having SalI and KpnI ends. Finally, the yeast expression vector, pPICB, was cut with EcoRI and KpnI. A tripartite ligation was set up to join together these components: 1) the "Ag" (OVA) as an EcoRI-SalI fragment; 2) the "transporter" (p{sigma}1), as a SalI-KpnI fragment; and 3) the vector cut with EcoRI and KpnI. The junction between the "passenger Ag" and the "transporter" featured a flexible linker (Gly-Arg-Pro) to minimize steric hindrance between the components. The resulting construct was sequenced and expressed in the yeast P. pastoris, according to the manufacturer’s directions (Invitrogen Life Technologies). Recombinant proteins were extracted from yeast cells by a bead-beater (Biospec Products) and purified on a Talon metal affinity resin (BD Biosciences), according to manufacturer’s instructions. Proteins were assessed for purity and quality by Coomassie-stained polyacrylamide gels and by Western blot analysis using a polyclonal rabbit anti-p{sigma}1 (produced in-house) or a polyclonal rabbit anti-OVA Ab (Sigma-Aldrich). All recombinant proteins migrated as a single band with the expected molecular weight.

Mice

Female BALB/c and C57BL/6N mice (Frederick Cancer Research Facility, National Cancer Institute, Frederick, MD) were used throughout this study. DO11.10 and IL-10–/– breeder pairs were obtained from The Jackson Laboratory to establish our colonies. All mice were maintained in the Montana State University (MSU) Animal Resources Center under pathogen-free conditions in individually ventilated cages under HEPA-filtered barrier conditions and were fed sterile food and water ad libitum. The mice were free of bacterial and viral pathogens, as determined by Ab screening and histopathologic analysis of major organs and tissues. All animal studies were approved by the MSU Institutional Animal Care and Use Committee.

Immunizations, tolerance induction, and OVA-specific challenge

For tolerance induction, mice (five mice per group) were nasally dosed up to three times, as described in the text, with 50–100 µg of OVA-p{sigma}1 alone or in combination with cholera toxin (CT; List Biologicals): 5 µg of CT for the initial dose and 2.5 µg with each boost (25). OVA-p{sigma}1 was administered nasally in a volume of no >20 µl/dose up to four times a day, with no less than 2.5-h intervals between each administration. Mice were nasally dosed with OVA or OVA-p{sigma}1 plus 25 µg of CpG oligodeoxynucleotide cDNA (CpG-ODN; Sigma-Aldrich), TCCATGACGTTCCTGACGTT (26). As a tolerance control, a group of age-matched mice received a single oral 25-mg dose of OVA (grade V; Sigma-Aldrich) in 200 µl of saline (17). To stimulate anti-OVA immunity, mice were nasally dosed with 100 µg of OVA (10 mg/ml) with or without adjuvant (CT or ODN). For peripheral challenge, mice were given a s.c. injection at 1:1 ratio of 100 µg of OVA in IFA (Sigma-Aldrich) for a total volume of 100 µl/mouse.

Sample collections and Ab ELISA

Serum (saphenous vein) and fecal samples were collected weekly from each mouse. Fecal extractions (4, 14, 25) and vaginal washes (25) were performed, as previously described. OVA-specific endpoint Ab titers were measured by ELISA, as previously described (17), using purified OVA (grade V) as coating Ag. Specific reactivity to OVA was determined using HRP conjugates of goat anti-mouse IgG-, IgA-specific Abs (1.0 µg/ml; Southern Biotechnology Associates), and ABTS (Moss) enzyme substrate. The absorbances were measured at 415 nm on a Kinetics reader model ELx808 (Bio-Tek Instruments). Endpoint titers were expressed as the reciprocal dilution of the last sample dilution, giving an absorbance of 0.1 OD units above the OD415 of negative controls after 1 h of incubation (4, 25).

Measurement of delayed-type hypersensitivity (DTH) responses

To measure OVA-specific DTH responses in vivo (17), 10 µg of OVA were injected into the left ear pinna, and PBS alone (20 µl) was administered to the right ear pinna as a control. Ear swelling was measured 24 h later with an electronic digital caliper (World Precision Instruments). The DTH response was calculated as the increase in ear swelling after OVA injection following subtraction of swelling in the control site injected with PBS.

Isolation of CD4+ T cells and T cell ELISPOT

Lymphocytes were isolated from mesenteric lymph nodes (MLNs), head and neck LNs (HNLNs), and spleens. LNs and spleens were obtained and lymphoid cells isolated, as previously described (4, 27). Splenic mononuclear cell suspensions were subjected to lympholyte-M (Accurate Chemical and Scientific) density gradient centrifugation, and CD4+ T cells were isolated by negative selection (Dynal Mouse CD4 Negative Isolation kit; Invitrogen Life Technologies). An aliquot of 2 x 106 CD4+ T cells were cultured for 72 h (37°C, 5% CO2) with an equal number of splenic feeder cells (T cell depleted, mitomycin C treated) in the presence or absence of 1 mg/ml OVA (17) or 1 µg/ml OVA323–329 peptide. For T cell ELISPOT analysis, CD4+ T cells were added to cytokine-coated, nitrocellulose-bottom microtiter plates (Millipore; MultiScreen). For detection of IFN-{gamma}, IL-2, IL-4, IL-10, IL-13, and IL-17, the plates were coated with 5 µg/ml purified mAbs (BD Pharmingen), and the reaction was detected using 0.5 µg/ml appropriate biotinylated mAbs (BD Pharmingen). For TGF-β1 ELISPOT, an anti-TGF-β1 mAb (10 µg/ml; clone 1D11; R&D Systems) was used for coating, and a biotinylated chicken anti-human TGF-β1 Ab (5.0 µg/ml; R&D Systems) was used for detection. The color reaction was developed using a HRP-conjugated goat anti-biotin Ab (Vector Laboratories) and 3-amino-9-ethylcarbazole reagent (Moss) and enumerated, as previously described (14, 27).

FACS analysis

Lymphocytes from CLNs, HNLNs, MLNs, PPs, and spleens from different immunization groups following OVA plus IFA challenge were cultured at 5 x 106 cells/ml in medium alone or in the presence of OVA (1 mg/ml). Cells were then stained for FACS analysis with Abs to cell surface molecules: FITC-anti-mouse CD4 (GK1.5; BD Pharmingen), streptavidin-PE-Cy5 (BD Pharmingen) for biotinylated chicken anti-human TGF-β1 IgY (R&D Systems), and PE-Cy5- or allophycocyanin-anti-mouse CD25 (both clones PC61; eBioscience). Intracellular staining was performed following standard protocols with 2% paraformaldehyde and 0.2% saponin to stain with PE- or allophycocyanin-anti-mouse/rat FoxP3 (clone FJK-16s; eBioscience) or PE-rat anti-mouse IL-10 (BD Pharmingen), as previously described (27). Fluorochrome-conjugated rat IgG2a (clone eBR2a), IgG2b (clone A95-1), and IgG1 (clone R3-34) were used as isotype control Abs. FACS analysis was performed on FACSCalibur (BD Biosciences). At least 50,000 events were collected for each sample.

Adoptive transfer of CD4+ T cell subsets

Adoptive transfer presented in Fig. 2A. Aliquots of 1 x 107 CD4+ T cells isolated from spleens of naive DO11.10 TCR-transgenic (Tg) mice were adoptively transferred via i.v. injection into naive BALB/c mice, which, after 24 h, were dosed nasally with sterile PBS (sPBS), 400 µg of OVA, or 80 µg of OVA-p{sigma}1 or i.m. (tibialis anterior muscle) with 400 µg of OVA. Three days later, total CLN CD4+ T cells (2 x 105) isolated by cell sorting were adoptively transferred into naive BALB/c mice, which, 24 h later, were challenged s.c. with 100 µg of OVA in IFA. CD4+ T cells were isolated from the CLNs and spleens 5 days later and subjected to an in vitro proliferation assay.

Adoptive transfer experiments are presented in Figs. 2, B and C, and 3. Naive BALB/c mice were adoptively transferred with Vybrant CM-Dil (Molecular Probes)-labeled DO11.10 Tg CD4+ T cells (1 x 107) isolated from naive OVA-Tg mice and with 6 x 105 of one of the following T cell subsets: CD25+CD4+, CD25CD4+, or total CD4+ T cells from OVA-p{sigma}1-dosed mice or with total CD4+ T cells from OVA-dosed mice. Control mice received Tg DO11.10 CD4+ T cells and PBS (positive proliferation control). All recipients were challenged 24 h later with OVA, as described above, and 4 days later, HNLNs, MLNs, and spleens were evaluated by FACS for proliferation of total and Vybrant+ CD4+ T cells.

In vitro T cell assays

Cell-sorted CD4+ T cells isolated from CLNs, HNLNs, MLNs, and spleens were cultured, as described elsewhere (27). Cells were pulsed with [3H]TdR (0.5 µCi/well), and [3H]TdR incorporation by proliferating CD4+ T cells (triplicate cultures) was measured and expressed as a stimulation index (SI) (27). To assess cytokine production by Treg cells and effector T cells, CD25+CD4+ and CD25CD4+ T cells (2 x 105) were stimulated in vitro with anti-CD3 mAb-coated wells (10 µg/ml; BD Pharmingen) and a soluble anti-CD28 mAb (5 µg/ml; BD Pharmingen) for 5 days (final volume of 300 µl in a 48-well plate). Capture ELISA was used to quantify triplicate sets of samples to measure cytokine production (27).

Cytokine secretion by DO11.10 T cells cultured for 24 or 72 h with or without OVA, OVA-p{sigma}1, OVA plus p{sigma}1, or p{sigma}1 stimulation was assessed by cytokine ELISA. Cytokine ELISA was conducted, as previously described (27), to determine the levels of IFN-{gamma}, IL-4, IL-10, and IL-17 in each sample.

Apoptosis assay

Lymphocytes isolated from spleens of naive DO11.10 mice were cultured with or without stimulation for 24 or 72 h in 37°C with 5% CO2. Cells were stimulated with one of the following per 1 ml of culture: 1 mg of OVA, OVA-p{sigma}1, p{sigma}1, 1 mg of OVA plus 1 mg of p{sigma}1, 50 µg of OVA-p{sigma}1, 50 µg of p{sigma}1, or 1 mg of OVA plus 50 µg of p{sigma}1. Percentage of apoptosis of CD4+ T cells was determined by FACS based on the costaining of CD4+ T cells with Cy-7-aminoactinomycin D (BD Pharmingen), and PE-annexin V (BD Pharmingen) according to the manufacturer’s instructions.

Statistical analysis

One-way ANOVA (p < 0.05) followed by a post-hoc Tukey test was applied to evaluate statistical differences between groups in Figs. 1F, 4, and 7A. The remaining groups were analyzed by a Student t test to evaluate statistical differences between groups or treatments in performed experiments, and p values <0.05 are indicated.


Figure 1
View larger version (16K):
[in this window]
[in a new window]

 
FIGURE 1. Nasal administration of OVA-p{varsigma}1 suppresses OVA-specific immune responses. A, Schematic representation of OVA-p{varsigma}1 protein: tolerogen, OVA, and p{varsigma}1 (shaft and head), 6-histidine tag, and Myc-Ag tag (components are not drawn to scale). B, Western immunoblot of OVA-p{varsigma}1, p{varsigma}1, and OVA probed with mouse IgG anti-OVA mAb (left panel) or rabbit anti-p{varsigma}1 polyclonal Ab (right panel). C, Recombinant p{varsigma}1 binds to L cells. L cells were incubated with 2 µg (left panel) or 25 µg (right panel) of his/myc-tagged p{varsigma}1, followed by an addition of a biotinylated anti-p{varsigma}1 mAb and streptavidin-PE to detect p{varsigma}1 by FACS; thus, the his/myc tag on p{varsigma}1’s C terminus does not interfere with L cell binding. D–F, BALB/c mice were nasally dosed with OVA or OVA-p{varsigma}1, with or without CT. D and E, Serum, vaginal, and fecal samples collected on day 28 p.i. were analyzed for IgA and IgG OVA-specific titers by ELISA. Mean of 10 mice ± SEM is depicted. *, p < 0.001; **, p < 0.05 for OVA-p{varsigma}1- vs OVA-dosed, and OVA-p{varsigma}1 + CT- vs OVA + CT-dosed mice, calculated by Student’s t test. F, DTH reactions to OVA were measured at day 35 p.i. Mean ± SEM of six mice per group. Statistical significance between groups was calculated by one-way ANOVA followed by post-hoc Tukey test. *, p < 0.05 vs OVA + CT; OVA vs OVA-p{varsigma}1 were not significantly different. G, Anti-p{varsigma}1 Ab ELISA was performed on serum samples collected from BALB/c mice dosed nasally with OVA-p{varsigma}1 or p{varsigma}1-poly-L-lysine-DNA. Mice dosed with p{varsigma}1-PL-DNA, but not OVA-p{varsigma}1, showed the p{varsigma}1-specific IgG response. *, p < 0.001 for OVA-p{varsigma}1 vs p{varsigma}1-poly-L-lysine-DNA was calculated by Student’s t test.

 

Figure 4
View larger version (16K):
[in this window]
[in a new window]

 
FIGURE 4. OVA-p{varsigma}1-induced tolerance is mediated by IL-10-producing CD25+CD4+ T cells and supported by IL-4-producing CD25CD4+ T cells. BALB/c mice were adoptively transferred with 1 x 107 DO11.10-Tg CD4+ T cells and 24 h later were nasally dosed with 50 µg of OVA-p{varsigma}1 or OVA only. Mice were challenged s.c. on day 3 after transfer and sacrificed 4 days later. CD25+CD4+ T cells and CD25CD4+ T cells were isolated from HNLNs, MLNs, and spleens of these mice and cultured in vitro. Presence of (A and B) proinflammatory and (C–E) regulatory cytokines in cultured supernatants was measured by ELISA. CD25+CD4+ T cells from OVA-p{varsigma}1-dosed mice produced significantly more (D) IL-10, whereas the majority of (C) IL-4 was secreted by CD25CD4+ T cells. Mean ± SEM of five mice per group is shown. Statistical significance for cytokine-producing CD25 or CD25+ CD4+ T cells was calculated by one-way ANOVA followed by a post-hoc Tukey test. §, p < 0.05 for OVA-p{varsigma}1- vs PBS-dosed mice; *, p < 0.05 for OVA-p{varsigma}1- vs OVA-dosed mice.

 

Figure 7
View larger version (32K):
[in this window]
[in a new window]

 
FIGURE 7. A single nasal dose of OVA-p{varsigma}1 is sufficient to induce tolerance to OVA. A and B, C57BL/6 mice were given OVA-p{varsigma}1, OVA, or sPBS and were subsequently challenged s.c. with OVA/IFA. A, Data depict serum IgG anti-OVA Ab titers at 18 days postchallenge (28 days p.i.). Statistical significance was calculated by one-way ANOVA followed by post-hoc Tukey test. *, p < 0.05 vs mice nasally given 50 µg of OVA-p{varsigma}1; §, p < 0.05 vs mice given nasally 50 µg of OVA. B, OVA-specific DTH responses were measured at day 15 p.i. (day 5 postchallenge). A single 50-µg dose of OVA-p{varsigma}1, but not OVA alone, was sufficient for tolerance induction. *, p < 0.001 for OVA-p{varsigma}1-dosed vs control mice, calculated by Student’s t test. Data are representative of three separate experiments. C and D, BALB/c mice were nasally given 100 µg of OVA-p{varsigma}1 or OVA, with or without 25 µg of CpG. Ten days p.i., mice were challenged s.c. with OVA/IFA. Data depict (C) plasma IgG and fecal IgA anti-OVA Ab titers 18 days postchallenge (28 days p.i.), and (D) OVA-specific DTH responses at day 15 p.i. (day 5 postchallenge). Statistical significance: *, p < 0.001 for OVA-p{varsigma}1 vs OVA-dosed mice, or for OVA-p{varsigma}1 + CpG vs OVA + CpG-dosed mice, calculated by Student’s t test.

 

    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Nasal immunization with OVA-p{sigma}1 induces B and T cell unresponsiveness to OVA

Our past studies (14, 23) have shown that chemically modified p{sigma}1 can be successfully used for mucosal delivery of DNA vaccines. To further exploit p{sigma}1 as a mucosal vaccine delivery platform, OVA cDNA was genetically fused 5' to the p{sigma}1 gene so as not to disrupt the binding capacity of p{sigma}1. The resulting fusion protein was termed OVA-p{sigma}1 (Fig. 1A). This modified OVA retained its Ag integrity when detected using an anti-OVA mAb (Fig. 1B), and the p{sigma}1 portion retained its binding activity to L cells (Fig. 1C). To test its immunogenicity, OVA-p{sigma}1 was applied nasally with or without the potent mucosal adjuvant CT (Fig. 1, D–F). BALB/c mice dosed with OVA-p{sigma}1 or OVA-p{sigma}1 plus CT were unresponsive, as evident by the depressed or lack of OVA-specific IgG and IgA Abs, when compared with mice given OVA alone or OVA plus CT (Fig. 1, D and E). Even immunization with OVA alone, which is a poor mucosal immunogen, elicited greater Ag-specific IgG Ab titers than did OVA-p{sigma}1-dosed mice (Fig. 1E). To test unresponsiveness to OVA challenge, mice dosed with OVA, OVA plus CT, or OVA-p{sigma}1 and CT as mucosal adjuvant were peripherally challenged with OVA. Results showed significantly lower OVA-specific DTH responses by OVA and OVA-p{sigma}1 plus CT-dosed mice when compared with mice given OVA plus CT as mucosal adjuvant (Fig. 1F). To discern whether OVA-p{sigma}1 induces tolerance to p{sigma}1, serum samples collected from BALB/c mice nasally dosed with OVA-p{sigma}1 or with DNA complexes with p{sigma}1-poly-L-lysine were tested by Ab ELISA. Virtually, no p{sigma}1-specific IgG Ab titers were detected in mice dosed with OVA-p{sigma}1 compared with mice given DNA complexes with p{sigma}1-poly-L-lysine, which exhibited IgG titers in excess of 213 (Fig. 1G). Thus, OVA-p{sigma}1 tolerizes the host to p{sigma}1- and OVA-specific B and T cell responses, even in the presence of coadministered CT, and these results show the feasibility of using p{sigma}1 as a mucosal vaccine delivery platform for induction of mucosal tolerance, rather than immunity.

Tolerance can be adoptively transferred with OVA-specific CD4+ T cells

Using CD4+ T cells isolated from OVA-Tg DO11.10 TCR mice, we hypothesized that OVA-p{sigma}1 would induce tolerance in an OVA-specific fashion. Splenic CD4+ T cells isolated from DO11.10-Tg mice were adoptively transferred into naive BALB/c mice. Twenty-four hours after adoptive transfer, the recipient mice were dosed nasally with 400 µg of OVA to induce tolerance (28) or with only 80 µg of OVA-p{sigma}1. Control mice received an i.m. injection of 400 µg of OVA as a positive immunized control group (28) or nasal sPBS (negative control group). Because Treg cells are highly enriched in CLNs (28), CD4+ T cells were isolated from recipient CLNs and were adoptively transferred 3 days after immunization into a second group of naive recipient BALB/c mice, which, 24 h later, were challenged s.c. with OVA. Five days postperipheral challenge, the second recipient mice were evaluated for tolerance induction by an in vitro OVA-specific proliferation assay (Fig. 2A). Contrary to the i.m.-immunized group, CD4+ T cells originating from mice dosed nasally with OVA-p{sigma}1 or with a high dose of OVA failed to proliferate following in vitro stimulation with OVA (Fig. 2A). The CD4+ T cells originated from the i.m. OVA-dosed mice showed a ~5-fold increase in OVA-specific proliferation. Thus, these data show that OVA-p{sigma}1 can stimulate OVA-specific tolerance via CD4+ T cells.


Figure 2
View larger version (19K):
[in this window]
[in a new window]

 
FIGURE 2. OVA-p{varsigma}1-induced unresponsiveness is mediated by CD4+ T cells. A, CD4+ T cells isolated from CLNs and spleens of mice adoptively transferred with CLN-derived CD4+ T cells from OVA-p{varsigma}1- or OVA-dosed mice were cultured in vitro without or with 1 mg/ml of OVA for 5 days. [3H]TdR incorporation was measured and expressed as a stimulation index (SI). For CLN: §, p ≤ 0.001 vs i.m. OVA; for spleen: **, p = 0.003, ***, p = 0.006 vs i.m. OVA, calculated by Student’s t test. B and C, BALB/c mice were adoptively transferred with Vybrant-labeled DO11.10-Tg CD4+ T (responder) cells and with the designated T cell population (donor CD4+ T cells) isolated from OVA-p{varsigma}1- or OVA-dosed mice. B, In vivo suppression of proliferation of DO11.10-Tg CD4+ T cells following challenge with OVA was measured by FACS. *, p ≤ 0.001 vs mice given CD4+ T cells from OVA-dosed mice, calculated by Student’s t test. C, Lymphocytes pooled from HNLNs, MLNs, and spleens from recipient mice were stained with anti-CD4, anti-CD25, and anti-FoxP3 mAbs and analyzed by FACS. The mean percentage (±SD) of FoxP3+CD25CD4+ T cells and FoxP3+CD25+CD4+ T cells as a (left panel) proportion of total CD4+ T cells, or (right panel) DO11.10 CD4+ T cells is depicted. *, p ≤ 0.001 vs CD25+CD4+ T cells from mice given CD4+ T cells from OVA-dosed mice; §, p ≤ 0.001, **, p ≤ 0.05 vs CD25CD4+ T cells from mice given CD4+ T cells from OVA-dosed mice, calculated by Student’s t test. D and E, FACS analysis was performed on lymphocytes isolated from C57BL/6 mice (D) naive or (E) nasally dosed with OVA-p{varsigma}1 three times at weekly intervals. Depicted are percentages of unstimulated Treg cells isolated from HNLNs. Percentage of FoxP3+ Treg cells (upper filled histogram) and FoxP3+CD25CD4+ T cells (lower filled histograms) as a proportion of CD4+ T cells are plotted vs isotype control for FoxP3 (empty histogram). Results are presented as an average ± SD of five animals per tissue.

 
Dosing with OVA-p{sigma}1 induces FoxP3+ Treg cells

To define the possible Treg cells induced by tolerization with OVA-p{sigma}1, FACS analysis was performed. Mice given nasal OVA-p{sigma}1 revealed a significant induction of FoxP3+CD25+CD4+ T cells (Fig. 2E), even following a peripheral OVA challenge (Tables I and II). A more than 40% increase in FoxP3+ CD25+CD4+ T cells in HNLNs (Fig. 2E) and in MLNs (data not shown) was observed in mice given nasal OVA-p{sigma}1, when compared with naive mice (Fig. 2, D and E, upper histograms). In a similar fashion, OVA-p{sigma}1-dosed mice, but not naive mice, showed a >60% increase in FoxP3+CD25CD4+ T cells (Fig. 2, D and E, lower histograms). The effector function of Treg cells is often associated with secretion of regulatory cytokines, such as IL-10 and/or TGF-β1. Subsequent FACS analysis confirmed that increased Treg cells in OVA-p{sigma}1-dosed mice expressed significantly more IL-10, but not TGF-β1, when compared with PBS-dosed mice (Table I). These results further suggest that tolerance induced by OVA-p{sigma}1 is supported by Treg cells, which may act in an IL-10-dependent manner.


View this table:
[in this window]
[in a new window]

 
Table I. Nasal immunization with OVA-p{sigma}1 induces IL-10-secreting CD25+CD4+Treg cells

 

View this table:
[in this window]
[in a new window]

 
Table II. Nasal immunization with OVA-p{sigma}1 induces FoxP3+CD25+ and FoxP3+CD25CD4+ T cells

 
OVA-specific Treg, as well as CD25CD4+ T cells, suppress in vivo proliferation of Ag-specific effector CD4+ T cells

The combined evidence from the adoptive transfer study and from the phenotypic analysis suggests that OVA-p{sigma}1 induces Ag-specific Treg cells. To investigate the ability of OVA-p{sigma}1-induced Treg cells to inhibit proliferation of OVA-specific effector CD4+ T cells in vivo, naive BALB/c mice were adoptively transferred with CD4+, CD25+CD4+, or CD25CD4+ T cells isolated from mice given nasal OVA-p{sigma}1 or with CD4+ T cells from mice given only nasal OVA. All recipient mice simultaneously received Vybrant-labeled OVA-specific CD4+ T cells isolated from Tg DO11.10 mice. Recipient mice were s.c. challenged with OVA in IFA 24 h after adoptive transfer, and 4 days later, Tg CD4+ T cells were evaluated by flow cytometry for in vivo proliferation (Fig. 2B). Proliferation of the Tg CD4+ T cells was significantly reduced in mice receiving OVA-p{sigma}1-specific Treg cells, because only 15% of these cells underwent cell division (Fig. 2B). In contrast, adoptively transferred CD4+ T cells from OVA-immunized mice, allowed expansion of the Tg CD4+ T cells, as evidenced by >55% of them undergoing proliferation (Fig. 2B). Significant suppression of the Tg CD4+ T cell proliferation was also obtained using CD25CD4+ and total CD4+ T cells from OVA-p{sigma}1-dosed mice (p < 0.001), but to a lesser extent (20% proliferation). This study shows that OVA-p{sigma}1-derived Treg cells significantly inhibited the proliferation of Tg CD4+ T cells greater than OVA-p{sigma}1-derived CD25 (p = 0.009) or OVA-p{sigma}1-derived total CD4+ T cells (p = 0.001). Collectively, these results suggest that OVA-p{sigma}1-induced tolerance is mediated by CD25+CD4+ T cells and, interestingly, may also be contributed to in part by CD25CD4+ T cells, which inhibited the proliferation of OVA-specific effector T cells.

In an effort to define the mechanism by which OVA-p{sigma}1-derived CD4+ T cells inhibit proliferation of these Tg DO11.10 CD4+ T cells, we analyzed the phenotypes of the CD4+ T cells isolated from the OVA-challenged recipients. Mice receiving OVA-p{sigma}1-derived CD25CD4+ T cells showed significant increases in FoxP3+CD25CD4+ T cells (~40%) and elevated numbers of FoxP3+ Treg cells (~20%; Fig. 2C, left panel). In contrast, mice adoptively transferred with OVA-p{sigma}1-derived CD25+CD4+ T cells showed even greater increases in FoxP3+ Treg cells (~30%), but FoxP3+CD25CD4+ T cells in these mice were not elevated and, in fact, were equivalent with control CD4+ T cells from OVA-immunized or PBS-dosed mice (Fig. 2C, left panel). To determine whether adoptively transferred OVA- or OVA-p{sigma}1-derived CD4+ T cells induce CD4+ Treg cells among the responder DO11.10 CD4+ T cell subset, the percentages of DO11.10 FoxP3+CD25CD4+ and FoxP3+CD25+CD4+ T cells in mice given OVA- or OVA-p{sigma}1-derived CD4+ T cells were evaluated. FACS analysis revealed that before the adoptive transfer, the Tg DO11.10 CD4+ T cell population contained ~5% Treg cells and ~10% FoxP3+CD25CD4+ T cells (Fig. 2C, right panel). These FoxP3+CD25+CD4+ T cells expanded in mice given OVA-p{sigma}1-derived (both CD25+ and CD25) CD4+ T cells, although the greatest increase, by nearly 5-fold, was in mice given OVA-p{sigma}1-derived CD25+CD4+ T cells (Fig. 2C, right panel). In contrast, expansion of DO11.10 FoxP3+CD25+CD4+ T cells was not observed in mice dosed with PBS or adoptively transferred with OVA-derived CD4+ T cells. Interestingly, more than a 3-fold increase in Tg FoxP3+CD25CD4+ T cells was observed in mice cotransferred with OVA-p{sigma}1-derived CD25CD4+ T cells. By examining the expansion of Tg FoxP3+CD25CD4+ T cells in mice given OVA-p{sigma}1-derived CD25+CD4+ T cells, it was found that these FoxP3+CD25CD4+ T cells expanded to a lesser extent. No increases in FoxP3+CD25CD4+ T cells were observed in mice given OVA- or PBS-dosed recipients given Tg CD4+ T cells (Fig. 2C, right panel). This evidence suggests that OVA-p{sigma}1-induced FoxP3+CD25CD4+ T cells do contribute to OVA-p{sigma}1-mediated inhibition of effector T cell proliferation, possibly via expansion of either CD4+ T cell subset or via conversion of FoxP3+ T cells (29).

OVA-p{sigma}1-induced tolerance is mediated by increased regulatory cytokine production

To investigate the specific mechanisms of the observed tolerance, cytokine secretion by CD4+ T cells was measured. Total CD4+ T cells were isolated from recipient HNLNs and spleens given Tg CD4+ T cells and various CD4+ T cell subsets, as described in the adoptive transfer studies in Fig. 2, B and C. After in vitro restimulation with OVA323–339 peptide, the cytokine profiles of the responding OVA-specific CD4+ T cells were analyzed. Unlike controls, mice receiving OVA-p{sigma}1-derived (CD25+, CD25, and total CD4+) T cells failed to induce IL-17-secreting CD4+ T cells and showed no or reduced IFN-{gamma}-secreting CD4+ T cells in all tested lymphoid tissues (Fig. 3). Instead, these mice showed greater anti-inflammatory responses, as evidenced by significant increases in the numbers of IL-10- and IL-4-producing CD4+ T cells. Adoptive transfer of Treg cells resulted in a 15-fold enhancement in IL-10-producing CD4+ T cells, whereas recipient mice given CD25CD4+ T cells from OVA-p{sigma}1-dosed mice showed a 10-fold enhancement in IL-4-producing CD4+ T cells when compared with recipient mice given CD4+ T cells from OVA-vaccinated or PBS-dosed mice (Fig. 3).


Figure 3
View larger version (15K):
[in this window]
[in a new window]

 
FIGURE 3. OVA-p{varsigma}1-induced tolerance is dependent upon increased production of anti-inflammatory/regulatory cytokines and depression of proinflammatory cytokines. CD4+ T cells were isolated from (A) HNLNs and (B) spleens of recipient mice given the various CD4+ T cell subsets plus responding Tg CD4+ T cells in Fig. 2, B and C. To evaluate differences in cytokine production by the responder (DO11.10) CD4+ T cells influenced to become tolerogenic or immunogenic, CD4+ T cells were isolated from recipient mice and subjected to T cell ELISPOT assay after in vitro restimulation with OVA323–339 peptide. Results are depicted as cytokine-forming cells (CFC) per 106 CD4+ T cells corrected for unstimulated responses. Adoptive transfer of OVA-p{varsigma}1-specific CD25+CD4+ T cells or CD25CD4+ T cells significantly enhanced numbers of IL-10- and IL-4-producing CD4+ T cells, respectively, in recipient mice with concomitant reductions in IFN-{gamma} and IL-17 CFC responses. Adoptive transfer of OVA-stimulated CD4+ T cells showed enhanced IFN-{gamma} and IL-17 CFCs with little to no IL-4 or IL-10 CFCs. *, p < 0.001; **, p ≤ 0.05 vs mice given CD4+ T cells from OVA-dosed mice, calculated by Student’s t test.

 
To evaluate the specific cytokine profiles for CD25+ and CD25 T cell subsets from OVA-p{sigma}1-dosed mice, BALB/c mice adoptively transferred with DO11.10 Tg CD4+ T cells were given a single nasal dose of OVA-p{sigma}1, OVA, or PBS. Recipient mice were then challenged with OVA/IFA on day 3 postimmunization (p.i.) and sacrificed on day 7 p.i. Induction of tolerance was confirmed in OVA-p{sigma}1-dosed mice by the absence of an OVA-specific DTH response (data not shown). CD25+CD4+ and CD25CD4+ T cells from pooled HNLNs, MLNs, and spleens were stimulated with plate-bound anti-CD3 and soluble anti-CD28 mAbs. Analysis of cytokines produced by cultured cells revealed that the majority of IL-10 from OVA-p{sigma}1-dosed mice was derived from Treg cells (Fig. 4D), whereas almost all of the IL-4 was produced by CD25CD4+ T cells (Fig. 4C). These data further confirm that OVA-p{sigma}1-induced tolerance depends largely upon IL-10-producing Treg cells and is further supported by Th2 cells. Although TGF-β1 was secreted by both CD25+ and CD25CD4+ T cells, this cytokine was not strikingly elevated in OVA-p{sigma}1-dosed mice when compared with OVA- and PBS-dosed mice (Fig. 4E), further implying that TGF-β1 may have a lesser role for OVA-p{sigma}1-induced tolerance. Contrary to control mice, production of proinflammatory cytokines, IFN-{gamma} (Fig. 4A), and IL-17 (Fig. 4B) was significantly diminished by both Treg and CD25CD4+ T cell subsets.

IL-10 is necessary for induction of OVA-p{sigma}1-mediated tolerance

Results thus far have shown that mucosal administration of OVA-p{sigma}1 induces secretion of regulatory cytokines, IL-4, IL-10, and TGF-β1, although the most pronounced increase was observed in the production of IL-10. Because past studies have shown that IL-10 is not responsible for tolerance induction (30, 31, 32), we queried whether tolerance could be induced in IL-10–/– mice given nasal OVA-p{sigma}1. C57BL/6 mice given nasal OVA-p{sigma}1 were unresponsive to OVA, as evidenced by the low plasma IgG and mucosal IgA anti-OVA Ab titers and a lack of DTH responses, when compared with PBS-primed mice (Fig. 5, A and B). In contrast, OVA-p{sigma}1-dosed IL-10–/– mice became immune to OVA after peripheral challenge, as did PBS-primed IL-10–/– mice (Fig. 5, A and B). CD4+ T cells isolated from HNLNs, MLNs, and spleens of IL-10–/– mice dosed with OVA-p{sigma}1 showed significant increases in OVA-specific T cell proliferation when compared with the same cells obtained from tolerized C57BL/6 mice. As evidenced in OVA-p{sigma}1-dosed C57BL/6 mice, these had at least 3-fold less CD4+ T cell proliferative responses to OVA in HNLNs and spleens than their PBS-dosed littermates (Fig. 5C). Interestingly, FACS analysis of FoxP3+ Treg cells revealed no differences in Treg cell numbers between PBS- and OVA-p{sigma}1-dosed IL-10–/– mice (Fig. 5D), and, in fact, they resembled baseline levels of CD25+CD4+ T cells in these mice (Fig. 5E). In contrast, the HNLNs and spleens of OVA-p{sigma}1-dosed C57BL/6 mice contained significantly more OVA-specific Treg cells than the HNLNs and spleens of both PBS-dosed C57BL/6 mice and OVA-p{sigma}1-dosed IL-10–/– mice, the latter result suggesting that Treg cells in IL-10–/– mice were simply not induced (Fig. 5D). Additionally, almost 50% of the FoxP3+ Treg cells in HNLNs and spleens of OVA-p{sigma}1-dosed C57BL/6 mice showed intracellular expression of IL-10 (Fig. 5F), confirming the supportive role of IL-10 in OVA-p{sigma}1-induced tolerance. Upon OVA restimulation, analysis of cytokine-secreting CD4+ T cells from C57BL/6 (Fig. 6, A and C) and IL-10–/– mice (Fig. 6, B and D) was performed. As expected, OVA-p{sigma}1-dosed C57BL/6 mice showed a significant increase in CD4+ T cells secreting regulatory cytokines IL-10 and TGF-β1 in HNLNs and MLNs, and IL-4-producing cells in all tested tissues when compared with PBS-dosed mice (Fig. 6C). Numbers of CD4+ T cells producing IL-13 were not significantly different between immunized and control mice (Fig. 6C).


Figure 5
View larger version (34K):
[in this window]
[in a new window]

 
FIGURE 5. IL-10 is required for induction and maintenance of OVA-p{varsigma}1-mediated tolerance. IL-10–/– and C57BL/6 (IL-10+/+) (B6) mice were given 100 µg of OVA-p{varsigma}1 or PBS nasally on days 0, 1, and 2 and were then challenged s.c. on day 10 p.i. with OVA in IFA. A, OVA-specific ELISA was performed on serum samples collected from OVA-p{varsigma}1- and PBS-dosed C57BL/6 and IL-10–/– mice on day 17 p.i. OVA-p{varsigma}1-dosed IL-10–/– mice elicited a serum IgG anti-OVA response. B, OVA-specific DTH responses measured on day 15 p.i. OVA-p{varsigma}1-dosed IL-10–/– mice were responsive to OVA. C, CD4+ T cells isolated from HNLNs, MLNs, and spleens of OVA-p{varsigma}1- or PBS-dosed C57BL/6 (IL-10+/+) and IL-10–/– mice were measured for their proliferative responses after in vitro stimulation with OVA. CD4+ T cells from IL-10–/– mice dosed with OVA-p{varsigma}1 or PBS, and PBS-dosed C57BL/6 mice proliferated in response to OVA. Depicted values are corrected for [3H]TdR uptake by unstimulated cells. D, Percentages of FoxP3+CD25+CD4+ T cells were measured by FACS after in vitro stimulation with OVA, and depicted are values corrected for unstimulated cells. IL-10–/– mice failed to show induction of Treg cells independent of treatment. The mean of two experiments ± SEM per group is shown. *, p < 0.001, **, p < 0.05 for OVA-p{varsigma}1- vs PBS-dosed C57BL/6 or IL-10–/– mice; NS, calculated by Student’s t test. E, Depicted is the percentage of CD25+CD4+ T cells for the combined MLNs, PPs, and spleens from five naive IL-10–/– mice. Results determined by FACS show the mean ± SD. F, Percentages of FoxP3+IL-10+ Treg cells, as a proportion of CD25+CD4+ T cells, were measured by FACS. Treg cells induced in C57BL/6 mice given nasally OVA-p{varsigma}1 expressed IL-10, whereas significantly less IL-10 was expressed by PBS-dosed C57BL/6 mice. Average ± SEM of four mice is shown. *, p < 0.001 for OVA-p{varsigma}1- vs PBS-dosed C57BL/6 mice, calculated by Student’s t test.

 

Figure 6
View larger version (31K):
[in this window]
[in a new window]

 
FIGURE 6. Immunization of IL-10–/– mice with OVA-p{varsigma}1 increases IL-17- and IFN-{gamma}-producing CD4+ T cells with concomitant increases in anti-inflammatory cytokine (IL-4 and IL-13) responses when compared with similarly treated C57BL/6 mice. C57BL/6 (IL-10+/+) (B6) and IL-10–/– mice were immunized and challenged, as described in Fig. 5 legend. CD4+ T cells isolated from HNLNs, MLNs, and spleens were restimulated with OVA, and cytokine-specific T cell ELISPOT was performed. CFC/106 CD4+ T cells in C57BL/6 (A and C) and IL-10–/– (B and D) mice are depicted. For OVA-p{varsigma}1-dosed C57BL/6 mice, CD4+ T cells producing anti-inflammatory cytokines in MLNs and HNLNs were significantly elevated when compared with (C) PBS-dosed mice. The numbers of CD4+ T cells producing (A) proinflammatory cytokines were significantly reduced in OVA-p{varsigma}1-dosed mice vs PBS-dosed C57BL/6 mice. OVA-p{varsigma}1-dosed IL-10–/– mice showed significant increases when compared with PBS-dosed mice in (B and D) IL-4-, IL-13-, and IL-17-producing CD4+ T cells, but not TGF-β1-producing CD4+ T cells. IFN-{gamma}- and IL-17-producing CD4+ T cells were significantly elevated in IL-10–/– mice given OVA-p{varsigma}1 when compared with OVA-p{varsigma}1-dosed C57BL/6 mice (A and B). Depicted is the mean of two experiments ± SEM. *, p < 0.001, **, p < 0.05 for OVA-p{varsigma}1- vs PBS-dosed C57BL/6 or IL-10–/– mice, calculated by Student’s t test.

 
Production of proinflammatory cytokines, IFN-{gamma}, IL-2, and IL-17 (Fig. 6A), was significantly inhibited in all tested tissues of OVA-p{sigma}1-dosed C57BL/6 mice. IL-10–/– mice revealed that, although the IL-4 and IL-13 responses were significantly more elevated in OVA-p{sigma}1- than PBS-dosed mice (Fig. 6D), TGF-β1-secreting CD4+ T cells were significantly depressed, except in the spleen (Fig. 6D). No significant differences in numbers of IL-2-producing CD4+ T cells were observed between OVA-p{sigma}1- and PBS-dosed IL-10–/– mice. Consistent with an antagonistic relationship between IFN-{gamma} and IL-17 (33), there was a significant decrease in IFN-{gamma} and a concomitant increase in the IL-17 in OVA-p{sigma}1-dosed IL-10–/– mice when compared with PBS-dosed mice (Fig. 6B).

OVA-p{sigma}1-mediated tolerance can be induced after a single dose

Because the p{sigma}1-based approach offers the possibility of inducing tolerance while using significantly less Ag, the persistence of OVA-p{sigma}1-induced tolerance was investigated after a single dose. C57BL/6 mice were nasally given either 100 µg per dose of OVA, OVA-p{sigma}1, or sPBS for 3 consecutive days, or a single 50-µg dose of OVA-p{sigma}1 or OVA alone. Additionally, a group of C57BL/6 mice was given 0.5 mg of OVA nasally for 5 consecutive days. Ten days p.i., all mice were challenged with OVA by the s.c. route. One day before challenge, no OVA-specific serum IgG Ab responses in either immunization group were detected (data not shown). By day 18 postchallenge (day 28 p.i.), mice given OVA or PBS revealed significantly elevated OVA-specific Ab titers in both mucosal (data not shown) and systemic immune compartments, and these responses were sustained (Fig. 7A). Moreover, we were unable to induce tolerance to OVA, even in mice dosed nasally with as much as 2.5 mg of OVA alone. In contrast, virtually no OVA-specific serum-IgG Abs (Fig. 7A) nor DTH responses (Fig. 7B) were observed in OVA-challenged mice given a single or three nasal doses of OVA-p{sigma}1. These data show that mice given OVA-p{sigma}1 nasally are tolerized to OVA and that this tolerance can be induced by substantially lower doses of p{sigma}1-delivered Ag.

Although OVA-p{sigma}1 can induce tolerance to OVA, even in the presence of CT, chemically modified p{sigma}1 is found to be immunogenic. Mucosal delivery of DNA complexed to poly-L-lysine-modified p{sigma}1 results in enhanced transgene-specific immune responses (14). To determine whether there is an adjuvant effect by the plasmid cDNA that can overcome the OVA-p{sigma}1-induced tolerance, BALB/c mice were given a single nasal dose of OVA or OVA-p{sigma}1 alone, or coadministered with CpG-ODN. In contrast to mice dosed with OVA or OVA plus ODN, mice dosed with OVA-p{sigma}1 alone or OVA-p{sigma}1 plus ODN showed significantly reduced OVA-specific serum and mucosal Ab (Fig. 7C) and DTH responses (Fig. 7D). Therefore, the tolerogenic effect of this p{sigma}1-based delivery system cannot be overridden by coadministration of the immune-modulatory molecule CpG-ODN.

Mucosal administration of OVA-p{sigma}1 is necessary for induction of tolerance

We have shown here that mucosal administration of OVA-p{sigma}1 induces a low-dose tolerance to OVA. In an effort to determine whether the p{sigma}1-mediated tolerance can be induced via a nonmucosal route, mice were i.m. immunized on days 0, 7, and 14 with OVA-p{sigma}1 without or with CT and compared with mice similarly immunized with OVA (Fig. 8). On day 21 (1 wk after the last immunization), mice were evaluated for serum IgG anti-OVA Ab titers by ELISA. As expected, OVA-immunized mice responded well, but naive and OVA-p{sigma}1-immunized mice remained OVA unresponsive (Fig. 8). All mice were subsequently challenged on day 28 with OVA in IFA, and 1 wk later, serum from individual mice was collected and measured for IgG anti-OVA titers. Even though mice dosed with OVA-p{sigma}1 plus CT (Fig. 8B) showed reduced Ab titers relative to OVA plus CT-dosed mice, these anti-OVA Ab titers were greater than those obtained in the OVA-challenged, naive mice (Fig. 8A). Thus, these results show that induction of the optimal tolerance to OVA via the use of p{sigma}1 requires mucosal, not parenteral, administration of OVA-p{sigma}1 (Fig. 8).


Figure 8
View larger version (13K):
[in this window]
[in a new window]

 
FIGURE 8. Parenteral immunization with OVA-p{varsigma}1 induces an anti-OVA Ab response following OVA challenge. C57BL/6 mice were i.m. immunized with (A) PBS, 50 µg of OVA, or OVA-p{varsigma}1, or (B) with 50 µg of OVA or OVA-p{varsigma}1 + 1 µg of CT, on days 0, 7, and 14. On day 21, sera were collected and analyzed for the presence of anti-OVA IgG Abs by ELISA ({square}), and showed unresponsiveness by PBS-, OVA-p{varsigma}1-, and OVA-p{varsigma}1 + CT-dosed mice. On day 28, mice were s.c. challenged with OVA in IFA. Sera collected from mice 1 wk postchallenge (day 35) revealed the presence of IgG anti-OVA Abs ({blacksquare}) in all tested groups, although the anti-OVA response was higher in mice dosed with OVA + CT compared with OVA-p{varsigma}1 + CT-dosed mice. *, p < 0.001 for OVA vs OVA-p{varsigma}1 and OVA + CT vs OVA-p{varsigma}1 + CT-dosed mice, calculated by Student’s t test.

 
OVA-p{sigma}1 induces apoptosis of OVA-Tg CD4+ T cells in vitro

Mucosal delivery of OVA-p{sigma}1 triggers the Treg cell response and secretion of anti-inflammatory cytokines. In contrast, parenteral administration of OVA-p{sigma}1 induces anti-OVA Ab response after s.c. challenge with OVA. To evaluate whether p{sigma}1 has a direct impact on CD4+ T cell populations, or whether the induction of tolerance relies solely on p{sigma}1 interaction with the mucosal epithelium, an in vitro study was performed. Lymphocytes isolated from naive DO11.10-Tg mice were cultured with a high (1 mg/ml) or low dose (0.05 mg/ml) of OVA-p{sigma}1 or p{sigma}1 and compared with in vitro cultures stimulated with OVA or OVA plus p{sigma}1. After 24 or 72 h, cells and culture supernatants were harvested and evaluated for CD4+ T cell apoptosis by FACS, and cytokine production by ELISA, respectively. Only ~13% of Tg CD4+ T cells underwent apoptosis in response to in vitro stimulation with OVA for up to 72 h. In contrast, stimulation with p{sigma}1, OVA-p{sigma}1, or OVA plus p{sigma}1 induced much greater apoptosis of Tg DO11.10 CD4+ T cells after 24 and 72 h (Table III), and the extent of this apoptosis was time and dose dependent. Less than 31% of these cells died after 24 h of culture with a low-dose (0.05 mg/ml) stimulation, whereas 1 mg/ml OVA-p{sigma}1, p{sigma}1 or OVA plus p{sigma}1 doubled the number of apoptotic cells at this time point (Table III). After 72 h, low-dose p{sigma}1 exposure resulted in ~54–62% of Tg CD4+ T cells undergoing apoptosis unlike high-dose treatment that resulted in ~80% apoptosis (Table III). Concomitant cytokine analysis of cultured supernatants revealed increased production of IL-4 and IL-10 by the cells stimulated for 24 h with 1 mg/ml OVA-p{sigma}1 or 72 h with 0.05 mg/ml OVA-p{sigma}1 (Table IV). Consistently, these OVA-p{sigma}1-stimulated cells showed significant reduction in inflammatory cytokines IFN-{gamma} and IL-17 at both time points, when compared with OVA-stimulated cells. Cells cultured with a high dose of OVA-p{sigma}1 for 72 h failed to produce any cytokines, presumably due to apoptosis of 80% of these cells (Table III). Interestingly, cells incubated with unconjugated p{sigma}1 and OVA mimicked the inflammatory response of OVA-stimulated cells, showing elevated IL-17 and IFN-{gamma} secretion after 24 h, and even after 72 h, the production of IL-10 and IL-4 by these cells was significantly reduced in relation to OVA-stimulated cells (Table IV). These results offer an alternative mechanism in which p{sigma}1 may induce apoptosis of OVA-responsive CD4+ T cells if intact p{sigma}1 survives delivery beyond the initial cell binding to the mucosal epithelium or M cells.


View this table:
[in this window]
[in a new window]

 
Table III. Apoptosis of Tg DO11.10 CD4+ T cells

 

View this table:
[in this window]
[in a new window]

 
Table IV. Cytokine production by in vitro cultured DO11.10 lymphocytesa

 
In summary, these studies show that OVA-p{sigma}1 can readily accomplish tolerance with a single dose and stimulate the production of FoxP3+ Treg cells producing IL-10, and tolerance induction is IL-10 dependent.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
We previously showed that the reovirus adhesin, p{sigma}1, can enhance the efficacy of mucosal DNA vaccination (14). In this work, we investigated whether a genetic fusion between p{sigma}1 and a model Ag (OVA) would have the same effect. Unlike the previous findings, it was learned that when p{sigma}1 was fused to a protein Ag, tolerance was induced. In fact, tolerance could be accomplished even with a single dose of OVA-p{sigma}1 delivered mucosally. In contrast, parenteral delivery of OVA-p{sigma}1 failed to induce tolerance to OVA. This p{sigma}1-based mucosal tolerance even resisted cotreatment with potent mucosal adjuvants (CT and CpG-ODN), and tolerance was not broken after peripheral challenge with OVA. In contrast to OVA-p{sigma}1, nasal administration of OVA alone, which is known to be a poor mucosal immunogen (34), elicited greater Ag-specific Ab responses than did OVA-p{sigma}1. Moreover, the mechanism for this p{sigma}1-induced tolerance was CD4+ T cell dependent and could be adoptively transferred into naive mice. Adoptive transfer of CLN-derived CD4+ T cells from mice tolerized with OVA-p{sigma}1 significantly inhibited OVA-specific proliferation of CD4+ T cells in vitro. In subsequent analysis, it was revealed that tolerization via OVA-p{sigma}1 induced significant increases in FoxP3+ CD25+CD4+ T cells, as well as an elevation in FoxP3+CD25CD4+ T cells. Adoptive transfer of OVA-p{sigma}1-primed CD25+CD4+ or CD25CD4+ T cells significantly inhibited Ag-specific proliferation of OVA-Tg CD4+ T cells in vivo. This suppression was due to increased production of IL-10 by OVA-p{sigma}1-induced Treg cells, as evidenced by cytokine and FACS analyses, as well as by the lack of OVA-specific tolerance in OVA-p{sigma}1-dosed IL-10–/– mice. Additionally, it was learned from the in vitro studies that OVA-p{sigma}1 induces apoptosis of OVA-responsive CD4+ T cells in a time- and a dose-dependent manner, offering an additional potential mechanism for the action of p{sigma}1 if it can survive delivery beyond the initial cell binding to the mucosal epithelium or M cells.

Induction of peripheral tolerance to a number of mucosally delivered Ags has been demonstrated previously using both high- and low-dose tolerization regimens (2, 7, 17, 28, 35); however, we propose that fusion of p{sigma}1 to a protein Ag can significantly improve both mucosal and systemic unresponsiveness to this Ag. Previously, we have shown that chemically modified p{sigma}1 with poly-L-lysine significantly enhances immunity to delivered DNA (14), and because of this modification, Abs to p{sigma}1 are induced, but not to the unmodified p{sigma}1. Thus, genetic fusion of an Ag to p{sigma}1 is instrumental to stimulate tolerance. When OVA-p{sigma}1 was coadministered with potent mucosal adjuvants, CT or CpG-ODN, the results provided further evidence that immunity to OVA was impaired. This finding was surprising because it is well-established that CT given mucosally always induces Ag-specific Abs (36). Although the mechanism by which OVA-p{sigma}1-induced tolerance overrides the immunostimulatory effects of CT is unclear, it is plausible that OVA-p{sigma}1 resists cotreatment with CT due to the p{sigma}1-adhesive properties which, in turn, may act on different receptors than CT-B. Nonetheless, p{sigma}1-induced tolerance to OVA remained effective. Another mucosal immune modulator, the unmethylated CG dinucleotides CpG-containing motifs (CpG-ODN), was also shown to enhance immunity to OVA after oral administration (26). Here, it was shown that nasal coadministration of OVA-p{sigma}1 plus CpG-ODN also resulted in tolerance. In contrast to mice given OVA plus CpG-ODN, OVA-p{sigma}1 plus CpG-ODN-dosed mice lacked OVA-specific DTH responses and showed limited OVA-specific systemic and mucosal Ab titers, suggesting that the presence of a plasmid cDNA does not affect tolerogenic properties of genetically modified p{sigma}1.

Despite the reported feasibility to induce low-dose nasal tolerance with OVA (28, 37), a sustainable tolerance by a variety of nasal OVA doses (0.05–2.5 mg) could not be induced, but a single oral 25-mg dose of OVA was found effective. In contrast, as little as a single 50-µg nasal dose of OVA-p{sigma}1 was sufficient to induce OVA-specific tolerance that was long-lasting and resisted peripheral challenge with OVA in IFA, showing that OVA-p{sigma}1 is at least a 1000-fold more efficient on a molar basis.

Previous studies have shown that the CT-B subunit could be adapted for mucosal tolerance induction (38, 39, 40, 41). In those reports, efficiency of Ag-specific tolerance was improved by its conjugation to CT-B, as evidenced by reduced Ag-specific Ab and DTH responses following mucosal delivery. Many of these studies depended upon chemically coupling the tolerogen, which produces a heterogeneous population of carrier conjugates and may limit only a fraction of these to bind the intended cell surface receptor (42). Additionally, CT-B is also commonly used as a mucosal adjuvant (43, 44) because it lacks the toxic moieties associated with native CT (45). To circumvent these potential barriers for using CT-B to induce tolerance, a genetic fusion between CT-B and proteolipid protein immunodominant peptide was done to ameliorate the clinical manifestations of experimental autoimmune encephalomyelitis (42). Although multiple doses were required, nasal administration of this CT-B-proteolipid protein peptide fusion protein was effective for inducing tolerance.

Treg cells consist of a phenotypically diverse group bearing a variety of cell surface receptors, but they commonly share their ability to suppress T cell function (Refs. 46, 47, 48 ; Immunological Aging Research Group Tokyo Metropolitan Institute of Gerontology, www.tmig.or.jp/topic/topic_01.html). Induction and maintenance of low-dose mucosal tolerance has been associated with activation of Treg cells acting in an Ag-specific fashion (6, 7, 49, 50, 51). Evidence provided in this study shows that OVA-p{sigma}1-induced tolerance is mediated by Ag-specific CD4+ T cells, because adoptive transfer of these OVA-p{sigma}1-primed CD4+ T cells conferred unresponsiveness in naive recipients to in vivo peripheral OVA challenge and inhibited OVA-specific CD4+ T cell proliferation. Studies have also found that low-dose mucosal tolerance is mediated by Treg cells that express the FoxP3 transcription factor (5, 47, 52, 53, 54). Consistent with these findings, nasal administration of OVA-p{sigma}1 significantly increased the numbers of Treg cells, in which >97% were FoxP3+. Along these lines, expression of FoxP3 was also induced in CD25CD4+ T cells following tolerization with OVA-p{sigma}1, although the intensity of FoxP3 staining was ~50-fold less than that observed for the CD25+CD4+ T cells. A low-level intensity of FoxP3 and its transient expression on activated human CD25 T cells has been previously reported (55). These FoxP3-expressing CD25 T cells are not capable of inhibiting cytokine production nor proliferation, and expression of FoxP3 on these cells is not correlated with the induction of a Treg cell phenotype (55). In contrast to that study, adoptive transfer of OVA-p{sigma}1-primed CD25+ or CD25 T cells significantly inhibited in vivo proliferation of OVA-Tg CD4+ T cells. Additionally, FACS analysis of lymphocytes isolated from mice adoptively transferred with OVA-p{sigma}1-derived CD25 T cells showed significant enrichment in FoxP3+CD25CD4+ T cells. A significant increase in FoxP3 expression in DO11.10 responder CD4+ T cells (both CD25+ and CD25) was observed in mice adoptively transferred with OVA-p{sigma}1-derived CD25+ or CD25 CD4+ T cells, suggesting that OVA-p{sigma}1-derived CD4+ T cells induce FoxP3+ expression by the responder CD4+ T cells. This finding is not surprising, because tolerance induction can occur via conversion of CD25 to FoxP3+CD25+CD4+ T cells, as reported by others (29, 56), and these FoxP3-expressing CD25CD4+ T cells, as well as converted CD25+CD4+ T cells, are potent inhibitors of CD4+ T cell expansion in vivo (29). Thus, the OVA-p{sigma}1-induced CD25 T cells also have regulatory properties, as evident by being able to suppress proliferation of Tg CD4+ T cells.

Examination of OVA323–339-specific CD4+ T cell cytokine production in recipient mice adoptively transferred with either total CD25 or CD25+ CD4+ T cells from OVA-p{sigma}1-primed mice revealed greatly reduced numbers of CD4+ T cells secreting the proinflammatory cytokines, IFN-{gamma} and IL-17, and instead produced IL-4 and IL-10. These primarily segregated with IL-4 coming from recipients given OVA-p{sigma}1-primed CD25CD4+ T cells and with IL-10 from recipients given OVA-p{sigma}1-primed Treg cells. The increased production of IL-4 may play a beneficial role in OVA-p{sigma}1-mediated tolerance, perhaps, via the induction of a Th2-type immune bias, which was previously shown to support mucosal tolerance (57, 58). Additionally, IL-4 can also facilitate induction of Treg cells from naive, peripheral CD25CD4+ T cells, as recently demonstrated in vitro by others (57). The role for IL-10 in maintenance of tolerance is well-established (30, 31, 32), even though its role in the induction of both mucosal and peripheral unresponsiveness remains controversial (59, 60, 61). One report has shown that the early production of IL-10 by CD4+ T cells is important for induction of high-dose oral tolerance (59). Here, we demonstrated that IL-10 is also necessary for induction of a low-dose nasal tolerance mediated by p{sigma}1, because OVA-p{sigma}1-mediated tolerance could not be established in IL-10–/– mice. IL-10–/– mice given OVA-p{sigma}1 nasally developed elevated serum IgG anti-OVA Ab and DTH responses. In contrast to C57BL/6 mice, immunization of IL-10–/– mice with OVA-p{sigma}1 failed to induce Ag-specific Treg cells and failed to inhibit Ag-specific proliferation of CD4+ T cells. Therefore, we conclude that IL-10 is essential for induction and maintenance of p{sigma}1-induced tolerance, and IL-10-producing Treg cells, as well as possibly CD25CD4+ T cells, mediate the observed p{sigma}1-induced tolerance.

The role of TGF-β1 appears to be less essential for OVA-p{sigma}1-induced tolerance. TGF-β1 was only modestly induced in OVA-p{sigma}1-tolerized BALB/c mice; however, TGF-β1 was induced in OVA-p{sigma}1-tolerized C57BL/6 mice and greatly reduced in OVA-p{sigma}1-dosed IL-10–/– mice. The PBS-dosed, OVA-challenged IL-10–/– mice also showed elevated numbers of TGF-β1-producing CD4+ T cells. This suggests that TGF-β1 may play a supportive role in OVA-p{sigma}1-induced tolerance, and secretion of TGF-β1 in OVA-p{sigma}1-tolerized mice depends upon the presence of IL-10, as previously suggested (62). Alternatively, the production of TGF-β1 may contribute to the conversion of CD25CD4+ to CD25+CD4+ T cells in tolerized mice, as implicated by recent studies demonstrating that TGF-β1 induces conversion of naive peripheral CD25CD4+ T cells into Treg cells by enhancing FoxP3 expression (29, 35, 56). Further evidence for the supportive role of TGF-β1 in OVA-p{sigma}1-mediated tolerance is suggested by the depressed levels of TGF-β1+ CD4+ T cells in the OVA-p{sigma}1-dosed IL-10–/– mice.

We have demonstrated, here and elsewhere (14, 23), that reovirus adhesin, p{sigma}1, can be engineered to induce either immunity or tolerance, although the exact mechanism of p{sigma}1-mediated modulation of an immune response remains undefined. P{sigma}1, aside from binding M cells in murine NALT (14), interacts with a variety of rodent and human cell types, including murine L929 (L) cells, RFL-6 cells, and Caco-2 cells (23). Additionally, p{sigma}1 binds to mammalian erythrocytes (63), as well as to intestinal epithelial cells (64). It is known that p{sigma}1 has two distinct binding domains (64, 65). One domain, located in p{sigma}1’s head structure, has been shown to interact with cells expressing the junctional adhesion molecule 1, whereas a second binding domain in p{sigma}1’s tail is thought to be responsible for binding to ubiquitously expressed sialic acid (64). Interaction of p{sigma}1 with host cells may be junctional adhesion molecule 1-mediated, because some of them, including primary human DCs and epithelial cells, express this molecule (64). A possible mechanism for p{sigma}1-induced modulation of an immune response could be a well-described ability of p{sigma}1 to induce apoptosis (65, 66). Interestingly, the efficiency of p{sigma}1-mediated apoptosis has been linked to the presence of sialic acid-binding domain, because p{sigma}1 mutants, unable to bind sialic acid, are insufficient inducers of apoptosis (65). Given these findings, we showed here that OVA-p{sigma}1 and p{sigma}1 trigger apoptosis of OVA-Tg CD4+ T cells in vitro. However, in contrast to p{sigma}1 alone, or unconjugated p{sigma}1 plus OVA, only OVA-p{sigma}1 was capable of stimulating these cells to produce increased levels of regulatory cytokines. The means by which p{sigma}1 induces tolerance are still being investigated, and our results suggested that more than one mechanism may be associated with this process. Nonetheless, mucosal delivery of OVA-p{sigma}1 is obviously crucial for the induction of OVA-specific unresponsiveness. It is known that stimulation of mucosal tolerance is dose dependent, resulting from active suppression, induction of anergy, or clonal deletion of effector cells (2, 5). Results presented here suggest that a low dose of OVA-p{sigma}1 delivered mucosally induces active suppression of anti-OVA immune responses by regulatory CD4+ T cells. Although the in vitro studies suggested possible clonal deletion because of the accompanied p{sigma}1-induced apoptosis of OVA-specific effector CD4+ T cells, it remains to be determined whether such events occur in vivo following mucosal delivery.

In summary, we showed that p{sigma}1-mediated tolerance to OVA can be established with a minimal amount of tolerogen when genetically fused to p{sigma}1 and when applied mucosally. In some instances, a single nasal administration using ~1000-fold less OVA was sufficient to induce tolerance to OVA. Tolerance induced by OVA-p{sigma}1 resisted cotreatment with CT, as well as peripheral challenge with OVA and IFA. Although IL-4 and TGF-β1 seemed to have supportive roles, p{sigma}1-delivered tolerance relied largely on activation of specific FoxP3+ Treg cells that acted in an IL-10-dependent manner. The induced tolerance was IL-10 dependent because IL-10–/– mice were unable to undergo tolerance by OVA-p{sigma}1 presumably via the failure to produce Treg cells. The impact by the OVA-p{sigma}1-induced Treg cells was enhanced by regulatory CD25CD4+ T cells because a subset of these was FoxP3+ and produced predominantly IL-4 in addition to IL-10. These CD25CD4+ T cells could also inhibit the proliferation of OVA-Tg CD4+ T cells. TGF-β1 appeared to have a supportive role in tolerance induction by OVA-p{sigma}1. Depression of TGF-β1-producing CD4+ T cells in OVA-p{sigma}1-dosed IL-10–/– mice was observed suggesting that the production of this cytokine may be triggered by IL-10. These collective data show that IL-10 is pivotal in OVA-p{sigma}1-induced tolerance. This finding is relevant because of the low dose of Ag required for tolerance induction and its potential applicability to treat or prevent a variety of autoimmune diseases and allergies. The opportunity to deliver p{sigma}1-based tolerogens via the nasal route offers a safer, easier, and more cost-effective alternative for tolerization.


    Acknowledgments
 
We thank Dr. Arnold Stein (Purdue University) for kindly providing the OVA cDNA, Sue Brumfield for her assistance at MSU’s fermentation facility, and Nancy Kommers for her assistance in preparing this manuscript.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by Public Health Service Grants AI-56286, DE-13812, DE-12242, AI-18958, and AG-25873, and in part, by the Montana Agricultural Station and U.S. Department of Agriculture Formula Funds. The Veterinary Molecular Biology flow cytometry facility was, in part, supported by National Institutes of Health/National Center for Research Resources, Centers of Biomedical Excellence P20 RR-020185, and an equipment grant from the M. J. Murdock Charitable Trust. Back

2 Address correspondence and reprint requests to Dr. David W. Pascual, Veterinary Molecular Biology, Montana State University, P.O. Box 173610, Bozeman, MT 59717-3610. E-mail address: dpascual{at}montana.edu Back

3 Abbreviations used in this paper: Treg, T regulatory; FoxP3, forkhead box P3; PP, Peyer’s patch; LN, lymph node; CLN, cervical LN; p{sigma}1, protein {sigma}1; CT, cholera toxin; ODN, oligodeoxynucleotide; DTH, delayed-type hypersensitivity; MLN, mesenteric LN; HNLN, head and neck LN; NALT, nasopharyngeal-associated lymphoid tissue; M cell, microfold cell; Tg, transgenic; sPBS, sterile PBS; p.i., postimmunization. Back

Received for publication July 27, 2007. Accepted for publication January 21, 2008.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Mowat, A. M.. 2003. Anatomical basis of tolerance and immunity to intestinal antigens. Nat. Rev. Immunol. 3: 331-341. [Medline]
  2. Weiner, H. L.. 2000. Oral tolerance, an active immunologic process mediated by multiple mechanisms. J. Clin. Invest. 106: 935-937. [Medline]
  3. Xiao, B.-G., H. Link. 1997. Mucosal tolerance: a two-edged sword to prevent and treat autoimmune diseases. Clin. Immunol. Immunopathol. 85: 119-128. [Medline]
  4. Jun, S., W. Gilmore, G. Callis, A. Rynda, A. Haddad, D. W. Pascual. 2005. A live diarrheal vaccine imprints a Th2 cell bias and acts as an anti-inflammatory vaccine. J. Immunol. 175: 6733-6740. [Abstract/Free Full Text]
  5. Faria, A. M., H. L. Weiner. 1999. Oral tolerance: mechanisms and therapeutic applications. Adv. Immunol. 73: 153-264. [Medline]
  6. Fujihashi, K., H. Kato, F. W. van Ginkel, T. Koga, P. N. Boyaka, R. J. Jackson, R. Kato, Y. Hagiwara, Y. Etani, I. Goma, et al 2001. A revisit of mucosal IgA immunity and oral tolerance. Acta Odontol. Scand. 59: 301-308. [Medline]
  7. Weiner, H. L.. 1997. Oral tolerance: immune mechanisms and treatment of autoimmune diseases. Immunol. Today 18: 335-343. [Medline]
  8. Kraus, T. A., J. Brimnes, C. Muong, J. H. Liu, T. M. Moran, K. A. Tappenden, P. Boros, L. Mayer. 2005. Induction of mucosal tolerance in Peyer’s patch-deficient, ligated small bowel loops. J. Clin. Invest. 115: 2234-2243. [Medline]
  9. Reiter, R., K. Pfeffer. 2002. Impaired germinal center formation and humoral immune response in the absence of CD28 and interleukin-4. Immunology 106: 222-228. [Medline]
  10. Faria, A. M., R. Maron, S. M. Ficker, A. J. Slavin, T. Spahn, H. L. Weiner. 2003. Oral tolerance induced by continuous feeding: enhanced up-regulation of transforming growth factor-β/interleukin-10 and suppression of experimental autoimmune encephalomyelitis. J. Autoimmun. 20: 135-145. [Medline]
  11. Fujihashi, K., T. Dohi, P. D. Rennert, M. Yamamoto, T. Koga, H. Kiyono, J. R. McGhee. 2001. Peyer’s patches are required for oral tolerance to proteins. Proc. Natl. Acad. Sci. USA 98: 3310-3315. [Abstract/Free Full Text]
  12. Rennert, P. D., J. L. Browining, P. S. Hochman. 1997. Selective disruption of lymphotoxin ligands reveals a novel set of mucosal lymph nodes and unique effects on lymph node cellular organization. Int. Immunol. 9: 1627-1639. [Abstract/Free Full Text]
  13. Kiyono, H., S. Fukuyama. 2004. NALT- versus Peyer’s-patch-mediated mucosal immunity. Nat. Rev. Immunol. 4: 699-710. [Medline]
  14. Wu, Y., X. Wang, K. L. Csencsits, A. Haddad, N. Walters, D. W. Pascual. 2001. M cell-targeted DNA vaccination. Proc. Natl. Acad. Sci. USA 98: 9318-9323. [Abstract/Free Full Text]
  15. Fleeton, M., N. Contractor, F. Leon, J. D. Wetzel, T. S. Dermody, B. L. Kelsall. 2004. Peyer’s patch dendritic cells process viral antigen from apoptotic epithelial cells in the intestine of reovirus-infected mice. J. Exp. Med. 200: 235-245. [Abstract/Free Full Text]
  16. Fleeton, M., N. Contractor, F. Leon, J. He, D. Wetzel, T. Dermody, A. Iwasaki, B. Kelsall. 2004. Involvement of dendritic cell subsets in the induction of oral tolerance and immunity. Ann. NY Acad. Sci. 1029: 60-65. [Medline]
  17. Kato, H., K. Fujihashi, R. Kato, Y. Yuki, J. R. McGhee. 2001. Oral tolerance revisited: prior oral tolerization abrogates cholera toxin-induced mucosal IgA responses. J. Immunol. 166: 3114-3121. [Abstract/Free Full Text]
  18. Wolf, J. L., R. S. Kauffman, R. Finberg, R. Dambrauskas, B. N. Fields, J. S. Trier. 1983. Determinants of reovirus interaction with the intestinal M cells and absorptive cells of murine intestine. Gastroenterology 85: 291-300. [Medline]
  19. Mah, D. C. W., G. Leone, J. M. Jankowski, P. W. K. Lee. 1990. The N-terminal quarter of reovirus cell attachment protein {sigma}1 possesses intrinsic virion-anchoring function. Virology 179: 95-103. [Medline]
  20. Turner, D. L., R. Duncan, P. W. Lee. 1992. Site-directed mutagenesis of the C-terminal portion of reovirus protein {sigma}1: evidence for a conformation-dependent receptor binding domain. Virology 186: 219-227. [Medline]
  21. Barton, E. S., J. D. Chappell, J. L. Connolly, J. C. Forrest, T. S. Dermody. 2001. Reovirus receptors and apoptosis. Virology 290: 173-180. [Medline]
  22. Kato, T., R. L. Owen. 2005. Structure and function of intestinal mucosal epithelium. J. Mestecky, and M. E. Lamm, and W. Strober, and J. Bienenstock, and J. R. McGhee, and L. Mayer, eds. Mucosal Immunology 131-151. Elsevier-Academic Press, San Diego. Ch. 8..
  23. Wu, Y., M. J. Boysun, K. L. Csencsits, D. W. Pascual. 2000. Gene transfer facilitated by a cellular targeting molecule, reovirus protein sigma1. Gene Ther. 7: 61-69. [Medline]
  24. Wang, X., D. M. Hone, A. Haddad, M. T. Shata, D. W. Pascual. 2003. M cell DNA vaccination for CTL immunity to HIV. J. Immunol. 171: 4717-4725. [Abstract/Free Full Text]
  25. Csencsits, K. L., N. Walters, D. W. Pascual. 2001. Cutting edge: dichotomy of homing receptor dependence by mucosal effector B cells: {alpha}E versus L-selectin. J. Immunol. 167: 2441-2445. [Abstract/Free Full Text]
  26. Alignani, D., B. Maletti, M. Liskovsky, A. Rópolo, G. Morón, M. C. Pistoresi-Palencia. 2005. Orally administered OVA/CpG-ODN induces specific mucosal and systemic immune response in young and aged mice. J. Leukocyte Biol. 77: 898-905. [Abstract/Free Full Text]
  27. Ochoa-Repáraz, J., C. Riccardi, A. Rynda, S. Jun, G. Callis, D. W. Pascual. 2007. Regulatory T cell vaccination without autoantigen protects against experimental autoimmune encephalomyelitis. J. Immunol. 178: 1791-1799. [Abstract/Free Full Text]
  28. Unger, W. W., F. Hauet-Broere, W. Jansen, L. A. van Berkel, G. Kraal, J. N. Samsom. 2003. Early events in peripheral regulatory T cell induction via the nasal mucosa. J. Immunol. 171: 4592-4603. [Abstract/Free Full Text]
  29. Chen, W., W. Jin, N. Hardegen, K. J. Lei, L. Li, N. Marinos, G. McGrady, S. M. Wahl. 2003. Conversion of peripheral CD4+CD25 naive T cells into CD4+CD25+ regulatory T cells by TGF-β induction of transcription factor FoxP3. J. Exp. Med. 198: 1875-1886. [Abstract/Free Full Text]
  30. Gonnella, P. A., H. P. Waldner, D. Kodali, H. L. Weiner. 2004. Induction of low-dose oral tolerance in IL-10 deficient mice with experimental autoimmune encephalomyelitis. J. Autoimmun. 3: 193-200.
  31. Ghoreishi, M., J. P. Dutz. 2006. Tolerance induction by transcutaneous immunization through ultraviolet-irradiated skin is transferable through CD4+CD25+ T regulatory cells and is dependent on host-derived IL-10. J. Immunol. 176: 2635-2644. [Abstract/Free Full Text]
  32. Seewaldt, S., J. Alferink, I. Förster. 2002. Interleukin-10 is crucial for maintenance but not for developmental induction of peripheral T cell tolerance. Eur. J. Immunol. 32: 3607-3616. [Medline]
  33. Veldhoen, M., B. Stockinger. 2006. TGFβ1, a "Jack of all trades": the link with pro-inflammatory IL-17-producing T cells. Trends Immunol. 27: 358-361. [Medline]
  34. Van der Heijden, P. J., A. T. J. Bianchi, M. Dol, J. W. Pals, W. Stok, B. A. Bokhout. 1991. Manipulation of intestinal immune response against ovalbumin by cholera toxin and its B subunit in mice. Immunology 72: 89-93. [Medline]
  35. Huber, S., C. Schramm, H. A. Lehr, A. Mann, S. Schmitt, C. Becker, M. Protschka, P. R. Galle, M. F. Neurath, M. Blessing. 2004. Cutting edge: TGF-β signaling is required for the in vivo expansion and immunosuppressive capacity of regulatory CD4+CD25+ T cells. J. Immunol. 173: 6526-6531. [Abstract/Free Full Text]
  36. Lycke, N.. 2005. From toxin to adjuvant: basic mechanisms for the control of mucosal IgA immunity and tolerance. Immunol. Lett. 97: 193-198. [Medline]
  37. Samson, J. N., L. A. van Berkel, J. M. van Helvoort, W. W. Unger, W. Jansen, T. Thepen, R. E. Mebius, S. S. Verbeek, G. Kraal. 2005. Fc{gamma}RIIB regulates nasal and oral tolerance: a role for dendritic cells. J. Immunol. 174: 5279-5287. [Abstract/Free Full Text]
  38. Sun, J.-B., J. Holmgren, C. Czerkinsky. 1994. Cholera toxin B subunit: an efficient transmucosal carrier-delivery system for induction of peripheral immunological tolerance. Proc. Natl. Acad. Sci. USA 91: 10795-10799. [Abstract/Free Full Text]
  39. Sun, J.-B., C. Rask, T. Olsson, J. Holmgren, C. Czerkinsky. 1996. Treatment of experimental autoimmune encephalomyelitis by feeding myelin basic protein conjugated to cholera toxin B subunit. Proc. Natl. Acad. Sci. USA 93: 7196-7201. [Abstract/Free Full Text]
  40. Sun, J.-B., S. Raghavan, Å. Sjöling, S. Lundin, J. Holmgren. 2006. Oral tolerance induction with antigen-conjugated to cholera toxin B subunit generates both FoxP3+ CD25+ and FoxP3CD25CD4+ regulatory T cells. J. Immunol. 177: 7634-7644. [Abstract/Free Full Text]
  41. Bergerot, I., C. Ploix, J. Petersen, V. Moulin, C. Rask, N. Fabien, M. Lindblad, A. Mayer, C. Czerkinsky, J. Holmgren, C. Thivolet. 1997. A cholera toxin-insulin conjugate as an oral vaccine against spontaneous autoimmune diabetes. Proc. Natl. Acad. Sci. USA 94: 4610-4614. [Abstract/Free Full Text]
  42. Yuki, Y., Y. Byun, M. Fujita, W. Izutani, T. Suzuki, S. Udake, K. Fujihashi, J. R. McGhee, H. Kiyono. 2001. Production of recombinant hybrid molecule of cholera toxin-B-subunit and proteolipid-protein-peptide for the treatment of experimental encephalomyelitis. Biotechnol. Bioeng. 74: 62-69. [Medline]
  43. Yokohama, Y., Y. Harabuchi. 2002. Intranasal immunization with lipoteichoic acid and cholera toxin evokes specific pharyngeal IgA, and systemic IgG responses and inhibits streptococcal adherence to pharyngeal epithelial cells in mice. Int. J. Pediatr. Otohinolaryngol. 63: 235-241.
  44. Lian, T., T. Bui, R. J. Ho. 1999. Formulation of HIV-envelope protein with lipid vesicles expressing ganglioside GM1 associated to cholera toxin B enhances mucosal immune responses. Vaccine 18: 604-611. [Medline]
  45. Lycke, N.. 2004. ADP-ribosylating bacterial enzymes for the targeted control of mucosal tolerance and immunity. Ann. NY Acad. Sci. 1029: 193-208. [Medline]
  46. Grundstrom, S., L. Cederbom, A. Sundstedt, P. Scheipers, F. Ivars. 2003. Superantigen-induced regulatory T cells display different suppressive functions in the presence or absence of natural CD4+CD25+ regulatory T cells in vivo. J. Immunol. 170: 5008-5017. [Abstract/Free Full Text]
  47. Olivares-Villagomez, D., Y. Wang, J. J. Lafaille. 1998. Regulatory CD4+ T cells expressing endogenous T cell receptor chains protect myelin basic protein-specific transgenic mice from spontaneous autoimmune encephalomyelitis. J. Exp. Med. 188: 1883-1894. [Abstract/Free Full Text]
  48. Shimizu, J., S. Yamazaki, T. Takahashi, Y. Ishida, S. Sakaguchi. 2002. Stimulation of CD4+CD25+ regulatory T cells through GITR breaks immunological self-tolerance. Nat. Immunol. 3: 135-142. [Medline]
  49. Chen, Y., V. K. Kuchroo, J. Inobe, D. A. Hafler, H. L. Weiner. 1994. Regulatory T cell clones induced by oral tolerance: suppression of autoimmune encephalomyelitis. Science 265: 1237-1240. [Abstract/Free Full Text]
  50. Mangan, P. R., L. E. Harrington, D. B. O’Quinn, W. S. Helms, D. C. Bullard, C. O. Elson, R. D. Hatton, S. M. Wahl, T. R. Schoeb, C. T. Weaver. 2006. Transforming growth factor-β induces development of the T(H)17 lineage. Nature 441: 231-234. [Medline]
  51. Miyamoto, K., C. I. Kingsley, X. Zhang, C. Jabs, L. Izikson, R. A. Sobel, H. L. Weiner, V. K. Kuchroo, A. H. Sharpe. 2005. The ICOS molecule plays a crucial role in the development of mucosal tolerance. J. Immunol. 175: 7341-7347. [Abstract/Free Full Text]
  52. Harber, M., A. Sundstedt, D. Wraith. 2000. The role of cytokines in immunological tolerance: potential for therapy. Expert Rev. Mol. Med. 2000: 1-20. [Medline]
  53. Lee, J. H., L. C. Wang, Y. T. Lin, Y. H. Yang, D. T. Lin, B. L. Chiang. 2006. Inverse correlation between CD4+ regulatory T-cell population and autoantibody levels in paediatric patients with systemic lupus erythematosus. Immunology 117: 280-286. [Medline]
  54. Lim, H. W., P. Hillsamer, A. H. Banham, C. H. Kim. 2005. Cutting edge: direct suppression of B cells by CD4+CD25+ regulatory T cells. J. Immunol. 175: 4180-4183. [Abstract/Free Full Text]
  55. Allan, S. E., S. O. Crome, N. K. Crellin, L. Passerini, T. S. Steiner, R. Bacchetta, M. G. Roncarolo, M. K. Levings. 2007. Activation-induced FoxP3 in human T effector cells does not suppress proliferation or cytokine production. Int. Immunol. 19: 345-354. [Abstract/Free Full Text]
  56. Selvaraj, R. K., T. L. Geiger. 2007. A kinetic and dynamic analysis of FoxP3 induced in T cells by TGF-β. J. Immunol. 178: 7667-7677. [Abstract/Free Full Text]
  57. Skapenko, A., J. R. Kalden, P. E. Lipsky, H. Schulze-Koops. 2005. The IL-4 receptor "-chain-binding cytokines, IL-4 and IL-13, induce forkhead box P3-expressing CD25+CD4+ regulatory T cells from CD25CD4+ precursors. J. Immunol. 175: 6107-6116. [Abstract/Free Full Text]
  58. al Sabbagh, A., A. Miller, L. M. Santos, H. L. Weiner. 1994. Antigen-driven tissue-specific suppression following oral tolerance: orally administered myelin basic protein suppresses proteolipid protein-induced experimental autoimmune encephalomyelitis in the SJL mouse. Eur. J. Immunol. 24: 2104-2109. [Medline]
  59. Cong, Y., C. Liu, C. T. Weaver, C. O. Elson. 2004. Early upregulation of T cell IL-10 production plays an important role in oral tolerance induction. Ann. NY Acad. Sci. 1029: 319-320. [Medline]
  60. Maurer, M., W. Seidel-Guyenot, M. Metz, J. Knop, K. Steinbrink. 2003. Critical role of IL-10 in the induction of low zone tolerance to contact allergens. J. Clin. Invest. 112: 432-439. [Medline]
  61. Silva, S. R., J. F. Jacysyn, M. S. Macedo, E. L. Faquim-Mauro. 2006. Immunosuppressive components of Ascaris suum down-regulate expression of co-stimmulatory molecules and function of antigen-presenting cells via an IL-10-mediated mechanism. Eur. J. Immunol. 36: 3227-3237. [Medline]
  62. Joetham, A., K. Takeda, C. Taube, N. Miyahara, S. Matsubara, T. Koya, Y. H. Rha, A. Dakahama, E. W. Gelfand. 2007. Naturally occurring lung CD4+CD25+ T cell regulation of airway allergic response depends on IL-10 induction of TGF-β. J. Immunol. 178: 1433-1442. [Abstract/Free Full Text]
  63. Dermody, T. S., M. L. Nibert, R. Bassel-Duby, B. N. Fields. 1990. A {sigma}1 region important for hemagglutination by serotype 3 reovirus strains. J. Virol. 64: 5173-5176. [Abstract/Free Full Text]
  64. Mercier, G. T., J. A. Campbell, J. D. Chappell, T. Stehle, T. S. Dermody, M. A. Barry. 2004. A chimeric adenovirus vector encoding reovirus attachment protein {sigma}1 targets cells expressing junctional adhesion molecule 1. Proc. Natl. Acad. Sci. USA 101: 6188-6193. [Abstract/Free Full Text]
  65. Connolly, J. V., E. S. Barton, T. S. Dermody. 2001. Reovirus binding to cell surface sialic acid potentiates virus-induced apoptosis. J. Virol. 75: 4029-4031. [Abstract/Free Full Text]
  66. Tyler, K. L., M. K. Squier, S. E. Rodgers, B. E. Schneider, S. M. Oberhaus, T. A. Grdina, J. J. Cohen, T. S. Dermody. 1995. Differences in the capacity of reovirus strains to induce apoptosis are determined by the viral attachment protein {sigma}1. J. Virol. 69: 6972-6979. [Abstract]



This article has been cited by other articles:


Home page
J. Immunol.Home page
I. Kochetkova, T. Trunkle, G. Callis, and D. W. Pascual
Vaccination without Autoantigen Protects against Collagen II-Induced Arthritis via Immune Deviation and Regulatory T Cells
J. Immunol., August 15, 2008; 181(4): 2741 - 2752.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rynda, A.
Right arrow Articles by Pascual, D. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rynda, A.
Right arrow Articles by Pascual, D. W.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS