The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


The Journal of Immunology, 2008, 180, 5101-5108
Copyright © 2008 by The American Association of Immunologists, Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, P. Y.
Right arrow Articles by Reeves, W. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, P. Y.
Right arrow Articles by Reeves, W. H.

A Novel Type I IFN-Producing Cell Subset in Murine Lupus1

Pui Y. Lee*, Jason S. Weinstein*, Dina C. Nacionales*, Philip O. Scumpia{dagger}, Yi Li*, Edward Butfiloski*, Nico van Rooijen§, Lyle Moldawer{dagger}, Minoru Satoh*,{ddagger} and Westley H. Reeves2,*,{ddagger}

* Division of Rheumatology & Clinical Immunology and Center for Autoimmune Disease, {dagger} Department of Surgery, and {ddagger} Department of Pathology, Immunology and Laboratory Medicine, University of Florida, Gainesville, FL 32610-0221; and § Department of Molecular Cell Biology, Free University Medical Center, Amsterdam, The Netherlands


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Excess type I IFNs (IFN-I) have been linked to the pathogenesis of systemic lupus erythematosus (SLE). Therapeutic use of IFN-I can trigger the onset of SLE and most lupus patients display up-regulation of a group of IFN-stimulated genes (ISGs). Although this "IFN signature" has been linked with disease activity, kidney involvement, and autoantibody production, the source of IFN-I production in SLE remains unclear. 2,6,10,14-Tetramethylpentadecane-induced lupus is at present the only model of SLE associated with excess IFN-I production and ISG expression. In this study, we demonstrate that tetramethylpentadecane treatment induces an accumulation of immature Ly6Chigh monocytes, which are a major source of IFN-I in this lupus model. Importantly, they were distinct from IFN-producing dendritic cells (DCs). The expression of IFN-I and ISGs was rapidly abolished by monocyte depletion whereas systemic ablation of DCs had little effect. In addition, there was a striking correlation between the numbers of Ly6Chigh monocytes and the production of lupus autoantibodies. Therefore, immature monocytes rather than DCs appear to be the primary source of IFN-I in this model of IFN-I-dependent lupus.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Systemic lupus erythematosus (SLE)3 is a chronic autoimmune disorder affecting multiple organs including the skin, joints, kidneys, lungs, heart, and the nervous system (1). Antinuclear Abs against small nuclear ribonucleoprotein (RNP) and dsDNA are pathognomonic of the disease (1). Recent evidence suggests that type I IFNs (IFN-I), a family of antiviral cytokines, are integral to the pathogenesis of SLE. More than two-thirds of SLE patients display up-regulation of a group of type I IFN-stimulated genes (ISGs) (2, 3, 4). This "IFN signature" is clinically relevant as it correlates with active disease, presence of certain autoantibodies, and an increased incidence of renal involvement (4, 5). Supporting a causal role of IFN-I, therapeutic use of recombinant IFN-{alpha} is linked to a wide array of autoimmune manifestations and there are reports of SLE following treatment (6). Although an association between elevated IFN-I levels and SLE is well established, its origin is unclear.

Experimental lupus induced by 2,6,10,14-tetramethylpentadecane (TMPD; Sigma-Aldrich) displays key immunologic and clinical features of human SLE, including the production of autoantibodies against dsDNA and small nuclear RNPs, and the development of immune complex-mediated glomerulonephritis and arthritis (7). We recently reported that TMPD-induced lupus is associated with excess IFN-I production and up-regulation of ISGs (8). This murine model is at present the only one reported to have the "IFN signature". IFN-I signaling is critically required in this model as shown by the absence of lupus autoantibodies and kidney disease in IFN-I receptor {alpha}-chain-deficient (IFNAR–/–) mice) (9). The source of the excess IFN-I, however, has not been examined. In this study, we aimed to identify and characterize the cell population responsible for increased IFN-I production in TMPD-induced lupus.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Mice

Wild-type BALB/cJ, and B6.FVB-Tg.Itgax-DTR/EGFP.57Lan/J backcrossed to a BALB/c background, referred to as CD11c-DTR (diphtheria toxin receptor) mice (10, 11), were purchased from The Jackson Laboratory and housed in a conventional facility. CD11c-DTR mice were maintained as heterozygote crosses and littermates not expressing the transgene were used as controls. 129Sv/Ev IFNAR–/– mice and wild-type controls (129Sv/Ev) were purchased from B&K Universal. Eight-week-old mice received a single i.p. injection of 0.5 ml of TMPD, mineral oil (Harris Teeter), 4% thioglycolate (BD Biosciences), squalene (Sigma-Aldrich), n-hexadecane (Sigma-Aldrich), or PBS. Peritoneal cell isolation and cecal ligation and puncture were performed as described (8, 11). These studies were approved by the Institutional Animal Care and Use Committee.

PCR analysis

Real-time PCR and conventional PCR were performed as described (8). Briefly, total RNA was extracted from 106 peritoneal cells using TRIzol reagent (Invitrogen Life Technologies) and cDNA was synthesized using Superscript II First-Strand Synthesis kit (Invitrogen Life Technologies). Real-time PCR was performed using the SYBR Green Core Reagent kit (Applied Biosystems) with an Opticon II thermocycler (MJ Research). The following amplification conditions were used: 95°C for 10 min, followed by 45 cycles of 94°C for 15 s, 60°C for 25 s, and 72°C for 25 s. After the final extension (72°C for 10 min), a melting-curve analysis was performed to ensure specificity of the products. IFN-I genes were amplified by conventional PCR using a PTC-100 programmable thermal controller (MJ Research). The amplification conditions were 95°C for 5 min, followed by 40 cycles of 94°C for 30 s, 60°C for 1 min, and 72°C for 1 min. After a final extension (72°C for 10 min), PCR products were analyzed by agarose gel electrophoresis. Primers used in this study include the following: myxoma resistance protein-1 Mx-1 (forward) GATCCGACTTCACTTCCAGATGG, (reverse) CATCTCAGTGGTAGTCAACCC; MCP-1 (forward) AGGTCCCTGTCATGCTTCTG, (reverse) GGATCATCTTGCTGGTGAAT; IP-10 (forward) CCTGCAGGATGATGGTCAAG, (reverse) GAATTCTTGCTTCGGCAGTT; consensus IFN-{alpha} (forward) ATGGCTAGRCTCTGTGCTTTCCT, (reverse) AGGGCTCTCCAGAYTTCTGCTCTG; IFN-{alpha}5 (forward) tgtgaccttcttcagactc, (reverse) CTCCTCCTTGCTCAATC; IFN-β (forward) AGCTCCAAGAAAGGACGAACAT, (reverse) ATTCTTGCTTCGGCAGTTAC; TNF-{alpha} (forward) GGCAGGTCTACTTTGGAGTCATTGC, (reverse) ACATTCGAGGCTGCTCCAGTGAATTCGG; inducible NO synthase (iNOS) (forward) ATCGACCCGTCCACAGTATG, (reverse) GATGGACCCCAAGCAAGACT; IL-12p40 (forward) GAGTGGACTGGACTCCCGA, (reverse) CAAGTTCTTGGGCGGGTCTG; β-actin (forward) CCCACACTGTGCCCATCTAC, (reverse) CGCTCGGTCAGGATCTTCAT); and 18 S RNA (forward) CGGCTACCACATCCAAGGAA, (reverse) GCTGGAATTACCGCGGCT.

Flow cytometry

All Abs were purchased from BD Biosciences with the exceptions of anti-Ly6C-FITC, anti-Ly6C-biotin, avidin-allophycocyanin (eBioscience), anti-F4/80-FITC, anti-Moma2-FITC (Serotec), and anti-CD11b-Pacific blue (Caltag Laboratories). Cell staining was performed as described (8). Propidium iodide (Invitrogen Life Technologies) staining was performed following the manufacturer’s protocol. Fifty thousand events per sample were acquired by a Cyan ADP flow cytometer (DakoCytomation) and analyzed with FCS Express 3 (De Novo Software).

Cell sorting

Peritoneal cells from TMPD-treated mice (107) were stained with anti-Ly6G-PE, washed, and incubated with magnetic bead-conjugated anti-PE (Miltenyi Biotec). Granulocytes (>99% purity) were positively selected using MS columns, whereas the negative fraction was stained with anti-CD11b-allophycocyanin, washed, and incubated with magnetic bead-conjugated anti-allophycocyanin (Miltenyi Biotec). Positive selection using MS columns yielded >85% Ly6Chigh monocytes. The negative fraction consisted of lymphocytes and dendritic cells (DCs). Cell sorting using a FACSDiva flow cytometer (BD Biosciences) yielded similar results with a higher purity of Ly6Chigh monocytes (>95%). For morphological analysis, 3 x 104 sorted cells were cytospun onto glass slides and stained using the Hema3 kit (modified Wright stain; Fisher Scientific).

Monocyte labeling and depletion

Clodronate-containing liposomes (clo-liposomes), a gift from Roche Diagnostics, and DiD (1,1'-dioctadecyl-3,3,3',3'-tetramethylindodicarbocyanine perchlorate) liposomes were produced as described (12, 13). To label Ly6C monocytes, 150 µl of DiD-liposomes were injected i.v. into TMPD-treated mice. Clo-liposomes (200 µl) were delivered i.v. 24 h before the injection of DiD-liposomes for the labeling of Ly6Chigh monocytes. Analysis was performed 24 h after labeling. To deplete peritoneal monocytes, 200 µl of clo-liposomes were injected i.p. into wild-type BALB/c mice treated with TMPD 2 wk earlier.

DC depletion

DC ablation was performed in TMPD-treated CD11c-DTR mice by i.p. injecting 4 ng/g of body weight of diphtheria toxin (Sigma-Aldrich). Mice were sacrificed for analysis 48 h after clo-liposomes or diphtheria toxin administration.

Statistical analysis

For quantitative variables, differences between groups were analyzed by the Student’s unpaired t test. Bivariate correlations were assessed using Spearman’s correlation coefficient. Data were presented as mean ± SD. All tests were two-sided, and a value for p < 0.05 was considered statistically significant. Statistical analyses were performed using GraphPad Prism 4.0 (GraphPad Software).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The "IFN signature" precedes lupus disease onset

Although the link between SLE and IFN-I is firmly established, it remains unclear whether the IFN signature precedes disease manifestations. In the TMPD model of SLE, production of lupus autoantibodies (anti-Smith Ag (-Sm), antinuclear RNP (-nRNP), and anti-dsDNA) and development of immune complex-mediated glomerulonephritis occur ~4–6 mo after peritoneal exposure to the hydrocarbon oil (7). Up-regulation of IFN-{alpha} and IFN-β, conversely, was observed in peritoneal exudate cells within 2 wk of TMPD treatment (Fig. 1A). Although consensus PCR primers can amplify most IFN-{alpha} subtypes, quantification of ISG expression allows assessment of total IFN-I proteins because all IFN-I subtypes bind to single receptor complex to activate ISG expression. Accordingly, a panel of ISGs including Mx-1, MCP-1/CCL2, and IP-10/CXCL10 were also highly up-regulated (Fig. 1B) 2 wk after TMPD treatment. In contrast, ISG expression was only modestly increased in mice treated with mineral oil, a control hydrocarbon oil that triggers chronic inflammation without features of lupus. Supporting the gene expression data, elevated levels of IFN-β and MCP-1 protein along with the inflammatory cytokines TNF-{alpha} and IL-12 were demonstrated in peritoneal lavage fluid of TMPD-treated mice (data not shown). Thus, the IFN signature induced by TMPD was established within 2 wk of treatment, long before the appearance of lupus autoantibodies and kidney pathology.


Figure 1
View larger version (30K):
[in this window]
[in a new window]

 
FIGURE 1. TMPD induces elevated expression of IFN-I and accumulation of Ly6Chigh monocytes. Comparisons of IFN-I expression (A) (conventional PCR) and ISG expression (B) (real-time PCR) in peritoneal cells after TMPD or mineral oil (MO) treatment. Data in B represent the mean of n = 4 animals and error bars indicate SD. C, Flow cytometry of peritoneal cells in wild-type 129Sv mice treated with PBS, TMPD (2 wk), mineral oil (2 wk), thioglycolate (3 days), and cecal ligation and puncture (3 days). Boxed sections indicate Ly6Chigh immature monocytes (R1), CD11b+ Ly6Cmid granulocytes (R2), and Ly6C mature monocytes/macrophages (R3) populations. Quantification (D) and morphologic analysis (E) of peritoneal cell populations. Data in D represent the mean of n = 4 animals and error bars indicate SD. *, p < 0.05 as determined by Student’s t test. F, Flow cytometry of surface makers on Ly6Chigh immature monocytes. Shaded histogram represents isotype control staining. G, Flow cytometry of peritoneal cells from wild-type 129Sv mice treated with TMPD or mineral oil for 1 day. Boxed area represents the percentage of Ly6Chigh immature monocytes.

 
TMPD induces an accumulation of Ly6Chigh monocytes

To identify the source of IFN-I production, we analyzed different cell populations in the peritoneal exudate 2 wk following TMPD treatment. More than 80% of the cells in the inflammatory exudate were CD11b+ (data not shown). Because CD11b is expressed by monocytes/macrophages, granulocytes, and peritoneal B1 cells, we used the marker Ly6C to distinguish these populations (14, 15). In untreated or PBS-treated animals, resting peritoneal cells predominantly consisted of macrophages (CD11bhigh Ly6C) and B1 cells (CD11bmid Ly6C) (Fig. 1C). As previously described (14), peritoneal macrophages expressed the F4/80 Ag, whereas B1 cells were positive for the B cell markers B220 and CD5 (data not shown). Interestingly, both resting cell types were depleted 2 wk following TMPD treatment, whereas two distinct populations emerged: CD11b+ Ly6Chigh cells (R1), consistent with the phenotype of immature monocytes (15), and CD11b+ Ly6Cmid cells (R2) characteristic of granulocytes (Fig. 1, C and D). The latter cell population (R2) also expressed the neutrophil marker Ly6G (data not shown). These populations each represented ~30% of cells in the peritoneal inflammatory infiltrate. Morphology of the monocyte and granulocyte populations was consistent with their surface marker profile (Fig. 1E). These findings were consistent in other wild-type strains (C57BL/6 and BALB/c), except that these strains showed a greater influx of granulocytes (data not shown).

Treatment with mineral oil, which does not induce the IFN signature, resulted in similar accumulation of granulocytes, but few Ly6Chigh monocytes were present (Fig. 1, C and D). Instead, mature monocytes resembling resting peritoneal macrophages were found (R3) (Fig. 1, C and D). Compared with the Ly6Chigh monocytes, these cells were larger, more vacuolated, and displayed rounded nuclei, suggestive of a more differentiated phenotype (Fig. 1E). The accumulation of Ly6Chigh monocytes was specific to TMPD treatment as this pattern was not seen in sterile peritonitis induced by thioglycolate or septic peritonitis induced by cecal ligation and puncture (Fig. 1C).

Flow cytometric analysis of Ly6Chigh monocytes from TMPD-treated animals demonstrated intense expression of the myeloid markers Mac-3 and Moma-2 (Fig. 1F). Supporting their immature phenotype, only a small fraction of Ly6Chigh monocytes expressed the macrophage marker F4/80, MHC class II (I-A), and the costimulatory molecules CD80 and CD86 (Fig. 1F). This result was in sharp contrast to mature peritoneal macrophages, which expressed these markers at high levels (data not shown). Ly6Chigh monocytes also lacked markers of DCs (CD11c and CD205), B cells (B220 and CD19), T cells (CD3), granulocytes (Ly6G), or NK cells (Pan-NK) (Fig. 1F and data not shown). The absence of B220 and CD11c expression distinguishes these cells from the previously described natural IFN-producing cells, which also express Ly6C, albeit at much lower levels compared with Ly6Chigh monocytes (16, 17). Curiously, these monocytes exhibited strong expression of Sca-1 (Ly6A/E) (Fig. 1F), a marker normally found on hematopoietic stem cells and certain T cell subsets (18).

Although the accumulation of Ly6Chigh monocytes was evident after 2 wk, these cells appeared in the peritoneal cavity as early as 1 day after TMPD treatment (Fig. 1G). However, this observation was not limited to TMPD as a similar pattern of acute peritoneal inflammation was elicited by mineral oil (Fig. 1G). But the appearance of Ly6Chigh monocytes in response to mineral oil was transient compared with TMPD. Only a small population of Ly6Chigh monocytes was found in the peritoneal cavity 2 wk after mineral oil treatment, whereas the response was maintained for several months with TMPD treatment (Fig. 1C and data not shown).

To investigate the source of the accumulating Ly6Chigh monocytes, we first performed a cell cycle analysis to determine whether these cells were proliferating in the peritoneal cavity. Propidium iodide staining revealed that virtually all Ly6Chigh monocytes in the peritoneal exudate elicited by TMPD were in G1 phase (Fig. 2A), indicating that extramedullary myelopoiesis at the site of inflammation is not a likely explanation for the monocyte accumulation.


Figure 2
View larger version (20K):
[in this window]
[in a new window]

 
FIGURE 2. TMPD induces the direct recruitment of circulating Ly6Chigh monocytes. A, Propidium iodide cell cycle analysis of peritoneal cells 2 wk after TMPD treatment. B, Flow cytometry of Ly6C expression on peripheral blood monocytes (gated on CD11b+Ly6G cells) and quantification of peripheral blood Ly6Chigh and Ly6C monocytes following TMPD treatment (n = 4 per group). C, Flow cytometry of peripheral blood and peritoneal monocytes (gated on CD11b+Ly6G cells) in TMPD-treated mice 24 h after administration of DiD-liposomes (DiD-lip). Data are representative of three independent experiments.

 
Recent studies have demonstrated that Ly6Chigh monocytes egress from the bone marrow and that expression of Ly6C diminishes as they mature in the circulation (12). We therefore examined whether TMPD treatment alters the maturation profile of peripheral blood monocytes. In untreated animals, mature circulating monocytes (Ly6C) outnumbered their immature Ly6Chigh counterparts by ~2:1 (Fig. 2B). Two weeks after TMPD treatment, the frequency of Ly6Chigh monocytes in the peripheral blood doubled, whereas the Ly6C subset remained constant (Fig. 2B).

To demonstrate the migration of Ly6Chigh monocytes into the peritoneal cavity following TMPD injection, we selectively labeled monocyte subsets in vivo. As previously described (12), i.v. injection of liposomes containing the fluorescent dye DiD labeled strictly Ly6C monocytes in the circulation (Fig. 2C, left). Consistent with the paucity of Ly6C monocytes in the response to TMPD, DiD-positive cells were not recovered from the peritoneal cavity. Using clo-liposomes first to deplete mature monocytes (12), circulating Ly6Chigh monocytes were specifically labeled by the subsequent administration of DiD-liposomes (Fig. 2C, right). After 24 h, more than one-third of Ly6Chigh monocytes in the peritoneal cavity were DiD-positive, indicating that TMPD treatment induces rapid and specific recruitment of this monocyte subset. Taken together, these data suggest that TMPD treatment results in the export of Ly6Chigh monocytes from the bone marrow into the circulation and followed by their specific recruitment and accumulation in the peritoneal cavity.

Ly6Chigh monocytes are a major source of IFN-I production

Using magnetic bead sorting, we separated peritoneal exudate cells from TMPD-treated mice into Ly6Chigh monocytes, Ly6G+ granulocytes, and a negative fraction consisting of lymphocytes and DCs. Although the Ly6Chigh monocyte fraction contained a small percentage of contaminating Ly6G+ granulocytes, DCs were found only in the negative fraction (data not shown). PCR analysis revealed that Ly6Chigh monocytes were the predominant source of IFN-{alpha} and IFN-β expression (Fig. 3A). IFN-I transcripts also were detected in other populations, albeit at significantly lower levels (Fig. 3A). Ly6Chigh monocytes expressed high levels of the IFN-stimulated chemokine MCP-1 and moderate levels of TNF-{alpha} and IL-12 (Fig. 3B) as well. Granulocytes accounted for the remaining TNF-{alpha} transcripts and the majority of iNOS expression. Not surprisingly, IL-12 transcripts were found predominantly in cells of the negative fraction because this cytokine was most likely derived from DCs (Fig. 3B). Similar results were obtained when this experiment was repeated using flow cytometric cell sorting to increase the purity of sorted populations (data not shown).


Figure 3
View larger version (25K):
[in this window]
[in a new window]

 
FIGURE 3. Ly6Chigh monocytes are major producers of IFN-I. Analysis of IFN-I expression (A) (conventional PCR) and ISG expression (B) (real-time PCR) in magnetic bead-sorted peritoneal Ly6Chigh monocytes, granulocytes, and the negative fraction (lymphocytes and DCs) from wild-type 129sv mice treated with TMPD (2 wk). C, Flow cytometry of TMPD-elicited peritoneal cells 2 days following treatment with clo-liposomes (clo-lip). Boxed areas indicate the percentage of Ly6Chigh monocytes. IFN-I expression (D) (conventional PCR) and ISG expression (E) (real-time PCR) in peritoneal cells after clo-liposome or PBS treatment. Data represent the mean of n = 5 animals and error bars indicate SD. *, p < 0.05, as determinied by Student’s t test.

 
To confirm that Ly6Chigh monocytes were major producers of IFN-I, we asked whether their depletion abolishes the IFN signature. Treatment with clo-liposomes effectively eliminates monocytes in vivo (13). Indeed, a single dose of clo-liposomes i.p. was sufficient to eliminate ~80% of peritoneal Ly6Chigh monocytes in mice pretreated with TMPD (Fig. 3C). There were also slight reductions in the number of DCs and lymphocytes (data not shown), whereas the number of CD11b+Ly6CmidLy6G+ granulocytes was unaffected by clo-liposome treatment.

Concomitant with the depletion of Ly6Chigh monocytes, the expression of IFN-{alpha}, IFN-β, and ISGs was drastically reduced (Fig. 3, D and E). Similarly, the expression of TNF-{alpha}, which was highly expressed by Ly6Chigh monocytes, also diminished upon their depletion. The expression of IL-12, which was expressed mainly by the negative cell fraction comprised of lymphocytes and DCs, did not change significantly after clo-liposome treatment (Fig. 3E). The effect of clo-liposomes was transient as the number of Ly6Chigh monocytes and the expression of ISGs returned to pretreatment levels after 4 days (data not shown).

TMPD-induced IFN-I production is not dependent on DCs

Plasmacytoid DCs (PDCs) are capable of secreting large amounts of IFN-I during viral infection and are thought to be primary IFN producers in SLE (17, 19). In the peritoneal cavity of TMPD-treated animals, CD11c+I-A+ DCs comprised ~2% of the infiltrating inflammatory cells. Most peritoneal DCs expressed CD11b but not B220 (Fig. 4A), consistent with the phenotype of myeloid DCs (MDCs). However, PDCs may home to other secondary lymphoid tissue following activation (16, 17). To elucidate the extent to which DCs contribute to IFN-I production in the TMPD model, we used transgenic mice carrying the simian DTR under the control of the CD11c promoter (CD11c-DTR) (10). Injection of diphtheria toxin rapidly ablates both PDCs and MDCs systemically in CD11c-DTR mice, whereas wild-type mice are unaffected by the toxin (10).


Figure 4
View larger version (27K):
[in this window]
[in a new window]

 
FIGURE 4. DCs are not required for IFN-I production induced by TMPD. A, Flow cytometry of peritoneal DCs after TMPD treatment. Boxed area indicates a percentage of CD11c+I-A+ DCs. B, Depletion in CD11c-DTR mice 2 days after diphtheria toxin injection. Boxed area indicates CD11c+I-A+ DCs. C, Quantification of peritoneal DCs and Ly6Chigh monocytes. *, p < 0.05. D, Quantification of splenic DC depletion. MDCs were defined as CD11chighI-A+CD11b+ cells and PDCs were defined as CD11c+B220+PDCA-1+ cells. IFN-I expression (E) (conventional PCR) and ISG expression (F) (real-time PCR) in peritoneal exudate cells (PEC) as a result of systemic depletion of DCs. Data in C, D, and F represent the mean of n = 6 animals and error bars indicate SD. *, p < 0.05, as determined by Student’s t test.

 
Two days following diphtheria toxin injection, TMPD-treated CD11c-DTR mice showed >85% depletion of CD11c+ I-A+ DCs in the peritoneal exudate compared with wild-type controls (Fig. 4, B and C). In line with previous reports (11, 20), DC depletion was systemic as splenic MDCs and PDCs were also depleted by 70–80% (Fig. 4, B and C). In contrast, there was no significant difference in the peritoneal accumulation of Ly6Chigh monocytes, granulocytes, and lymphocytes (Fig. 4C and data not shown). Both CD11chighCD11b+I-A+ MDCs and CD11c+B220+PDCA-1+ PDCs were depleted to a similar degree in the spleen (Fig. 4D) and lymph nodes (data not shown). Systemic depletion of DCs did not affect TMPD-induced IFN-I production as the expression of IFN-I and ISGs were unaffected in CD11c-DTR animals (Fig. 4, E and F). The expression of TNF-{alpha} and iNOS was also unchanged (data not shown). In contrast, IL-12 expression was drastically reduced in the absence of DCs (Fig. 4F), consistent with the cell sorting experiment (Fig. 3E). Taken together, these data indicate that DCs were the primary source of IL-12 but not IFN-I.

We also tried to deplete PDCs using the recently described PDC-specific Ab 120G8 (21). Treatment with 120G8 i.p. resulted in ~70% depletion of splenic PDCs after 24 h, comparable to the levels seen in CD11c-DTR mice. However, peritoneal Ly6Chigh monocytes and T lymphocytes were also reduced by >50% (data not shown). Although the Ag bound by 120G8 and PDC Ag-1 is normally expressed on PDCs, its expression can be induced by IFN-I in other cell types (21, 22). Indeed, elevated IFN-I production in TMPD mice is associated with the expression of this PDC Ag on Ly6Chigh monocytes, granulocytes and T lymphocytes (data not shown), making selective Ab-mediated depletion of PDCs unfeasible in this model.

Accumulation of Ly6Chigh monocytes is associated with autoantibody production

Expression of ISGs is associated with autoantibodies against Sm/RNP in SLE patients (4, 5). In the TMPD model, 60–70% of treated BALB/c mice exhibit anti-Sm/RNP Abs after 4–6 mo vs 0% of IFNAR–/– mice (9). These autoantibodies either appear less frequently or are completely absent in mice treated with other adjuvant oils such as n-hexadecane, squalene, or mineral oil (23). Interestingly, treatment with n-hexadecane (which induces anti-Sm/RNP in ~25% of treated animals) elicited the accumulation of Ly6Chigh monocytes, albeit the response was milder than with TMPD, whereas squalene (which induces a weak anti-Sm/RNP response in <10% of treated animals) recruited mostly mature monocytes/macrophages and few Ly6Chigh monocytes, resembling the pattern seen with mineral oil (Fig. 5A). Because Ly6Chigh monocytes were the major source of IFN-I in TMPD-treated mice, we examined whether the frequency of anti-Sm/RNP autoantibodies correlates with the number of these cells. Indeed, the ability of adjuvant oils to elicit anti-Sm/RNP Abs was highly correlated (R2 = 0.98) with the accumulation of Ly6Chigh monocytes (Fig. 5B). Numbers of Ly6Chigh monocytes also correlated with ISG expression (Fig. 5C), supporting our finding that these cells are major IFN-I producers. In contrast, the recruitment of granulocytes was similar among all treatment groups and more DCs were present in the peritoneal exudate cells following mineral oil or squalene treatment than TMPD (data not shown).


Figure 5
View larger version (23K):
[in this window]
[in a new window]

 
FIGURE 5. Accumulation of Ly6Chigh monocytes is correlated with the frequency of anti-Sm/RNP autoantibodies and up-regulation of ISG expression. A, Flow cytometry of peritoneal cells in wild-type 129Sv mice treated with n-hexadecane (2 wk) or squalene (2 wk). Boxed region indicates Ly6Chigh immature monocytes. B, Correlation showing the levels of Ly6Chigh monocyte accumulation with the frequency of anti-Sm/RNP autoantibodies and ISG expression induced by TMPD, n-hexadecane (HEX), squalene (SQ), mineral oil (MO), and PBS. Autoantibody frequency represents the mean of n > 10 mice per group from previous studies. Percentage of Ly6Chigh monocytes and ISG expression index represent the mean of n = 4 mice. Error bars indicate SD. ISG expression index was calculated as follows: mean relative expression of (Mx-1 + MCP + IP-10)/3.

 
Surface expression of Ly6C on monocytes is not IFN-I-dependent

Because Ly6C is an IFN-inducible gene (24), it is possible that IFN-I production triggered by TMPD treatment contributes to the Ly6Chigh monocyte phenotype. To address this issue, we analyzed monocyte subsets in IFNAR–/– mice. Compared with wild-type controls, untreated IFNAR–/– mice showed similar levels of Ly6Chigh and Ly6C monocytes in the circulation, accounting for ~2% and 5% of PBMC, respectively (data not shown). Two weeks following TMPD treatment, IFNAR–/– mice also displayed an increased number of circulating Ly6Chigh monocytes, albeit the response was milder than that of wild-type controls (Fig. 6). Importantly, Ly6Chigh and Ly6C monocytes, as well as the Ly6Cmid granulocyte populations in the peripheral blood were clearly discernible even in the absence of IFN-I signaling. The number of bone marrow precursors of Ly6Chigh monocytes was also comparable between wild-type and IFNAR–/– mice (Fig. 6). These data suggest that although IFN-I has been shown to induce Ly6C expression (24), the Ly6Chigh phenotype of the immature monocyte population in naive or TMPD-treated mice was not dependent on IFN-I signaling.


Figure 6
View larger version (58K):
[in this window]
[in a new window]

 
FIGURE 6. Ly6C expression on immature monocytes is not dependent on IFN-I signaling. Flow cytometry analysis of monocyte subsets in the peripheral blood (top) and bone marrow (bottom) of TMPD-treated wild-type 129sv mice and IFNAR–/– mice. Boxed area represents peripheral blood Ly6Chigh monocytes and ovals indicate bone marrow Ly6Chigh monocyte precursors.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Elevated serum IFN-I was first associated with SLE over two decades ago (25). Recent studies using microarrays and real-time PCR further defined a panel of ISGs overexpressed in the peripheral blood of SLE patients (2, 3, 4). Although this IFN signature has been linked to disease activity, kidney involvement, and autoantibody levels, the source of IFN-I responsible for the IFN signature remains a matter of speculation. This issue has been difficult to address using animal models because most of them do not exhibit up-regulation of IFN-I.

We recently reported that murine lupus induced by TMPD is associated with elevated IFN-I production and ISG expression (8). Disruption of IFN-I signaling completely abrogates the development of kidney disease and the onset of autoantibody production (9). In this study, we show that Ly6Chigh monocytes are a major source of IFN-I in the TMPD model of lupus. Up-regulation of IFN-I and ISGs occurred long before the clinical manifestations of lupus and coincided with an accumulation of Ly6Chigh monocytes. These immature monocytes expressed large amounts of IFN-I and the IFN signature was rapidly abolished upon depletion of these cells by clo-liposomes. Moreover, the abundance of Ly6Chigh monocytes was highly associated with the ability of various adjuvant oils to induce anti-Sm/RNP Abs. In contrast, systemic depletion of DCs did not alter IFN-I production triggered by TMPD.

Although Ly6Chigh monocytes were found in the inflammatory infiltrate 1 day after thioglycolate (12, 13) or mineral oil administration, the response was transient as the number of these cells was drastically reduced after 72 h. The recruitment and accumulation of Ly6Chigh monocytes seen in TMPD-treated animals, in contrast, persisted for as long as 4 mo after treatment. A recent study shows that the egression of Ly6Chigh monocytes from the bone marrow in response to Listeria monocytogenes infection is dependent on the interaction between the monocyte attractant MCP-1/CCL2 and its receptor CCR2 (26). Interestingly, as confirmed in this study, MCP-1 is an ISG that is induced by TMPD treatment, raising the possibility that the production of IFN-inducible chemokines may drive the recruitment of Ly6Chigh monocytes. This mechanism is relevant to human SLE as elevated serum levels of MCP-1 have been associated with the IFN signature (3). How TMPD treatment maintains the infiltrating monocytes in an immature state is unknown, but a defect intrinsic to the cells is unlikely as Ly6Chigh monocytes spontaneously acquired a mature macrophage-like phenotype (Ly6C F4/80+ I-A+) in vitro (data not shown). The immaturity of Ly6Chigh monocytes may be important to their ability to produce IFN-I as their mature counterparts elicited by mineral oil displayed significantly lower levels. Analogously, PDCs also are better equipped to secrete large amounts of IFN-I when immature (27).

Prolonged elevation of IFN-I may promote DC maturation (28), T cell survival (29), isotype class-switching (30), and B cell maturation into plasma cells (31), culminating in the loss of tolerance and autoantibody production. It is noteworthy that although IFN-I is essential to TMPD-induced lupus (9), other factors such as IL-12 and IFN-{gamma} play important roles because autoantibody production and kidney disease development are reduced in deficient mice (32, 33).

Our findings challenge the conventional view that PDCs are solely responsible for the elevated IFN-I in SLE. In TMPD-treated mice, the vast majority of the increased IFN-I production is derived from the 20–30% of peritoneal cells that are Ly6Chigh CD11b+B220CD11c monocytes. Although, PDCs can synthesize up to 1000-fold more IFN-{alpha} than most other cell types (34), the number of circulating PDCs is drastically reduced in SLE patients (4, 35). Although it is plausible that PDCs home to tissues following activation, a view supported by the presence of these cells in lupus skin lesions (36), there is little direct evidence connecting tissue PDCs to the excess serum IFN-I seen in SLE patients. Indeed, as tissue (e.g., spleen) PDCs were greatly reduced by diphtheria toxin treatment of CD11c-DTR mice, despite little effect on ISG expression, it is unlikely that PDCs were the main source of IFN-I in TMPD-induced lupus. Also, the elevation of IFN-I in this model occurs within 2 wk of treatment, long before the appearance of autoantibodies against dsDNA and small nuclear RNP and formation of immune complexes. The proposed mechanism of IFN-I induction in PDCs by endogenous nucleic acids present in immune complexes, therefore, is not a likely explanation of our findings (19). Nevertheless, PDCs may function to amplify IFN-I production once autoantibodies and immune complexes develop. MDCs also play a role in TMPD-induced lupus because they are the major source of IL-12, a cytokine critical for the development of kidney disease in this model (32). The role of DCs in human SLE is more difficult to assess because targeted DC therapy is not yet available.

It is noteworthy that Ly6Chigh monocytes also have been recently reported to play a role in atherosclerosis (37). Therefore, these monocyte-like IFN-producing cells could play a role in the premature atherosclerosis seen in SLE patients. A CD14highCD16 monocyte subset (also called "classical monocytes") is the equivalent of murine Ly6Chigh monocytes in terms of migratory properties (15). Whether this subset or other monocyte subsets produce IFN-I in human SLE warrants detailed investigation.


    Acknowledgments
 
We thank Neal Benson and the University of Florida Flow Cytometry Core (Gainesville, FL) for assistance with cell sorting.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by research Grant R01-AR44731 from the U.S. Public Health Service and by gifts from Lupus Link, Inc., Daytona Beach, FL, and from Mr. Lewis M. Schott to the University of Florida Center for Autoimmune Disease. P.Y.L. and J.S.W. are recipients of the National Institutes of Health T32 Trainee Grants DK07518 and AR007603. This work was also supported with resources and the use of facilities at the Malcolm Randall Veterans Affairs Medical Center, Gainesville, FL. Back

2 Address correspondence and reprint requests to Dr. Westley H. Reeves, Division of Rheumatology & Clinical Immunology, University of Florida, PO Box 100221, Gainesville, FL 32610-0221. E-mail address: whreeves{at}ufl.edu Back

3 Abbreviations used in this paper: SLE, systemic lupus erythematosus; RNP, ribonucleoprotein; DC, dendritic cell; MDC, myeloid DC; PDC, plasmacytoid DC; ISG, IFN-stimulated gene; IFN-I, type I IFN; IFNAR, IFN-I receptor {alpha}-chain; TMPD, tetramethylpentadecane; DTR, diphtheria toxin receptor; clo-liposome, clodronate-containing liposome; iNOS, inducible NO synthase. Back

Received for publication January 11, 2008. Accepted for publication January 30, 2008.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Reeves, W. H., S. Narain, M. Satoh. 2004. Autoantibodies in systemic lupus erythematosus. W. J. Koopman, and L. W. Moreland, eds. Arthritis and Allied Conditions 1497 Lippincott Williams & Wilkins, Philadelphia.
  2. Baechler, E. C., F. M. Batliwalla, G. Karypis, P. M. Gaffney, W. A. Ortmann, K. J. Espe, K. B. Shark, W. J. Grande, K. M. Hughes, V. Kapur, et al 2003. Interferon-inducible gene expression signature in peripheral blood cells of patients with severe lupus. Proc. Natl. Acad. Sci. USA 100: 2610-2615. [Abstract/Free Full Text]
  3. Bennett, L., A. K. Palucka, E. Arce, V. Cantrell, J. Borvak, J. Banchereau, V. Pascual. 2003. Interferon and granulopoiesis signatures in systemic lupus erythematosus blood. J. Exp. Med. 197: 711-723. [Abstract/Free Full Text]
  4. Zhuang, H., S. Narain, E. Sobel, P. Y. Lee, D. C. Nacionales, K. M. Kelly, H. B. Richards, M. Segal, C. Stewart, M. Satoh, W. H. Reeves. 2005. Association of anti-nucleoprotein autoantibodies with upregulation of type I interferon-inducible gene transcripts and dendritic cell maturation in systemic lupus erythematosus. Clin. Immunol. 117: 238-250. [Medline]
  5. Kirou, K. A., C. Lee, S. George, K. Louca, M. G. Peterson, M. K. Crow. 2005. Activation of the interferon-{alpha} pathway identifies a subgroup of systemic lupus erythematosus patients with distinct serologic features and active disease. Arthritis Rheum. 52: 1491-1503. [Medline]
  6. Rönnblom, L. E., G. V. Alm, K. E. Oberg. 1991. Autoimmunity after {alpha}-interferon therapy for malignant carcinoid tumors. Ann. Intern Med. 115: 178-183. [Medline]
  7. Satoh, M., W. H. Reeves. 1994. Induction of lupus-associated autoantibodies in BALB/c mice by intraperitoneal injection of pristane. J. Exp. Med. 180: 2341-2346. [Abstract/Free Full Text]
  8. Nacionales, D. C., K. M. Kelly, P. Y. Lee, H. Zhuang, Y. Li, J. S. Weinstein, E. Sobel, Y. Kuroda, J. Akaogi, M. Satoh, W. H. Reeves. 2006. Type I interferon production by tertiary lymphoid tissue developing in response to 2,6,10,14-tetramethyl-pentadecane (pristane). Am. J. Pathol. 168: 1227-1240. [Abstract/Free Full Text]
  9. Nacionales, D. C., K. M. Kelly-Scumpia, P. Y. Lee, J. S. Weinstein, R. Lyons, E. Sobel, M. Satoh, W. H. Reeves. 2007. Deficiency of the type I interferon receptor protects mice from experimental lupus. Arthritis Rheum. 56: 3770-3783. [Medline]
  10. Jung, S., D. Unutmaz, P. Wong, G. Sano, K. De los Santos, T. Sparwasser, S. Wu, S. Vuthoori, K. Ko, F. Zavala, E. G. Pamer, D. R. Littman, R. A. Lang. 2002. In vivo depletion of CD11c+ dendritic cells abrogates priming of CD8+ T cells by exogenous cell-associated antigens. Immunity 17: 211-220. [Medline]
  11. Scumpia, P. O., P. F. McAuliffe, K. A. O’Malley, R. Ungaro, T. Uchida, T. Matsumoto, D. G. Remick, M. J. Clare-Salzler, L. L. Moldawer, P. A. Efron. 2005. CD11c+ dendritic cells are required for survival in murine polymicrobial sepsis. J. Immunol. 175: 3282-3286. [Abstract/Free Full Text]
  12. Sunderkotter, C., T. Nikolic, M. J. Dillon, N. Van Rooijen, M. Stehling, D. A. Drevets, P. J. Leenen. 2004. Subpopulations of mouse blood monocytes differ in maturation stage and inflammatory response. J. Immunol. 172: 4410-4417. [Abstract/Free Full Text]
  13. Van Rooijen, N., A. Sanders. 1994. Liposome mediated depletion of macrophages: mechanism of action, preparation of liposomes and applications. J. Immunol. Methods 174: 83-93. [Medline]
  14. Cook, A. D., E. L. Braine, J. A. Hamilton. 2003. The phenotype of inflammatory macrophages is stimulus dependent: implications for the nature of the inflammatory response. J. Immunol. 171: 4816-4823. [Abstract/Free Full Text]
  15. Geissmann, F., S. Jung, D. R. Littman. 2003. Blood monocytes consist of two principal subsets with distinct migratory properties. Immunity 19: 71-82. [Medline]
  16. Asselin-Paturel, C., A. Boonstra, M. Dalod, I. Durand, N. Yessaad, C. Dezutter-Dambuyant, A. Vicari, A. O’Garra, C. Biron, F. Briere, G. Trinchieri. 2001. Mouse type I IFN-producing cells are immature APCs with plasmacytoid morphology. Nat. Immunol. 2: 1144-1150. [Medline]
  17. Cella, M., D. Jarrossay, F. Facchetti, O. Alebardi, H. Nakajima, A. Lanzavecchia, M. Colonna. 1999. Plasmacytoid monocytes migrate to inflamed lymph nodes and produce large amounts of type I interferon. Nat. Med. 5: 919-923. [Medline]
  18. Spangrude, G. J., Y. Aihara, I. L. Weissman, J. Klein. 1988. The stem cell antigens Sca-1 and Sca-2 subdivide thymic and peripheral T lymphocytes into unique subsets. J. Immunol. 141: 3697-3707. [Abstract]
  19. Rönnblom, L., M. L. Eloranta, G. V. Alm. 2006. The type I interferon system in systemic lupus erythematosus. Arthritis Rheum. 54: 408-420. [Medline]
  20. Kassim, S. H., N. K. Rajasagi, X. Zhao, R. Chervenak, S. R. Jennings. 2006. In vivo ablation of CD11c-positive dendritic cells increases susceptibility to herpes simplex virus type 1 infection and diminishes NK and T-cell responses. J. Virol. 80: 3985-3993. [Abstract/Free Full Text]
  21. Asselin-Paturel, C., G. Brizard, J. J. Pin, F. Briere, G. Trinchieri. 2003. Mouse strain differences in plasmacytoid dendritic cell frequency and function revealed by a novel monoclonal antibody. J. Immunol. 171: 6466-6477. [Abstract/Free Full Text]
  22. Blasius, A. L., E. Giurisato, M. Cella, R. D. Schreiber, A. S. Shaw, M. Colonna. 2006. Bone marrow stromal cell antigen 2 is a specific marker of type I IFN-producing cells in the naive mouse, but a promiscuous cell surface antigen following IFN stimulation. J. Immunol. 177: 3260-3265. [Abstract/Free Full Text]
  23. Kuroda, Y., J. Akaogi, D. C. Nacionales, S. C. Wasdo, N. J. Szabo, W. H. Reeves, M. Satoh. 2004. Distinctive patterns of autoimmune response induced by different types of mineral oil. Toxicol. Sci. 78: 222-228. [Abstract/Free Full Text]
  24. Dumont, F. J., L. Z. Coker. 1986. Interferon-{alpha}/β enhances the expression of Ly-6 antigens on T cells in vivo and in vitro. Eur. J. Immunol. 16: 735-740. [Medline]
  25. Hooks, J. J., H. M. Moutsopoulos, S. A. Geis, N. I. Stahl, J. L. Decker, A. L. Notkins. 1979. Immune interferon in the circulation of patients with autoimmune disease. N. Engl. J. Med. 301: 5-8. [Abstract]
  26. Serbina, N. V., E. G. Pamer. 2006. Monocyte emigration from bone marrow during bacterial infection requires signals mediated by chemokine receptor CCR2. Nat. Immunol. 7: 311-317. [Medline]
  27. Kadowaki, N., S. Antonenko, J. Y. Lau, Y. J. Liu. 2000. Natural interferon {alpha}/β-producing cells link innate and adaptive immunity. J. Exp. Med. 192: 219-226. [Abstract/Free Full Text]
  28. Blanco, P., A. K. Palucka, M. Gill, V. Pascual, J. Banchereau. 2001. Induction of dendritic cell differentiation by IFN-{alpha} in systemic lupus erythematosus. Science 294: 1540-1543. [Abstract/Free Full Text]
  29. Marrack, P., J. Kappler, T. Mitchell. 1999. Type I interferons keep activated T cells alive. J. Exp. Med. 189: 521-530. [Abstract/Free Full Text]
  30. Le Bon, A., G. Schiavoni, G. D’Agostino, I. Gresser, F. Belardelli, D. F. Tough. 2001. Type i interferons potently enhance humoral immunity and can promote isotype switching by stimulating dendritic cells in vivo. Immunity 14: 461-470. [Medline]
  31. Finkelman, F. D., A. Svetic, I. Gresser, C. Snapper, J. Holmes, P. P. Trotta, I. M. Katona, W. C. Gause. 1991. Regulation by interferon {alpha} of immunoglobulin isotype selection and lymphokine production in mice. J. Exp. Med. 174: 1179-1188. [Abstract/Free Full Text]
  32. Calvani, N., M. Satoh, B. P. Croker, W. H. Reeves, H. B. Richards. 2003. Nephritogenic autoantibodies but absence of nephritis in IL-12p35-deficient mice with pristane-induced lupus. Kidney Int. 64: 897-905. [Medline]
  33. Richards, H. B., M. Satoh, J. C. Jennette, B. P. Croker, H. Yoshida, W. H. Reeves. 2001. Interferon-{gamma} is required for lupus nephritis in mice treated with the hydrocarbon oil pristane. Kidney Int. 60: 2173-2180. [Medline]
  34. Coccia, E. M., M. Severa, E. Giacomini, D. Monneron, M. E. Remoli, I. Julkunen, M. Cella, R. Lande, G. Uze. 2004. Viral infection and Toll-like receptor agonists induce a differential expression of type I and {lambda} interferons in human plasmacytoid and monocyte-derived dendritic cells. Eur. J. Immunol. 34: 796-805. [Medline]
  35. Scheinecker, C., B. Zwolfer, M. Koller, G. Manner, J. S. Smolen. 2001. Alterations of dendritic cells in systemic lupus erythematosus: phenotypic and functional deficiencies. Arthritis Rheum. 44: 856-865. [Medline]
  36. Farkas, L., K. Beiske, F. Lund-Johansen, P. Brandtzaeg, F. L. Jahnsen. 2001. Plasmacytoid dendritic cells (natural interferon- {alpha}/β-producing cells) accumulate in cutaneous lupus erythematosus lesions. Am. J. Pathol. 159: 237-243. [Abstract/Free Full Text]
  37. Tacke, F., D. Alvarez, T. J. Kaplan, C. Jakubzick, R. Spanbroek, J. Llodra, A. Garin, J. Liu, M. Mack, N. van Rooijen, et al 2007. Monocyte subsets differentially employ CCR2, CCR5, and CX3CR1 to accumulate within atherosclerotic plaques. J. Clin. Invest. 117: 185-194. [Medline]



This article has been cited by other articles:


Home page
JEMHome page
P. Y. Lee, Y. Kumagai, Y. Li, O. Takeuchi, H. Yoshida, J. Weinstein, E. S. Kellner, D. Nacionales, T. Barker, K. Kelly-Scumpia, et al.
TLR7-dependent and Fc{gamma}R-independent production of type I interferon in experimental mouse lupus
J. Exp. Med., December 22, 2008; 205(13): 2995 - 3006.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, P. Y.
Right arrow Articles by Reeves, W. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, P. Y.
Right arrow Articles by Reeves, W. H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS