The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


The Journal of Immunology, 2008, 180, 5075-5082
Copyright © 2008 by The American Association of Immunologists, Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kang, Y. J.
Right arrow Articles by Han, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kang, Y. J.
Right arrow Articles by Han, J.

Macrophage Deletion of p38{alpha} Partially Impairs Lipopolysaccharide-Induced Cellular Activation1

Young Jun Kang2,*, Jianming Chen2,*, Motoyuki Otsuka*, Johann Mols*, Shuxun Ren{dagger}, Yinbin Wang{dagger} and Jiahuai Han3,*

* Department of Immunology, The Scripps Research Institute, La Jolla, CA 92037 and {dagger} Molecular Biology Institute and the Departments of Anesthesiology and Medicine, David Geffen School of Medicine, University of California, Los Angeles, CA 90095


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The activation of p38{alpha}, a MAPK family member, is associated with macrophage activation by microbial pattern molecules, such as LPS. The requirement of p38{alpha} in inflammatory responses has been shown in a number of studies using chemical inhibitors, though the inhibitors also inhibit p38β and perhaps some other enzymes. In this study, we used conditional knockout of p38{alpha} in macrophages to address the role of p38{alpha} in macrophage activation. We found that p38{alpha} deficiency causes a significant inhibition in the production of LPS-induced TNF-{alpha}, IL-12, and IL-18, but it has little or no effect on IL-6 or IFN-β production. Knockout of p38{alpha} in macrophages did not affect LPS-induced activation of the other major signaling pathways (NF-{kappa}B, Jnk, and Erk), nor did it affect the transcriptional activity of NF-{kappa}B. It had little inhibitory effect on LPS-induced AP-1 activity, but it significantly inhibited LPS-induced C/EBP-β and CREB activation, indicating that the role of p38{alpha} in cytokine production in macrophages is at least in part through its regulation of C/EBP-β and CREB activation. In addition, we also confirmed that p38{alpha} is important for phagocytosis of bacteria by macrophages. Our in vivo studies with two murine models showed that p38{alpha} is involved in sepsis. Collectively, our data demonstrate that p38{alpha} is an important player in inflammatory responses.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
In mammalian innate immunity, pathogen-associated molecular patterns are recognized by specific cell surface or intracellular receptors (1, 2). The signaling pathways of the transcription factor NF-{kappa}B and the MAPKs, which include Jnk, Erk, and p38, are commonly activated after receptor engagement with microbial pattern molecules (1, 3). The activation of these signaling pathways is believed to be essential for the production of proinflammatory cytokines, such as TNF-{alpha}, IL-6, IL-1, and IL-12, as well as chemokines (4). Although the production of proinflammatory cytokines renders an important role in host defense against the invading microbes (3, 5), overexpression of cytokines can lead to inflammatory disorders (4). Therefore, the signaling pathways that regulate cytokine production have been intensively studied.

The p38{alpha} protein is the prototypic member of p38 group of MAPK. It was identified as a protein that is rapidly phosphorylated in response to LPS stimulation (6, 7, 8). Molecular cloning and function studies of p38{alpha} revealed its kinase property and identified a number of its substrates, including protein kinases, transcription factors, and other proteins (9). The p38{alpha} kinase is involved in regulating the cell cycle, cell differentiation, cell death, development, tumorigenesis, and immune responses (9, 10). The essential role of p38{alpha} in proinflammatory responses has been implicated by several approaches. In macrophages, LPS stimulation induces the activation of p38{alpha}, which subsequently activates a downstream signaling cascade of proinflammatory cytokines, including TNF-{alpha}, IL-1, and IL-6 (8, 11, 12, 13, 14). Activation of p38{alpha} is also involved in the induction of inducible NO synthase and cyclooxygenase 2 (15, 16, 17), and the induction of surface molecules and other inflammation-related molecules (18) in LPS-treated macrophages. Inhibition of p38{alpha} activity by the inhibitor SB203580 reduced the mortality of endotoxin-induced shock and inhibited the development of collagen-induced arthritis in animal models (19). However, it is known that the currently available p38 inhibitors target both p38{alpha} and p38β, and perhaps other proteins, so the role of p38{alpha} in inflammatory cytokine production needs to be evaluated by genetic deletion of p38{alpha}.

The deletion of the p38{alpha} gene in mice has been described by several independent groups, and in all cases, it led to embryonic lethality (20, 21, 22, 23). Recently, the role of p38{alpha} in cell proliferation and differentiation has been reported using conditional knockout mice (24, 25, 26). Mice with an embryo-specific deletion of p38{alpha} died shortly after birth due to lung dysfunction. Proliferation of fetal hematopoietic cells and embryonic fibroblasts was found to be increased, which most likely resulted from sustained activation of the Jnk pathway in p38{alpha} knockout cells (24). Another approach using conditional deletion of p38{alpha} in adult mice showed notable defects in lung homeostasis, lifespan reduction, and a greater susceptibility to lung adenocarcinomas (25). In myoblasts, p38{alpha} deficiency resulted in impaired differentiation and multinucleated myotube formation due to delayed cell cycle exit and continuous proliferation in differentiation-promoting conditions (26). In this study we show that macrophage deletion of p38{alpha} impairs the innate immune response to the TLR4 ligand LPS. We found that production of the cytokines TNF-{alpha}, IL-12, and IL-18, as well as the activation of transcription factors C/EBP-β and CREB, were reduced in LPS-treated p38{alpha}-deficient macrophages in vitro. Upon LPS challenge in vivo, p38{alpha} conditional knockout mice showed significantly lower TNF levels in sera and prolonged survival times. Our results confirm the essential role of p38{alpha} in the innate immune response.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Reagents

LPS (Escherichia coli O111:B4) was purchased from List Biological Laboratories. Purified peptidoglycan from Staphylococcus aureus was from Sigma-Aldrich. Abs to I{kappa}B{alpha} and RNA polymerase II (RNA Pol II)4 were purchased from Santa Cruz Biotechnology, and Abs to phosphorylated p38, Jnk, Erk, and MAPK-activated protein kinase 2 (MK2) were from Cell Signaling Technology. Anti-GAPDH Ab was from Chemicon International. A cell permeable cAMP analog 8-bromo-cAMP was purchased from Biomol. Mouse TNF and IL-6 ELISA kits are from eBioscience. Recombinant mouse IFN-{alpha} was from PBL Biomedical Laboratories, and Vybrant Phagocytosis Assay kit and TRIzol was from Invitrogen Life Technologies. Fluorescein succinimidyl ester (Alexa Fluor 488 carboxylic acid) was from Molecular Probes, and SYBR green PCR Master mix from Applied Biosystems.

Animals

Protocols for the use of animals were approved by the Institutional Animal Care and Use Committee at The Scripps Research Institute.

Generation of mice with macrophage deletion of p38{alpha}

The p38{alpha} floxed allele was generated by homologous recombination in embryonic stem cells (Lexicon) in which the first exon (containing ATG) was flanked by two loxP sites as previously described (27). The floxed allele was bred into homozygosity, and then crossed with mice that contain a Cre-coding sequence driven by a lysozyme (Lys) promoter with a long terminal repeat (Ltr) enhancer inserted at the 5' end (LtrLysCre mice).

Genotyping

PCR analysis of mouse genomic DNA was performed for genotyping. The primer sets used were the following: cre, forward, GCTAATCGCCATCTTCCAGC, and reverse, GCCACCAGCCAGCTATCAAC; p38{alpha}, forward, TCCTACGAGCGTCGGCAAGGTG, and reverse, AGTCCCCGAGAGTTCCTGCCTC CCTCACTCCAGTTAAGGAGCC.

Preparation of cell or tissue lysates

Macrophages were harvested and washed twice with ice-cold PBS. The cell pellet was resuspended in lysis buffer (50 mM Tris-Cl (pH 7.5), 0.15 M NaCl, 1% Nonidet P-40, 0.5% deoxycholate, 1 mM EDTA, 1 mM DTT, 1 mM PMSF, 1 µg/ml leupeptin, 2 µg/ml aprotinin, and 5 µg/ml pepstatin) and incubated on ice for 30 min. Mouse tissues were collected and homogenized in lysis buffer using a Dounce homogenizer, and incubated on ice for 30 min. After centrifugation at 12,500 rpm for 5 min, the supernatant was collected, and the protein concentration was determined by the Bradford method.

Isolation and culture of peritoneal macrophages

Peritoneal macrophages were collected from thioglycolate-elicited mice and washed in ice-cold PBS. Cells were resuspended in culture medium (DMEM supplemented with 10% FBS, 2 g/L sodium bicarbonate, 100 mg/L sodium pyruvate, 10 mM HEPES (pH 7.4), 62.1 mg/L penicillin, and 100 mg/L streptomycin). Cells were seeded in the culture plates at a density of 106/ml or on glass coverslips at a density of 105/ml for the phagocytosis assay, and were incubated overnight at 37°C. Nonadherent cells were removed by washing with PBS.

Cytokine measurement

TNF-{alpha} and IL-6 levels from culture supernatants from LPS- or bacteria-treated macrophages, or blood sera were measured by ELISA according to the manufacturer’s protocol (eBioscience).

An IFN bioassay was performed to measure the IFN production by macrophages. Briefly, IFN-sensitive L929 cells were seeded in a 96-well culture plate at a density of 105/well, and recombinant mouse IFN-{alpha} or culture supernatant of macrophages were added to each well and further incubated overnight. Diluted vesicular stomatitis virus in culture medium was added to each well at the multiplicity of infection of 0.1, and incubated for 24 h. After washing the wells with PBS, cells were fixed with 5% formalin, followed by crystal violet staining. Absorbance was measured by an ELISA reader at 595 nm, and IFN-{alpha} activity was calculated from the standard curve.

Phagocytosis assay

Phagocytosis activity by macrophages was measured by infecting fluorescein-labeled E. coli (Vybrant Phagocytosis Assay kit) or fluorescein-labeled S. aureus. Briefly, bacteria were grown to mid-log phase, and washed twice with PBS containing 0.5% Tween 80 and 0.2 M sodium bicarbonate (pH 8.8), and then resuspended in the same buffer containing 1 µM fluorescein succinimidyl ester (Alexa Fluor 488 carboxylic acid). Following 1 h incubation at 37°C, bacteria were washed three times with PBS-Tween and syringe-dispersed before the infection of macrophages. Macrophages were infected for the indicated times with fluorescein-labeled live bacteria (macrophage to bacteria, 1/100), and washed in PBS three times. Cells were mounted in trypan blue to quench the noninternalized bacteria, and then visualized under a Zeiss Axioskop 20 fluorescence microscope. Three coverslips were collected from each time point, and 100 cells were randomly counted and the phagocytosis index was calculated.

Immunoblotting

Proteins were resolved using SDS-PAGE under reducing conditions, electrotransferred to polyvinylidene difluoride membrane, and then immunoblotted using the indicated Abs, which were then detected by chemiluminescence methods.

Preparation of nuclear extracts and EMSA

Nuclear extracts were prepared as previously described (28). Radiolabeling of NF-{kappa}B, AP-1, CREB, or C/EBP-β oligonucleotides with [{gamma}-32P]ATP and EMSA were performed according to the manufacturer’s protocols (Promega).

Isolation of RNA, reverse transcription, and PCR

Total RNA from macrophages was isolated using TRIzol. Semiquantitative PCR was performed as previously described (29). For real-time PCR, 1 µg of total RNA was used to prepare cDNA with oligo(dT)12 as a primer and SYBR green PCR Master mix was used for PCR analysis.

Chromatin immunoprecipitation (ChIP) assay

ChIP assays were performed as reported (30). Briefly, LPS-stimulated macrophages were treated with formaldehyde (final concentration of 1%) for 10 min at room temperature, and washed with PBS and lysed in lysis buffer containing 1% SDS, 10 mM EDTA, 50 mM Tris-HCl (pH 8.1), 1 mM PMSF, 1 mM Pepstatin A, and 1 mM aprotinin. After sonication, supernatants were collected by centrifugation. As a control, one-third of the lysate was ethanol-precipitated, and the total amount of DNA in the cells was analyzed by PCR of GAPDH and TNF. The remaining two-thirds of the lysate was diluted 10-fold with dilution buffer (1% Triton X-100, 1.2 mM EDTA, 16.7 mM Tris-HCl (pH 8.1), and 150 mM NaCl), and Abs against RNA Pol II were added and incubated overnight. Immunoprecipitated complexes were collected by protein A-Sepharose beads, and the protein/DNA was eluted in 200 µl of elution buffer (1% SDS, 0.1 M NaHCO3). Cross-linking was reversed by heating at 65°C for 4 h. The DNA was resuspended in 200 µl of water and treated with 20 µg of proteinase K at 37°C for 30 min, followed by phenol/chloroform extraction and ethanol precipitation. Pellets were resuspended in 10 mM Tris-HCl and EDTA and subjected to PCR amplification. The following primer sets were used for real-time PCR detection: GAPDH, forward, ACCTCTATAGGAGCGACAACAGT and reverse, TTTTGTCTACGGGACGAGGCT; and TNF, forward, TCAGCGAGGACAGCAAGGGACT and reverse, TGGTGTCTTTTCTGGAGGGAGAT.

Induction of sepsis and serum cytokine measurement

Age- and sex-matched p38{alpha}fl/fl and LtrLysCre-p38{alpha}{Delta}/{Delta} mice were injected i.p. with LPS or received cecal ligation and puncture (CLP) as previously reported (29, 31). Survival rates were monitored, and blood serum samples were collected at the indicated time points.

Statistical analysis

Data are presented as mean ± SD. The statistical significance of differences in TNF-{alpha} or IL-6 was determined by Student’s t test. Kaplan-Meier plots were constructed, and a log-rank test was used to analyze the significance of the differences in mouse survival.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Macrophage deletion of p38{alpha}

To knockout p38{alpha} in macrophages, we crossed the p38{alpha} floxed allele (p38{alpha}fl/fl) with a mouse strain (LtrLysCre mice) expressing Cre in macrophages, to generate LtrLysCre-p38{alpha}{Delta}/{Delta} mice. Expression of Cre in macrophages from LtrLysCre-p38{alpha}{Delta}/{Delta} mice should remove the first exon (containing ATG) of the p38{alpha} gene (Fig. 1A). Genomic DNA or proteins were prepared from different tissues and peritoneal macrophages of p38{alpha}fl/fl and LtrLysCre-p38{alpha}{Delta}/{Delta} mice, and were then analyzed by PCR or Western blotting to examine the p38{alpha} gene and the expression of the p38{alpha} protein. Because of restricted cell type expression of Cre by the lysozyme promoter (32, 33), the floxed p38{alpha} gene was detected in adult tissues of both p38{alpha}fl/fl and LtrLysCre-p38{alpha}{Delta}/{Delta} mice, despite of the presence of transgene cre in the tissues of LtrLysCre-p38{alpha}{Delta}/{Delta} mice (Fig. 1B, left). Due to the expression of the transgene cre in macrophages, we detected the deletion of the floxed p38{alpha} gene in macrophages from LtrLysCre-p38{alpha}{Delta}/{Delta} mice (Fig. 1B, right). We further analyzed the p38{alpha} protein in different tissues and peritoneal macrophages from p38{alpha}fl/fl or LtrLysCre-p38{alpha}{Delta}/{Delta} mice, confirming that p38{alpha} protein expression was eliminated in LtrLysCre-p38{alpha}{Delta}/{Delta} macrophages (Fig. 1C). These results demonstrate that we have obtained a mouse line whose macrophage p38{alpha} protein expression is eliminated. We therefore used p38{alpha}fl/fl mice as wild-type and LtrLysCre-p38{alpha}{Delta}/{Delta} mice as macrophage-specific p38{alpha} deletion mice to study the effect of macrophage deletion of p38{alpha}.


Figure 1
View larger version (30K):
[in this window]
[in a new window]

 
FIGURE 1. Conditional deletion of the p38{alpha} gene. A, The wild-type p38{alpha} allele was modified by inserting loxP sites flanking the exon of p38{alpha} and the neomycin-resistant cassette. The p38{alpha} exon is shown as a box and the starting codon is indicated by the ATG. B, PCR analysis of the p38{alpha} gene in various tissues and peritoneal macrophages from p38{alpha}fl/fl (p38{alpha} wild type) or LtrLysCre-p38{alpha}{Delta}/{Delta} (p38{alpha} conditional deletion) mice. The primers that specifically amplify cre or floxed p38{alpha} genes were used in PCR. C, Western blot analysis of p38{alpha} expression in various tissues and peritoneal macrophages from p38{alpha}fl/fl or LtrLysCre-p38{alpha}{Delta}/{Delta} mice. Anti-p38{alpha} and anti-GAPDH Abs were used in the Western blot analysis.

 
The role of p38{alpha} in LPS-mediated cytokine production

To study the role of p38{alpha} in proinflammatory cytokine production, we used LPS to stimulate wild-type macrophages (p38{alpha}fl/fl) and p38{alpha}-deficient macrophages (LtrLysCre-p38{alpha}{Delta}/{Delta}). We analyzed the production of cytokines in LPS-stimulated peritoneal macrophages from p38{alpha}fl/fl and LtrLysCre-p38{alpha}{Delta}/{Delta} mice in vitro. LPS-induced production of TNF-{alpha} was significantly reduced in LtrLysCre-p38{alpha}{Delta}/{Delta} cells, but production of IL-6 and IFN was not or only slightly affected (Fig. 2, A–C). We further examined the expression of proinflammatory cytokines by semiquantitative PCR using total RNA from LPS-stimulated p38{alpha}fl/fl or LtrLysCre-p38{alpha}{Delta}/{Delta} macrophages. The expressions of TNF, IL-12, and IL-18 were significantly reduced or delayed in LtrLysCre-p38{alpha}{Delta}/{Delta} macrophages, whereas the inductions of IL-6 and IFN-β were only modestly affected or unaffected (Fig. 2D). Thus, the p38{alpha}-mediated signaling pathway has a greater effect on the production of some proinflammatory cytokines, but has little or no effect on the induction of the others. It also should be noted that p38{alpha} knockout selective inhibition of the expression of different cytokines affects both the gene expression level and the time of the gene expression, suggesting that more than one mechanism is used by p38{alpha} to regulate cytokine gene expression.


Figure 2
View larger version (30K):
[in this window]
[in a new window]

 
FIGURE 2. LPS-induced proinflammatory cytokine expression in macrophages from p38{alpha}fl/fl and LtrLysCre-p38{alpha}{Delta}/{Delta} mice. A–C, Peritoneal macrophages isolated from p38{alpha}fl/fl mice (filled symbols) and LtrLysCre-p38{alpha}{Delta}/{Delta} mice (open symbols) were stimulated by LPS (100 ng/ml), and culture supernatants were collected at indicated time points for the analysis of TNF-{alpha} and IL-6 by ELISA, and IFN-β by bioassay. D, Total RNA samples were prepared from p38{alpha}fl/fl or LtrLysCre-p38{alpha}{Delta}/{Delta} macrophages treated with LPS for the indicated time points and were then analyzed by semiquantitative PCR using specific primers targeting different cytokines and GAPDH (as internal control). Results are representative of two to three independent experiments.

 
Activation of LPS-induced signaling pathways in p38{alpha}-deficient macrophages

We next examined the effect of p38{alpha} knockout on the activation of TLR4-mediated signaling pathways in macrophages. Because NF-{kappa}B and MAPK pathways are known to be important in cytokine production, we analyzed the degradation of the NF-{kappa}B inhibitor I{kappa}B{alpha}, as well as the phosphorylation of p38, Jnk, Erk, and MK2 by Western blot analysis (Fig. 3A). As expected, the activation of p38{alpha} was only detected in the control cells, but not in the p38{alpha}-deficient cells, because of the deletion of p38{alpha} (Fig. 3A). The degradation of I{kappa}B{alpha} and the activation of Jnk and Erk were not affected by p38{alpha} deficiency (Fig. 3A). The activation of MK2 was significantly reduced in LtrLysCre-p38{alpha}{Delta}/{Delta} macrophages, confirming that MK2 is primarily regulated by p38{alpha} (Fig. 3A).


Figure 3
View larger version (53K):
[in this window]
[in a new window]

 
FIGURE 3. Analyzing the effect of p38{alpha} knockout on LPS-induced activation of intracellular signaling pathways and transcription factors. A, Peritoneal macrophages from p38{alpha}fl/fl and LtrLysCre-p38{alpha}{Delta}/{Delta} mice were stimulated by LPS for the indicated times, and cell lysates were subjected to SDS-PAGE and Western blot analysis using the indicated Abs. Anti-GADPH Abs were used for the internal control. B, Peritoneal macrophages were stimulated by LPS for the indicated times, and nuclear extracts were prepared for analysis of the activation of transcription factors using specific probes by EMSA. C, Macrophages were treated with 8-bromo-cAMP for the indicated times and nuclear extracts were prepared for the EMSA using a CREB-specific probe. Results are representative of two to three independent experiments.

 
Because NF-{kappa}B, AP-1, C/EBP-β, and CREB are among the transcription factors that play a role in proinflammatory cytokine expression, we examined whether LPS-induced activation of these transcription factors was affected by p38{alpha} knockout in macrophages. As shown in Fig. 3B: LPS-induced activation of NF-{kappa}B was not affected by p38{alpha} knockout; LPS-induced AP-1 activation was slightly reduced in LtrLysCre-p38{alpha}{Delta}/{Delta} cells; LPS-induced initial C/EBP-β activation was almost completely blocked by p38{alpha} deletion and only a delayed weak activation appeared in LtrLysCre-p38{alpha}{Delta}/{Delta} macrophages; and LPS-induced CREB activation was significantly reduced by p38{alpha} deficiency. Thus, p38{alpha} is involved in the activation of some but not all transcription factors that play roles in LPS-induced proinflammatory cytokine expression.

CREB is a key mediator of cAMP- and calcium-inducible transcription, but LPS-induced CREB activation is independent from cAMP. MSK, a downstream kinase of p38{alpha}, is believed to be responsible for cAMP-independent stress-induced CREB activation (34, 35). To test the requirement of p38{alpha} in cAMP-mediated CREB activation, macrophages from p38{alpha}fl/fl or LtrLysCre-p38{alpha}{Delta}/{Delta} mice were treated with cell permeable 8-bromo-cAMP. CREB activity was tested by EMSA at different times after the treatment (Fig. 3C). Interestingly, p38{alpha} knockout effectively blocked activation of CREB by cAMP in macrophages. Thus, in addition to regulating stress-induced CREB activation through MSK, p38{alpha} can regulate cAMP-mediated activation of CREB directly or indirectly.

Involvement of p38{alpha} in transcriptional activation of TNF by LPS

To examine the role of p38{alpha} in transcriptional activation of TNF by LPS, we performed ChIP assay with RNA Pol II Abs. The DNA in the immunocomplex of RNA Pol II was analyzed by real-time PCR with primers flanking the promoters of TNF and GAPDH. The relative TNF promoter levels were calculated by normalizing against GAPDH. We did not detect RNA Pol II-associated TNF promoters in resting macrophages (data not shown). As expected, LPS stimulation led to a recruitment of RNA Pol II to the TNF promoter (Fig. 4A). The RNA Pol II-associated TNF promoter in LtrLysCre-p38{alpha}{Delta}/{Delta} macrophages is ~30% of that in p38{alpha}fl/fl cells 1 h after LPS treatment (Fig. 4A). It appears that p38{alpha} is involved in the recruitment of RNA Pol II to the promoter of TNF.


Figure 4
View larger version (15K):
[in this window]
[in a new window]

 
FIGURE 4. Requirement of p38{alpha} for the transcriptional activation of TNF in macrophages. A, The relative transcription activity of TNF in 1-h LPS-stimulated p38{alpha}fl/fl and LtrLysCre-p38{alpha}{Delta}/{Delta} macrophages was measured by ChIP assay using RNA Pol II Abs, followed by real-time PCR. Relative RNA Pol II-associated TNF promoter levels were calculated by normalizing with the internal control GAPDH. TNF promoter levels from p38{alpha}fl/fl macrophages was set as 1. TNF promoter levels from unstimulated macrophages were not detected. B, Real-time PCR analysis of LPS-induced TNF mRNA stability in p38{alpha}fl/fl and LtrLysCre-p38{alpha}{Delta}/{Delta} macrophages after LPS stimulation for 1 h. Actinomycin D (10 µg/ml) was added to inhibit transcription for the indicated periods of time, and total RNA was prepared for reverse transcription and PCR analysis. The percentage of remaining mRNA after actinomycin D treatment is presented. The value at 0 h was set as 100%. Results are representative of two to three independent experiments.

 
To determine whether the lower production of TNF in LPS-stimulated LtrLysCre-p38{alpha}{Delta}/{Delta} macrophages also resulted from a change in TNF mRNA stability, we measured the half-life of TNF mRNA in p38{alpha}fl/fl and LtrLysCre-p38{alpha}{Delta}/{Delta} macrophages at 1 h after LPS stimulation. The deletion of p38{alpha} in macrophages did not affect the stability of TNF mRNA (t1/2 = 23.60 min for wild-type macrophages and t1/2 = 24.84 min for p38{alpha}-deficient macrophages) (Fig. 4B), which indicates that p38{alpha} does not play a key role in regulating TNF mRNA stability in macrophages. These data are consistent with previous reports showing that the p38-MK2 pathway primarily regulates TNF translation, but not TNF mRNA stability in macrophages (36). It should be mentioned that these data neither support nor refute the role of p38{alpha} in regulating the mRNA stability of other inflammatory molecules in macrophages or in controlling TNF mRNA stability in other types of cells.

LtrLysCre-p38{alpha}{Delta}/{Delta} mice are more resistant to LPS- or CLP-induced death

The appearance of LtrLysCre-p38{alpha}{Delta}/{Delta} mice is indistinguishable from that of p38{alpha}fl/fl mice; they are viable, fertile, and healthy. To evaluate the in vivo effect of p38{alpha} deletion in macrophages, p38{alpha}fl/fl and LtrLysCre-p38{alpha}{Delta}/{Delta} mice were i.p. injected with LPS or received CLP. The LtrLysCre-p38{alpha}{Delta}/{Delta} mice were more resistant than p38fl/fl mice to the lethal effects of both LPS- and CLP-induced sepsis (Fig. 5, A and B). Sham-operated p38{alpha}fl/fl and LtrLysCre-p38{alpha}{Delta}/{Delta} mice (n = 5 mice each group) did not show any lethality (data not shown). The reduced sensitivity to LPS- or CLP-induced lethality in LtrLysCre-p38{alpha}{Delta}/{Delta} mice could be a result of a lack of p38{alpha} in macrophages or neutrophils in our mice, as Cre under the lysozyme promoter is expressed in both macrophages and neutrophils. Because macrophages are the major source of TNF-{alpha} production in mice (37), we compared LPS-induced TNF-{alpha} production in LtrLysCre-p38{alpha}{Delta}/{Delta} and p38{alpha}fl/fl mice. LtrLysCre-p38{alpha}{Delta}/{Delta} and p38{alpha}fl/fl mice have a similar number of peritoneal macrophages (data not shown). LPS induced a quick increase in serum TNF-{alpha} levels, peaking 1 h after LPS injection in p38{alpha}fl/fl mice, whereas LPS only modestly induced serum TNF-{alpha} levels in LtrLysCre-p38{alpha}{Delta}/{Delta} mice (Fig. 5C). Consistent with the in vitro data (Fig. 2A), p38{alpha} knockout did not significantly affect the LPS-induced IL-6 increase in serum levels (Fig. 5D). The defect in macrophage TNF-{alpha} production should at least contribute to the reduced lethality found in LPS-treated LtrLysCre-p38{alpha}{Delta}/{Delta} mice.


Figure 5
View larger version (25K):
[in this window]
[in a new window]

 
FIGURE 5. LPS- or CLP-induced lethality and LPS-induced TNF-{alpha} and IL-6 production in p38{alpha}fl/fl and LtrLysCre-p38{alpha}{Delta}/{Delta} mice. A, p38{alpha}fl/fl mice (n = 20) and LtrLysCre-p38{alpha}{Delta}/{Delta} mice (n = 20) were i.p. injected with LPS (400 µg/25 g of body weight). B, p38{alpha}fl/fl mice (n = 15) and LtrLysCre-p38{alpha}{Delta}/{Delta} mice (n = 15) received CLP. Survival rates were monitored. Kaplan-Meier plots were constructed and statistical significance was analyzed by a log-rank test. p < 0.0001 for LtrLysCre-p38{alpha}{Delta}/{Delta} vs p38{alpha}fl/fl mice in A and B. C and D, p38{alpha}fl/fl and LtrLysCre-p38{alpha}{Delta}/{Delta} mice were i.p. injected with LPS (400 µg/25 g of body weight), and blood samples were collected at the indicated time points to measure the TNF-{alpha} (left) or IL-6 (right) levels by ELISA. Data are shown as mean ± SD (n = 4). Statistical significance was analyzed by Students’ t test. *, p < 0.01 and **, p < 0.005 for p38{alpha}fl/fl vs LtrLysCre-p38{alpha}{Delta}/{Delta} mice.

 
Participation of p38{alpha} in the phagocytosis of bacteria by macrophages

In addition to producing inflammatory cytokines, phagocytosis is a major function of macrophages. Because the p38 pathway was reported to be involved in phagocytosis (38, 39, 40), we attempted to confirm whether p38{alpha} plays a role in the phagocytotic activity of macrophages. p38{alpha}fl/fl or LtrLysCre-p38{alpha}{Delta}/{Delta} macrophages were incubated with fluorescence-labeled E. coli or S. aureus, and the number of phagocytosed bacteria was counted by fluorescence microscopy. Bacterial phagocytosis activity was reduced in p38{alpha}-deficient macrophages compared with the control cells (Fig. 6A). Thus, we confirmed that p38{alpha} participates in the phagocytosis of bacteria by macrophages.


Figure 6
View larger version (25K):
[in this window]
[in a new window]

 
FIGURE 6. Phagocytotic activity and proinflammatory cytokine production of p38{alpha}fl/fl and LtrLysCre-p38{alpha}{Delta}/{Delta} macrophages incubated with bacteria. A, Peritoneal macrophages from p38{alpha}fl/fl ({blacksquare}) and LtrLysCre-p38{alpha}{Delta}/{Delta} ({square}) mice were seeded and further incubated with live fluorescein-labeled E. coli or S. aureus (macrophage to bacteria = 1/100). After incubating for the indicated times, cells were washed and fixed to count the number of phagocytosed bacteria. The phagocytosis index was calculated as the number of ingested bacteria per 100 cells. B and C, Macrophages were incubated with live E. coli or S. aureus (macrophage to bacteria = 1/100) (B) or with peptidoglycan (PGN, 10 µg/ml) (C), and culture supernatants were collected at the indicated time points for the analysis of TNF-{alpha} and IL-6 by ELISA. Data are shown as mean ± SD (n = 3). *, p < 0.05 and **, p < 0.01 for control vs p38{alpha}-deficient macrophages. Results are representative of two to four independent experiments.

 
We also investigated the production of inflammatory cytokines from bacteria-treated macrophages from LtrLysCre-p38{alpha}{Delta}/{Delta} and p38{alpha}fl/fl mice in vitro. Production of TNF-{alpha} from p38{alpha}-deficient macrophages incubated with live E. coli or S. aureus was significantly reduced compared with control cells, but IL-6 production was not or only modestly reduced (Fig. 6B). We also compared the production of inflammatory cytokines from peptidoglycan-treated macrophages and found it was similar to LPS treatment: TNF-{alpha} production was reduced in p38{alpha}-deleted cells, but that of IL-6 was only slightly affected (Fig. 6C).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Although different host receptors are used to recognize different pattern molecules from microorganisms, the downstream singling cascades of these receptors often include the same pathways, such as the NF-{kappa}B, Erk, Jnk, and p38 pathways. The p38 pathway has been implicated to be essential in inflammatory responses. Due to the embryonic lethality of p38{alpha} knockout, the role of p38{alpha} in inflammation has not been addressed using knockout mice. By using macrophage deletion, we were able to provide genetic evidence to support the role of p38{alpha} in cytokine production and phagocytosis (Figs. 1, 2, and 6). We confirmed that p38{alpha} activation is important in LPS-induced cytokine production, but also found that some cytokines such as IL-6, whose expression was believed to be controlled by the p38 pathway, was not significantly affected by p38{alpha} knockout in macrophages (Figs. 1 and 2). The defect of LPS-induced C/EBP-β and the CREB transactivation in p38{alpha} knockout macrophages indicates that the regulation of C/EBP-β and CREB by p38{alpha} is an important part of the mechanisms underlying LPS-induced gene expression in macrophages (Fig. 3).

The function of p38{alpha} has been intensively investigated in many biological systems (9, 10), and the requirement of p38{alpha} has mostly been determined by using inhibitors that simultaneously inhibit p38β, and perhaps some other enzymes (41, 42). Our data obtained by using p38{alpha}-deficient macrophages supports most published data obtained using inhibitors. Consistent with the results obtained using p38 inhibitors (8, 11, 43), expression of TNF-{alpha} and IL-12 was reduced in p38{alpha}-deficient macrophages. Although NF-{kappa}B is the key transcription factor that promotes the expression of TNF-{alpha} and IL-12, CREB and C/EBP-β also play a role (44, 45, 46, 47, 48, 49). Because of the impairment of CREB and C/EBP-β activation in p38{alpha}-deficient macrophages (Fig. 3), the reduction of LPS-induced TNF-{alpha} and IL-12 expression in p38{alpha}-deficient cells is at least in part due to a lack of p38{alpha}-mediated CREB and C/EBP-β activation. IL-18, originally identified as IFN-{gamma}-inducing factor (50, 51, 52, 53), is controlled by two distinct TATA-less promoters. LPS regulates both promoters P1 (upstream of exon 1) and P2 (in intron 1) (54). Additionally, IFN consensus sequence binding protein, AP-1, and PU.1 are known to be important for the transcription of IL-18 (55, 56). It is unclear how p38{alpha} deletion has such a significant effect on LPS-induced IL-18 expression (Fig. 2), as there is no evidence suggesting a role of p38{alpha} in regulating the aforementioned transcription factors. However, it is possible that p38{alpha}-mediated CREB and C/EBP-β activation play a role in IL-18 production, as expression of IL-18 is also dependent on the activation of p300/CREB-binding protein, a transcriptional coactivator of CREB (57), and several C/EBP-β binding sites were found in the promoter region of IL-18.

Many reports have shown that the p38 inhibitor blocked IL-6 production in several cell systems (58, 59, 60). We found that LPS-induced expression of IL-6 was only modestly affected by the deletion of p38{alpha} in macrophages (Fig. 2). This difference is unlikely to be caused by nonspecific effects of inhibitors, but rather by the cell type, as a p38 inhibitor was found to be unable to inhibit IL-6 production in PBMC (61). Expression of IL-6 was shown to be dependent of the activation of C/EBP-β in P388D1 cells (62). However, the C/EBP-β dependence of IL-6 expression appears to be cell type-dependent because LPS-induced C/EBP-β activation is impaired in p38{alpha} knockout macrophages (Fig. 3B), whereas IL-6 induction appears to be normal (Fig. 2, B and D). Expression of IL-6 can be regulated by another MAPK pathway Jnk (63), which regulates AP-1 activation (64). Both Jnk1–/– and Jnk2–/– mice showed low levels of IL-6 in response to LPS stimulation (65). The interplay among the PI3K, protein tyrosine kinase JAK2, and Jnk pathways was reported to play a role in LPS-induced IL-6 production in macrophages (66). It is clear that p38{alpha} does not affect these pathways in macrophages, as LPS-induced IL-6 expression is not significantly affected by p38{alpha} knockout (Fig. 2). Whether there are pathways other than CREB and C/EBP-β being impaired by p38{alpha} knockout needs further investigation. Because the inhibitory effect of p38{alpha} knockout acts on the level of gene expression with some cytokines and on the time of the expression of the others (Fig. 2D), there should be multiple mechanisms downstream of p38{alpha} that regulate different gene expressions.

MyD88 and TRIF are two important adaptors that mediate LPS-induced cellular activation. It was reported that LPS-induced IFN production is mediated by the TRIF-dependent signaling pathway and is independent from the MyD88-TNFR-associated factor 6 signaling cascade. TRIF recruits and activates downstream kinases I{kappa}B kinase-{epsilon} and TANK binding kinase-1, which phosphorylate IFN regulatory factor-3 to induce IFN-β and IFN-inducible genes (67). Our observation that the expression of IFN was not significantly changed in p38{alpha}-deficient macrophages is consistent with previously published studies (67).

In addition to the role in cytokine production, p38{alpha} has been shown to play a role in phagocytosis, which is a hallmark function of macrophages in host defense (38, 39, 40). Macrophages are a type of phagocytotic cell that can engulf invading bacteria, and we show that p38{alpha} deficiency in macrophages indeed significantly reduced the phagocytotic activity of the cells (Fig. 6). It was found that the fusion of the phagosomes with lysosomes or prelysosomes is accelerated by TLR-mediated p38 activation (38, 40). Our data confirmed that p38{alpha} activation plays a positive role in phagocytosis. How p38{alpha} regulates phagocytosis is not completely clear, but it could be through phosphorylation of guanine nucleotide dissociation inhibitor. Rab family protein of small GTPases are considered to be the major regulators of endocytotic traffic. Guanine nucleotide dissociation inhibitor controls the cycling of Rab5 between membrane and cytosolic forms, and it is phosphorylated by p38{alpha} to form a cytosolic Rab5-GDI complex, which increases the endocytotic traffic that results in enhanced phagocytosis (40). In addition, p38 is required for the induction of scavenger receptors, which play an important role in bacterial phagocytosis (68, 69, 70). In contrast, a study showed that p38 activation blocks the maturation of phagosomes containing mycobacteria or latex beads (39), suggesting that p38{alpha} may have different roles in phagocytosis.

In short, numerous studies have shown the involvement of p38{alpha} in inflammatory responses. Our result obtained by using macrophages lacking p38{alpha} confirms many of these findings and also demonstrates that in macrophages, p38{alpha} regulates the production of some inflammatory cytokines, but not all. Our data unambiguously show that p38{alpha} plays a role in inflammatory responses.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by Grants AI41637, AI54696 (to J.H.), and HL62311 and HL080111 (to Y.W.) from the National Institutes of Health. Back

2 Y.J.K. and J.C. contributed equally to this work. Back

3 Address correspondence and reprint requests to Dr. Jiahuai Han, Department of Immunology, The Scripps Research Institute, La Jolla, CA 92037. E-mail address: jhan{at}scripps.edu Back

4 Abbreviations used in this paper: RNA Pol II, RNA polymerase II; MK2, MAPK-activated protein kinase 2; ChIP, chromatin immunoprecipitation; CLP, cecal ligation and puncture. Back

Received for publication January 11, 2008. Accepted for publication February 3, 2008.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Akira, S., K. Takeda. 2004. Toll-like receptor signalling. Nat. Rev. Immunol. 4: 499-511. [Medline]
  2. Martinon, F., J. Tschopp. 2005. NLRs join TLRs as innate sensors of pathogens. Trends Immunol. 26: 447-454. [Medline]
  3. Beutler, B.. 2004. Inferences, questions and possibilities in Toll-like receptor signalling. Nature 430: 257-263. [Medline]
  4. Han, J., R. J. Ulevitch. 2005. Limiting inflammatory responses during activation of innate immunity. Nat. Immunol. 6: 1198-1205. [Medline]
  5. Beutler, B., E. T. Rietschel. 2003. Innate immune sensing and its roots: the story of endotoxin. Nat. Rev. Immunol. 3: 169-176. [Medline]
  6. Han, J., J.-D. Lee, L. Bibbs, R. J. Ulevitch. 1994. A MAP kinase targeted by endotoxin and hyperosmolarity in mammalian cells. Science 265: 808-811. [Abstract/Free Full Text]
  7. Han, J., J. D. Lee, P. S. Tobias, R. J. Ulevitch. 1993. Endotoxin induces rapid protein tyrosine phosphorylation in 70Z/3 cells expressing CD14. J. Biol. Chem. 268: 25009-25014. [Abstract/Free Full Text]
  8. Lee, J. C., J. T. Laydon, P. C. McDonnell, T. F. Gallagher, S. Kumar, D. Green, D. McNulty, M. J. Blumenthal, J. R. Heys, S. W. Landvatter, et al 1994. A protein kinase involved in the regulation of inflammatory cytokine biosynthesis. Nature 372: 739-746. [Medline]
  9. Ono, K., J. Han. 2000. The p38 signal transduction pathway: activation and function. Cell Signal. 12: 1-13. [Medline]
  10. Cuenda, A., S. Rousseau. 2007. p38 MAP-kinases pathway regulation, function and role in human diseases. Biochim. Biophys. Acta 1773: 1358-1375. [Medline]
  11. Kim, S. H., J. Kim, R. P. Sharma. 2004. Inhibition of p38 and ERK MAP kinases blocks endotoxin-induced nitric oxide production and differentially modulates cytokine expression. Pharmacol. Res. 49: 433-439. [Medline]
  12. Zhu, W., J. S. Downey, J. Gu, P. F. Di, H. Gram, J. Han. 2000. Regulation of TNF expression by multiple mitogen-activated protein kinase pathways. J. Immunol. 164: 6349-6358. [Abstract/Free Full Text]
  13. Perregaux, D. G., D. Dean, M. Cronan, P. Connelly, C. A. Gabel. 1995. Inhibition of interleukin-1β production by SKF86002: evidence of two sites of in vitro activity and of a time and system dependence. Mol. Pharmacol. 48: 433-422. [Abstract]
  14. Baldassare, J. J., Y. Bi, C. J. Bellone. 1999. The role of p38 mitogen-activated protein kinase in IL-1β transcription. J. Immunol. 162: 5367-5373. [Abstract/Free Full Text]
  15. Guan, Z., S. Y. Buckman, A. P. Pentland, D. J. Templeton, A. R. Morrison. 1998. Induction of cyclooxygenase-2 by the activated MEKK1 -> SEK1/MKK4 -> p38 mitogen-activated protein kinase pathway. J. Biol. Chem. 273: 12901-12908. [Abstract/Free Full Text]
  16. Badger, A. M., M. N. Cook, M. W. Lark, T. M. Newman-Tarr, B. A. Swift, A. H. Nelson, F. C. Barone, S. Kumar. 1998. SB 203580 inhibits p38 mitogen-activated protein kinase, nitric oxide production, and inducible nitric oxide synthase in bovine cartilage-derived chondrocytes. J. Immunol. 161: 467-473. [Abstract/Free Full Text]
  17. Da, S. J., B. Pierrat, J. L. Mary, W. Lesslauer. 1997. Blockade of p38 mitogen-activated protein kinase pathway inhibits inducible nitric-oxide synthase expression in mouse astrocytes. J. Biol. Chem. 272: 28373-28380. [Abstract/Free Full Text]
  18. Pietersma, A., B. C. Tilly, M. Gaestel, N. de Jong, J. C. Lee, J. F. Koster, W. Sluiter. 1997. p38 mitogen activated protein kinase regulates endothelial VCAM-1 expression at the post-transcriptional level. Biochem. Biophys. Res. Commun. 230: 44-48. [Medline]
  19. Badger, A. M., J. N. Bradbeer, B. Votta, J. C. Lee, J. L. Adams, D. E. Griswold. 1996. Pharmacological profile of SB 203580, a selective inhibitor of cytokine suppressive binding protein/p38 kinase, in animal models of arthritis, bone resorption, endotoxin shock and immune function. J. Pharmacol. Exp. Ther. 279: 1453-1461. [Abstract/Free Full Text]
  20. Adams, R. H., A. Porras, G. Alonso, M. Jones, K. Vintersten, S. Panelli, A. Valladares, L. Perez, R. Klein, A. R. Nebreda. 2000. Essential role of p38{alpha} MAP kinase in placental but not embryonic cardiovascular development. Mol. Cell 6: 109-116. [Medline]
  21. Allen, M., L. Svensson, M. Roach, J. Hambor, J. McNeish, C. A. Gabel. 2000. Deficiency of the stress kinase p38{alpha} results in embryonic lethality: characterization of the kinase dependence of stress responses of enzyme-deficient embryonic stem cells. J. Exp. Med. 191: 859-870. [Abstract/Free Full Text]
  22. Mudgett, J. S., J. Ding, L. Guh-Siesel, N. A. Chartrain, L. Yang, S. Gopal, M. M. Shen. 2000. Essential role for p38{alpha} mitogen-activated protein kinase in placental angiogenesis. Proc. Natl. Acad. Sci. USA 97: 10454-10459. [Abstract/Free Full Text]
  23. Tamura, K., T. Sudo, U. Senftleben, A. M. Dadak, R. Johnson, M. Karin. 2000. Requirement for p38{alpha} in erythropoietin expression: a role for stress kinases in erythropoiesis. Cell 102: 221-231. [Medline]
  24. Hui, L., L. Bakiri, A. Mairhorfer, N. Schweifer, C. Haslinger, L. Kenner, V. Komnenovic, H. Scheuch, H. Beug, E. F. Wagner. 2007. p38{alpha} suppresses normal and cancer cell proliferation by antagonizing the JNK-c-Jun pathway. Nat. Genet. 39: 741-749. [Medline]
  25. Ventura, J. J., S. Tenbaum, E. Perdiguero, M. Huth, C. Guerra, M. Barbacid, M. Pasparakis, A. R. Nebreda. 2007. p38{alpha} MAP kinase is essential in lung stem and progenitor cell proliferation and differentiation. Nat. Genet. 39: 750-758. [Medline]
  26. Perdiguero, E., V. Ruiz-Bonilla, L. Gresh, L. Hui, E. Ballestar, P. Sousa-Victor, B. Baeza-Raja, M. Jardí, A. Bosch-Comas, M. Esteller, et al 2007. Genetic analysis of p38 MAP kinases in myogenesis: fundamental role of p38{alpha} in abrogating myoblast proliferation. EMBO J. 26: 1245-1256. [Medline]
  27. Engel, F. B., M. Schebesta, M. T. Duong, G. Lu, S. Ren, J. B. Madwed, H. Jiang, Y. Wang, M. T. Keating. 2005. p38 MAP kinase inhibition enables proliferation of adult mammalian cardiomyocytes. Genes Dev. 19: 1175-1187. [Abstract/Free Full Text]
  28. Huang, D. Y., M. B. Prystowsky. 1996. Identification of an essential cis-element near the transcription start site for transcriptional activation of the proliferating cell nuclear antigen gene. J. Biol. Chem. 271: 1218-1225. [Abstract/Free Full Text]
  29. Kim, S. O., K. Ono, P. S. Tobias, J. Han. 2003. Orphan nuclear receptor Nur77 is involved in caspase-independent macrophage cell death. J. Exp. Med. 197: 1441-1452. [Abstract/Free Full Text]
  30. Luo, R. X., A. A. Postigo, D. C. Dean. 1998. Rb interacts with histone deacetylase to repress transcription. Cell 92: 463-473. [Medline]
  31. Hubbard, W. J., M. Choudhry, M. G. Schwacha, J. D. Kerby, L. W. Rue, III, K. I. Bland, I. H. Chaudry. 2005. Cecal ligation and puncture. Shock 24: (Suppl. 1):52-57. [Medline]
  32. Clarke, S., D. R. Greaves, L. P. Chung, P. Tree, S. Gordon. 1996. The human lysozyme promoter directs reporter gene expression to activated myelomonocytic cells in transgenic mice. Proc. Natl. Acad. Sci. USA 93: 1434-1438. [Abstract/Free Full Text]
  33. Clausen, B. E., C. Burkhardt, W. Reith, R. Renkawitz, I. Förster. 1999. Conditional gene targeting in macrophages and granulocytes using LysMcre mice. Transgenic Res. 8: 265-277. [Medline]
  34. Arthur, J. S., P. Cohen. 2000. MSK1 is required for CREB phosphorylation in response to mitogens in mouse embryonic stem cells. FEBS Lett. 482: 44-48. [Medline]
  35. Eliopoulos, A. G., C. D. Dumitru, C. C. Wang, J. Cho, P. N. Tsichlis. 2002. Induction of COX-2 by LPS in macrophages is regulated by Tpl2-dependent CREB activation signals. EMBO J. 21: 4831-4840. [Medline]
  36. Kotlyarov, A., A. Neininger, C. Schubert, R. Eckert, C. Birchmeier, H. D. Volk, M. Gaestel. 1999. MAPKAP kinase 2 is essential for LPS-induced TNF-{alpha} biosynthesis. Nat. Cell Biol. 1: 94-97. [Medline]
  37. Beutler, B., D. Greenwald, J. D. Hulmes, M. Chang, Y. C. Pan, J. Mathison, R. Ulevitch, A. Cerami. 1985. Identity of tumour necrosis factor and the macrophage-secreted factor cachectin. Nature 316: 552-554. [Medline]
  38. Blander, J. M., R. Medzhitov. 2004. Regulation of phagosome maturation by signals from toll-like receptors. Science 304: 1014-1018. [Abstract/Free Full Text]
  39. Fratti, R. A., J. Chua, V. Deretic. 2003. Induction of p38 mitogen-activated protein kinase reduces early endosome autoantigen 1 (EEA1) recruitment to phagosomal membranes. J. Biol. Chem. 278: 46961-46967. [Abstract/Free Full Text]
  40. Cavalli, V., F. Vilbois, M. Corti, M. J. Marcote, K. Tamura, M. Karin, S. Arkinstall, J. Gruenberg. 2001. The stress-induced MAP kinase p38 regulates endocytic trafficking via the GDI:Rab5 complex. Mol. Cell 7: 421-432. [Medline]
  41. Liverton, N. J., J. W. Butcher, C. F. Claiborne, D. A. Claremon, B. E. Libby, K. T. Nguyen, S. M. Pitzenberger, H. G. Selnick, G. R. Smith, A. Tebben, et al 1999. Design and synthesis of potent, selective, and orally bioavailable tetrasubstituted imidazole inhibitors of p38 mitogen-activated protein kinase. J. Med. Chem. 42: 2180-2190. [Medline]
  42. Godl, K., J. Wissing, A. Kurtenbach, P. Habenberger, S. Blencke, H. Gutbrod, K. Salassidis, M. Stein-Gerlach, A. Missio, M. Cotten, H. Daub. 2003. An efficient proteomics method to identify the cellular targets of protein kinase inhibitors. Proc. Natl. Acad. Sci. USA 100: 15434-15439. [Abstract/Free Full Text]
  43. Kim, L., R. L. Del, B. A. Butcher, T. H. Mogensen, S. R. Paludan, R. A. Flavell, E. Y. Denkers. 2005. p38 MAPK autophosphorylation drives macrophage IL-12 production during intracellular infection. J. Immunol. 174: 4178-4184. [Abstract/Free Full Text]
  44. Akira, S., H. Isshiki, T. Sugita, O. Tanabe, S. Kinoshita, Y. Nishio, T. Nakajima, T. Hirano, T. Kishimoto. 1990. A nuclear factor for IL-6 expression (NF-IL6) is a member of a C/EBP family. EMBO J. 9: 1897-1906. [Medline]
  45. Pope, R., S. Mungre, H. Liu, B. Thimmapaya. 2000. Regulation of TNF-{alpha} expression in normal macrophages: the role of C/EBPβ. Cytokine 12: 1171-1181. [Medline]
  46. Tsai, E. Y., J. V. Falvo, A. V. Tsytsykova, A. K. Barczak, A. M. Reimold, L. H. Glimcher, M. J. Fenton, D. C. Gordon, I. F. Dunn, A. E. Goldfeld. 2000. A lipopolysaccharide-specific enhancer complex involving Ets, Elk-1, Sp1, and CREB binding protein and p300 is recruited to the tumor necrosis factor {alpha} promoter in vivo. Mol. Cell Biol. 20: 6084-6094. [Abstract/Free Full Text]
  47. Roach, S. K., S. B. Lee, J. S. Schorey. 2005. Differential activation of the transcription factor cyclic AMP response element binding protein (CREB) in macrophages following infection with pathogenic and nonpathogenic mycobacteria and role for CREB in tumor necrosis factor {alpha} production. Infect. Immun. 73: 514-522. [Abstract/Free Full Text]
  48. Plevy, S. E., J. H. Gemberling, S. Hsu, A. J. Dorner, S. T. Smale. 1997. Multiple control elements mediate activation of the murine and human interleukin 12 p40 promoters: evidence of functional synergy between C/EBP and Rel proteins. Mol. Cell Biol. 17: 4572-4588. [Abstract]
  49. Becker, C., S. Wirtz, X. Ma, M. Blessing, P. R. Galle, M. F. Neurath. 2001. Regulation of IL-12 p40 promoter activity in primary human monocytes: roles of NF-{kappa}B, CCAAT/enhancer-binding protein β, and PU.1 and identification of a novel repressor element (GA-12) that responds to IL-4 and prostaglandin E2. J. Immunol. 167: 2608-2618. [Abstract/Free Full Text]
  50. Okamura, H., K. Nagata, T. Komatsu, T. Tanimoto, Y. Nukata, F. Tanabe, K. Akita, K. Torigoe, T. Okura, S. Fukuda, M. Kurimoto. 1995. A novel costimulatory factor for {gamma} interferon induction found in the livers of mice causes endotoxic shock. Infect. Immun. 63: 3966-3972. [Abstract]
  51. Stoll, S., G. Muller, M. Kurimoto, J. Saloga, T. Tanimoto, H. Yamauchi, H. Okamura, J. Knop, A. H. Enk. 1997. Production of IL-18 (IFN-{gamma}-inducing factor) messenger RNA and functional protein by murine keratinocytes. J. Immunol. 159: 298-302. [Abstract]
  52. Udagawa, N., N. J. Horwood, J. Elliott, A. Mackay, J. Owens, H. Okamura, M. Kurimoto, T. J. Chambers, T. J. Martin, M. T. Gillespie. 1997. Interleukin-18 (interferon-{gamma}-inducing factor) is produced by osteoblasts and acts via granulocyte/macrophage colony-stimulating factor and not via interferon-{gamma} to inhibit osteoclast formation. J. Exp. Med. 185: 1005-1012. [Abstract/Free Full Text]
  53. Monteleone, G., F. Trapasso, T. Parrello, L. Biancone, A. Stella, R. Iuliano, F. Luzza, A. Fusco, F. Pallone. 1999. Bioactive IL-18 expression is up-regulated in Crohn’s disease. J. Immunol. 163: 143-147. [Abstract/Free Full Text]
  54. Tone, M., S. A. Thompson, Y. Tone, P. J. Fairchild, H. Waldmann. 1997. Regulation of IL-18 (IFN-{gamma}-inducing factor) gene expression. J. Immunol. 159: 6156-6163. [Abstract]
  55. Kim, Y. M., H. S. Kang, S. G. Paik, K. H. Pyun, K. L. Anderson, B. E. Torbett, I. Choi. 1999. Roles of IFN consensus sequence binding protein and PU.1 in regulating IL-18 gene expression. J. Immunol. 163: 2000-2007. [Abstract/Free Full Text]
  56. Kim, Y. M., J. Y. Im, S. H. Han, H. S. Kang, I. Choi. 2000. IFN-{gamma} up-regulates IL-18 gene expression via IFN consensus sequence-binding protein and activator protein-1 elements in macrophages. J. Immunol. 165: 3198-3205. [Abstract/Free Full Text]
  57. Sun, H., J. Lu, X. Xu, S. Jin, X. Wang, L. Wei, M. Dong, B. Huang. 2005. Histone acetyltransferase activity of p300 enhances the activation of IL-18 promoter. J. Cell Biochem. 94: 566-572. [Medline]
  58. Hideshima, T., M. Akiyama, T. Hayashi, P. Richardson, R. Schlossman, D. Chauhan, K. C. Anderson. 2003. Targeting p38 MAPK inhibits multiple myeloma cell growth in the bone marrow milieu. Blood 101: 703-705. [Abstract/Free Full Text]
  59. Craig, R., A. Larkin, A. M. Mingo, D. J. Thuerauf, C. Andrews, P. M. McDonough, C. C. Glembotski. 2000. p38 MAPK and NF-{kappa}B collaborate to induce interleukin-6 gene expression and release: evidence for a cytoprotective autocrine signaling pathway in a cardiac myocyte model system. J. Biol. Chem. 275: 23814-23824. [Abstract/Free Full Text]
  60. Chae, H. J., S. W. Chae, H. Y. Chin, B. G. Bang, S. B. Cho, K. S. Han, S. C. Kim, K. C. Tae, K. H. Lee, D. E. Kim, et al 2001. The p38 mitogen-activated protein kinase pathway regulates interleukin-6 synthesis in response to tumor necrosis factor in osteoblasts. Bone 28: 45-53. [Medline]
  61. Horwood, N. J., T. H. Page, J. P. McDaid, C. D. Palmer, J. Campbell, T. Mahon, F. M. Brennan, D. Webster, B. M. Foxwell. 2006. Bruton’s tyrosine kinase is required for TLR2 and TLR4-induced TNF, but not IL-6, production. J. Immunol. 176: 3635-3641. [Abstract/Free Full Text]
  62. Su, W. C., H. Y. Chou, C. J. Chang, Y. M. Lee, W. H. Chen, K. H. Huang, M. Y. Lee, S. C. Lee. 2003. Differential activation of a C/EBPβ isoform by a novel redox switch may confer the lipopolysaccharide-inducible expression of interleukin-6 gene. J. Biol. Chem. 278: 51150-51158. [Abstract/Free Full Text]
  63. Ventura, J. J., N. J. Kennedy, J. A. Lamb, R. A. Flavell, R. J. Davis. 2003. c-Jun NH2-terminal kinase is essential for the regulation of AP-1 by tumor necrosis factor. Mol. Cell Biol. 23: 2871-2882. [Abstract/Free Full Text]
  64. Davis, R. J.. 2000. Signal transduction by the JNK group of MAP kinases. Cell 103: 239-252. [Medline]
  65. Morse, D., S. E. Pischke, Z. Zhou, R. J. Davis, R. A. Flavell, T. Loop, S. L. Otterbein, L. E. Otterbein, A. M. Choi. 2003. Suppression of inflammatory cytokine production by carbon monoxide involves the JNK pathway and AP-1. J. Biol. Chem. 278: 36993-36998. [Abstract/Free Full Text]
  66. Okugawa, S., Y. Ota, T. Kitazawa, K. Nakayama, S. Yanagimoto, K. Tsukada, M. Kawada, S. Kimura. 2003. Janus kinase 2 is involved in lipopolysaccharide-induced activation of macrophages. Am. J. Physiol. 285: C399-C408.
  67. Uematsu, S., S. Akira. 2007. Toll-like receptors and type I interferons. J. Biol. Chem. 282: 15319-15323. [Abstract/Free Full Text]
  68. Doyle, S. E., R. M. O’Connell, G. A. Miranda, S. A. Vaidya, E. K. Chow, P. T. Liu, S. Suzuki, N. Suzuki, R. L. Modlin, W. C. Yeh, T. F. Lane, G. Cheng. 2004. Toll-like receptors induce a phagocytic gene program through p38. J. Exp. Med. 199: 81-90. [Abstract/Free Full Text]
  69. Peiser, L., P. J. Gough, T. Kodama, S. Gordon. 2000. Macrophage class A scavenger receptor-mediated phagocytosis of Escherichia coli: role of cell heterogeneity, microbial strain, and culture conditions in vitro. Infect. Immun. 68: 1953-1963. [Abstract/Free Full Text]
  70. Thomas, C. A., Y. Li, T. Kodama, H. Suzuki, S. C. Silverstein, K. J. El. 2000. Protection from lethal Gram-positive infection by macrophage scavenger receptor-dependent phagocytosis. J. Exp. Med. 191: 147-156. [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
J. Zhu, X. Wu, S. Goel, N. M. Gowda, S. Kumar, G. Krishnegowda, G. Mishra, R. Weinberg, G. Li, M. Gaestel, et al.
MAPK-activated Protein Kinase 2 Differentially Regulates Plasmodium falciparum Glycosylphosphatidylinositol-induced Production of Tumor Necrosis Factor-{alpha} and Interleukin-12 in Macrophages
J. Biol. Chem., June 5, 2009; 284(23): 15750 - 15761.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Kwong, L. Hong, R. Liao, Q. Deng, J. Han, and P. Sun
p38{alpha} and p38{gamma} Mediate Oncogenic ras-induced Senescence through Differential Mechanisms
J. Biol. Chem., April 24, 2009; 284(17): 11237 - 11246.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Noursadeghi, J. Tsang, R. F. Miller, S. Straschewski, P. Kellam, B. M. Chain, and D. R. Katz
Genome-Wide Innate Immune Responses in HIV-1-Infected Macrophages Are Preserved Despite Attenuation of the NF-{kappa}B Activation Pathway
J. Immunol., January 1, 2009; 182(1): 319 - 328.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kang, Y. J.
Right arrow Articles by Han, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kang, Y. J.
Right arrow Articles by Han, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS