HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Le Negrate, G. Articles by Reed, J. C. Search for Related Content PubMed PubMed Citation Articles by Le Negrate, G. Articles by Reed, J. C.

Salmonella Secreted Factor L Deubiquitinase of Salmonella typhimurium Inhibits NF-B, Suppresses IB Ubiquitination and Modulates Innate Immune Responses¹

Gaëlle Le Negrate^*, Benjamin Faustin^*, Kate Welsh^*, Markus Loeffler^*, Maryla Krajewska^*, Patty Hasegawa, Sohini Mukherjee, Kim Orth, Stan Krajewski^*, Adam Godzik^*, Donald G. Guiney and John C. Reed^2,*

^* Burnham Institute for Medical Research, La Jolla, CA 92037; Department of Medicine, School of Medicine, University of California, San Diego, La Jolla, CA 92093; and Department of Molecular Biology, University of Texas Southwestern Medical Center, Dallas, TX 75390

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Salmonella enterica translocates virulent factors into host cells using type III secretion systems to promote host colonization, intracellular bacterial replication and survival, and disease pathogenesis. Among many effectors, the type III secretion system encoded in Salmonella pathogenicity island 2 translocates a Salmonella-specific protein, designated Salmonella secreted factor L (SseL), a putative virulence factor possessing deubiquitinase activity. In this study, we attempt to elucidate the mechanism and the function of SseL in vitro, in primary host macrophages and in vivo in infected mice. Expression of SseL in mammalian cells suppresses NF-B activation downstream of IB kinases and impairs IB ubiquitination and degradation, but not IB phosphorylation. Disruption of the gene encoding SseL in S. enterica serovar typhimurium increases IB degradation and ubiquitination, as well as NF-B activation in infected macrophages, compared with wild-type bacteria. Mice infected with SseL-deficient bacteria mount stronger inflammatory responses, associated with increased production of NF-B-dependent cytokines. Thus, SseL represents one of the first bacterial deubiquitinases demonstrated to modulate the host inflammatory response in vivo.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Salmonellatyphimurium infections rank among the most common bacterial diseases, ranging from self-limiting gastroenteritis (food poisoning) to severe systemic infection (typhoid fever) (1, 2, 3). Studies using mice in which specific cytokine genes have been ablated indicate that innate immune responses represent the first line of defense against S. typhimurium (4, 5, 6, 7). Both innate and adaptive immune response are regulated by the NF-B/REL family of transcription factors. In unstimulated cells, NF-B-family transcription factors exist as homo- or heterodimers bound to IB-family proteins, which typically sequester NF-B-family transcription factors in the cytosol, preventing their access to the nucleus and thereby maintaining NF-B in an inactive state (8). Degradation or proteolytic processing of IB-family proteins represents the pivotal event that triggers NF-B activation. In the canonical and the noncanonical NF-B-signaling pathway, phosphorylation and activation of IB kinases (IKK)³ β and , respectively, trigger the recruitment of the multiprotein ubiquitin ligase stem cell factor complex (SCF^β-TrCP). Activation of IKKβ leads to phosphorylation of IB, which is then ubiquitinated by SCF^β-TrCP and degraded by the 26S proteasome, allowing NF-B to enter the nucleus. In the nonclassical pathway, phosphorylated IKK recruits the SCF^β-TrCP to polyubiquitinate the NF-B precursor p100, which is then processed into the mature subunit p52-NF-B (9, 10).

Ubiquitin-dependent destruction of IB-family proteins is opposed by deubiquitinating (DUB) enzymes. CYLD and A20 are two of the best-studied DUB enzymes in mammals, which negatively regulate NF-B upstream of IKK (11, 12). Some types of pathogenic bacteria encode virulence factors that interfere with NF-B activation and ubiquitination, thus blunting signaling events involved in host defense. For example, AvrA, the bacterial effector from Salmonella, deubiquitinates IB inhibiting NF-B activation (13). The OspG protein kinase of Shigella flexneri has also been shown to bind various ubiquitin-conjugating enzymes belonging to the SCF^β-TrCP complex, and prevent phospho-IB degradation (14). Another example of a bacterial virulence factor that interferes with NF-B activation is the YopJ protein expressed in Yersinia species. YopJ is homologous to CE cysteine proteases and was reported to hydrolyze ubiquitin and SUMO (a ubiquitin-like protein) (15, 16, 17). YopJ was also shown to act as an acetyltransferase that blocks phosphorylation sites on MAPKK6 and IKKβ kinases implicated in NF-B activation (18, 19). The physiological relevance of YopJ in the pathogenic mechanism of Yersinia has been demonstrated in experiments comparing the lethality of wild-type (WT) and YopJ-deficient bacteria (20). Chlamydia trachomatis encodes two DUBs, which have been shown in vitro to hydrolyze thioester bonds that attach ubiquitin and NEDD8 (a ubiquitin-like protein) to target proteins (21). However, the role of these DUBs in the pathobiology of Chlamydia has not been established. Indeed, the cellular function of bacterial DUB remains to be elucidated.

Recently, an effector protein of Salmonella, SseL (STM2287; Salmonella secreted factor L) was shown to undergo translocation into host cytosol by the type III secretion system encoded by Salmonella pathogenicity island 2. SseL was suggested to contribute to systemic virulence during murine typhoid-like diseases (22), possibly by promoting delayed macrophage cytotoxicity (23). Additionally, SseL was recently demonstrated to have DUB activity (23) in vitro and in cells (23), but the physiological relevance of this enzymatic function in Salmonella pathogenesis was not previously elucidated. In the present study, we functionally characterized the mechanism of SseL in cultured host cells and in infected mice. Altogether, our data indicate that the DUB activity of SseL suppresses IB ubiquitination and degradation, preventing subsequent NF-B activation, and that SseL modulates host inflammatory responses in vivo during infection.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Bacteria strains and cell culture

Bacteria strains include WT Salmonella enterica serovar typhimurium LT2 and 14028s strains (provided by Dr. D. G. Guiney), and the sseL::Kan mutant lacking the STM2287 gene. Nonagitated microaerophilic bacterial cultures were grown overnight in Luria-Bertani (LB) medium (modified with 300 mM NaCl), with or without kanamycin (Kan; 25 µg/ml), and/or ampicillin (50 µg/ml). Typically, bacteria were subcultured (1:20 to 1:100 v:v) for 2–3 h in fresh medium, then washed twice in sterile PBS before being diluted into filtered (0.22 µm) LB medium for in vivo and in vitro infection experiments.

HEK293N, HEK293T, HeLa, and RAW264.7 cells were cultured in DMEM, while THP-1 cells were maintained in RPMI 1640 medium, supplemented with 10% FBS, 100 U/ml penicillin, and 100 µg/ml streptomycin. Mammalian cells were cultured at 37°C in 5% CO₂/air.

Murine macrophage cultures

Bone marrow cells were harvested from leg bones of sacrificed 8-wk-old inbred pathogen-free female BALB/c mice (Harlan Breeders). Bone marrow cells were cultured at 37°C in RPMI 1640 medium with 10% FBS. CSF-1 (10 ng/ml; Sigma-Aldrich) was added to medium for 1 wk to promote differentiation. Adherent macrophages in 100-cm² plates were used for bacterial infection and replication assays.

Plasmids

The complete open reading frame of sseL cDNA was PCR-amplified from S. typhimurium LT2 genomic DNA (American Type Culture Collection), using the primers SseL: forward (5'-GGAATTCATGAATATATGTGTAAATTCACTTTA-3') and SseL: reverse-Myc (5'-CCTCGAGTACTCGCCATTACTGGAGACT-3'), or SseL: reverse-GFP (5'-GCGTCGACTACTCGCCACTGGAGACTGT-3'). After enzymatic digestions, the resulting DNA fragments were ligated into pcDNA3myc (Invitrogen Life Technologies) or pEGFPC1 vectors (BD Clontech). DNA encoding the predicted catalytic domain of SseL corresponding to the C-terminal amino acids 211–341 was amplified from pcDNA3myc-SseL by PCR and subcloned into a modified His-tagged pET21b vector. The Cys²⁸⁵ was converted to alanine using the QuickChange site-directed mutagenesis kit (Stratagene). Authenticity of all constructs was confirmed by DNA sequencing.

To construct a sseL bacterial expression vector, the sseL open reading frame and the upstream ribosome binding site were amplified by PCR from S. enterica typhimurium strain 14028s genomic DNA using SseL/RevP1 (5'-GGAATTCACCAGGAAACAGAGCAAAATGAATAT-3'), SseL/RevP2 (5'-CCTCGAGTACTACCATTACTGGAGACTGTAT-3'). The resulting DNA fragment and pWSK29 vector were digested with EcoR1 and XhoI. After DNA purification, the amplified PCR fragment was ligated into pWSK29 to give pWSK-sseL.

Generation of Salmonella SseL mutants

S. enterica serovar typhimurium strain 14028s was used for mutant generation using the one-step gene inactivation method of Datsenko and Wanner (24). Briefly, STM2287 was replaced by a Kan-resistance gene (Kan^r) by generating PCR primers SseL/p1 (5'-CATTACATCATATTCGCTA CTTTCACTTACCAGGAAACAGAGCAAAATGAGTGTAGGCTGGA GCTGCTTCG-3'), SseL/p2 (5'-GATAAGAGCCTAATGGGATAGGCT CTAAGTACTCACCATTACTGGAGACTCATATGAATATCCTCCTT AG-3'), containing p1 and p2 FLP recognition target sites flanking the Kan^r gene of the template plasmid pDK4, and the 50-nt extensions homologous to the region flanking sseL (underlined). sseL::Kan mutants were also used for p22 phage transductions to independently generate additional Salmonella sseL::Kan mutant strains, which were selected on Kan LB plates. All experiments were confirmed with at least two independently derived sseL::Kan mutants.

To restore sseL, the sseL::Kan mutant bacteria were electroporated with pWSK-sseL plasmid and cells were selected on Kan and ampicillin LB plates. The presence of sseL was verified by PCR using sseL internal primers (CD-SseL:forward, and SseL:reverse-Myc).

Luciferase gene reporter assays

HEK293T cells were seeded into 96-well plates and transfected the next day by using Superfect transfection reagent (Qiagen), holding total DNA content constant, using pcDNA3Myc vector, as described in Ref. 25 . At 72 h posttransfection, cells were left untreated or were treated with TNF- (10 ng/ml) or IL-1β (20 ng/ml) for 6 h, and transcriptional activity was assessed 3 days after transfection. Data are expressed as fold induction relative to basal activity (mean ± SD; n = 3).

Immunoblotting, cellular fractionation, and immunoprecipitation

For immunoblotting, control and transfected HEK293N cells or RAW264.7 cells were lysed in radioimmunoprecipitation assay buffer containing 20 µg/ml NA₃VO₄, 20 µg/ml leupeptin, 20 µg/ml aprotinin, 5 mM NaF, 1 mM PMSF, 1 mM DTT, and 1x protease inhibitor mix (Roche). Clarified lysates, normalized for protein content (50 µg), were separated by SDS-PAGE (8% gels), and transferred to nitrocellulose membranes. Blots were analyzed using anti-IB (sc-371; Santa Cruz Biotechnology), anti-phospho-IB (Cell Signaling), anti-heat shock protein 60 (hsp60; Santa Cruz Biotechnology), anti-FLAG, and anti-β-actin (Sigma-Aldrich), anti-hemagglutinin (HA), and anti-Myc (Roche) Abs. Detection was accomplished using ECL (Amersham Biosciences). Polyclonal antiserum for SseL (BR-40) was generated in New Zealand rabbits using recombinant protein immunogens.

Nuclear and cytosolic extracts of HEK293T cells treated with TNF- or RAW cells infected with Salmonella strains were prepared using a kit (ActiveMotive). Cytosolic and nuclear extracts (50 µg) were submitted to SDS-PAGE/immunoblot analysis using anti-poly(ADP-ribose) polymerase (PARP; BD Pharmingen), anti-caspase-3 (AR-14), or anti-RelA (Santa Cruz Biotechnology) Abs.

For immunoprecipitations, transfected HEK293T or RAW264.7 cells were lysed in immunoprecipitation (IP) buffer (50 mM Tris-HCl (pH 7.8), 137 mM NaCl. 10 mM NaF, 1 mM EDTA, 0.2% Triton X-100, 1 mM DTT, 10%, glycerol, 1x protease inhibitor mix (Roche), 20 µg/ml Na₃VO₄, 20 µg/ml leupeptin, 1 mM PMSF, and 20 mM N-ethylmaleimide. Cell lysates (0.5 ml) were incubated with 2 µg of anti-FLAG or anti-IB mAbs prelinked to 25 µg of protein G and A Sepharose (25 µl each) for 4 h or overnight at 4°C. Samples were then washed four times, boiled in Laemmli buffer, and analyzed by SDS-PAGE/immunoblotting. Alternatively, lysates were directly analyzed by immunoblotting after normalization for total protein content. Abs used for Ag detection included anti-IB (Santa Cruz Biotechnology), anti-mono- and polyubiquitin (clone FK2; Biomol), anti-HA, and anti-c-Myc (Roche), anti-FLAG, and anti-β-actin Abs (Sigma-Aldrich).

Caspase activity and cell death assays

Caspase-3-like activity in cells transfected with pEGFPC1 or pEGFP-SseL was measured using a fluorogenic substrate Ac-DEVD-AFC (Alexis). Cells were lysed in 50 mM HEPES (pH 7.5), 150 mM NaCl, 20 mM EDTA, 1 mM PMSF, 10 µg/ml leupeptin, 10 µg/ml aprotinin, and 0.25% Triton X-100. After centrifugation (16, 000 x g, 15 min), equal amounts of supernatants (normalized for protein content) were mixed in 100-µl final volume, in buffer 50 mM HEPES (pH 7.4), 100 mM NaCl, 1 mM EDTA, 10% sucrose, 0.5% CHAPS, 5 mM DTT. A total of 100 µM Ac-DEVD-AFC substrate was added at 100 µM and substrate cleavage was monitored continuously by spectrofluorometry (Fluorolite 1000; Dynatech Laboratories), reporting data as relative fluorescence units/min/50 µg of total protein.

Cell death of control and infected RAW264.7 cells was detected by staining with trypan blue (0.1% (w/v) in DMEM medium; Sigma-Aldrich). Cells were counted using a hemocytometer to determine the ratio of dead to live cells (n 100 cells per determination).

Measurement of p65 nuclear translocation and p65 DNA-binding activity

Nuclear p65 translocation was monitored in HEK293N cells grown in 100-cm² plates, transfected with 10 µg of DNA, then cultured with or without TNF- for various times. Relative amounts of p65 DNA-binding activity were also measured from RAW264.7 cells or primary macrophages before or at various times after bacterial infection. Nuclear extracts were prepared using a kit (ActiveMotive), and relative amounts of p65 protein in nuclear extracts were quantified by ELISA, according to the manufacturer’s instructions (p65 ActivELISA; Imgenex). Data were normalized for cell number and assays performed in triplicate. The specificity of the assay was verified by adding excess DNA containing the p65-binding site as a competitor for NF-B (data not shown), subtracting noncompetitive binding from values.

Expression and purification of SseL catalytic domain

SseL (179–341) and the corresponding SseL (C285A) mutant cloned into pET21b were expressed in Escherichia coli (BL21 (DE3) RP), and purified by liquid chromatography using Ni-NTA agarose (Qiagen) followed by mono-Q, then concentrated with buffer exchange on an Amicon Ultra filtration apparatus (molecular mass of 10,000 Da). The proteins were exchanged into 50 mM Tris (pH 8.0), 1 mM DTT. Both proteins were obtained with 90–95% of purity, as determined by SDS-PAGE gel stained with Gelcode Blue (Pierce). Gel filtration using Superdex 200 suggests that SseL (211–341) has a monomeric structure.

Ubiquitin protease assays

Purified SseL WT or C285A catalytic domains, or human rSENP8 were incubated with ubiquitin-7-amino-4-methylcoumarin (ubiquitin-AMC), small ubiquitin-related modifier (SUMO)-AMC, or neural precursor cell-expressed developmentally down-regulated 8 (NEDD8)-AMC with or without addition of 8 µM ubiquitin-aldehyde (Boston Biochem) in 20 mM HEPES-KOH (pH 7.5) and 1 mM DTT. The resulting liberated fluorogenic AMC was measured continuously at 23°C for 1 h using an Analyst HT fluorometer. Relative fluorescence units were converted to picomoles of AMC using a standard curve of relative fluorescence units vs AMC concentration. We assume that 100% of purified SseL catalytic domain was active. K_m and V_max were determined using a nonlinear regression method to fit the Michaelis-Menten equation: V = (V_max – V₀)(S)/(K_m + (S)) + V₀, where V = initial catalytic rate, in nanomoles of AMC per minute; (S) = concentration of the substrate in nanomoles or micromoles; V₀ = limiting value of V without (S); V_max = a limiting value of V at sufficient high or saturating (S). The fitting procedure was performed using PRISM software.

Bacterial infection of RAW 264.7 and bone marrow murine macrophages

RAW 264.7 cells were seeded at 3.5 x 10⁶ cells, and murine macrophages at 8 x 10⁶ cells in 100-mm dishes, then infected 24 h or 7 days later, respectively. Bacterial invasion and intracellular replication assays were performed as previously described (25).

Bacterial infection of mice

A streptomycin pretreatment model was used using inbred pathogen-free female BALB/c mice (Harlan Breeders) at 8–10 wk age as described in Ref. 26 . Animals were euthanized by i.p. injection of 1 ml of avertin (BD Biosciences) at various times postinfection (p.i.). Organs were harvested aseptically for histological examination and colony counts. All animal experiments were conducted according to local animal care advisory committee guidelines.

Determination of TNF-, IL-12p70, and IL-1β levels in serum and supernatant

Serum was collected from mice 4 and 9 days postinfection. Supernatants of infected RAW264.7 cells infected with various Salmonella strains were collected at various times p.i. Cytokines levels were measured by ELISA kits from eBioscience, according to the manufacturer’s protocol. Three mice were used per condition, and each sample was measured in duplicate expressing results as means ± SE.

Histopathology

At various days p.i., spleens, livers, and intestine from infected and control animals were fixed in zinc-buffered formalin (Z-fix; Anatech), and embedded in paraffin. Organs were then sectioned at 0.5 mm, stained with H&E, and analyzed blindly. The pathological scores were quantified by an established method (26), averaging six fields per sample, based on variables of polymorphonuclear neutrophil (PMN) infiltration into various locations, including gut lumen (scant, 2; moderate, 3; dense, 4), intestinal surface epithelium (yes, 1; no, 0), submucosa (no extravascular PMN = 0; single extravascular PMN = 1; PMN aggregates = 2). Statistical analysis was performed by comparing total pathological scores using Mann-Whitney U and Kruskall-Wallis nonparametric tests. Values of p < 0.05 were considered as statistically significant.

	Results

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
SseL prevents NF-B activation downstream of IKK complex

The bacterial virulence-associated effector proteins YopJ and AvrA inhibit the innate immune response by suppressing NF-B signaling pathways upstream and downstream of the IKK complex, respectively (15, 27). By analogy to these bacterial proteins, we hypothesized that SseL may also inhibit NF-B activity, through its DUB activity. To explore this possibility, we first performed NF-B reporter gene assays using HEK293T cells transfected with plasmids encoding SseL or SseL C285A (SseL C/A), in which the predicted active site cysteine was mutated to alanine. Cells were cotransfected, with a luciferase reporter gene plasmid containing NF-B-binding sites within its promoter. SseL significantly inhibited NF-B activity stimulated by treatment of cells with TNF- and IL-1β cytokines, while SseL C285A did not (Fig. 1, A and B, and data not shown). NF-B activity was also inhibited by SseL when induced by transfection of a constitutively active LPS receptor TLR4 (CD4:TLR4 fusion protein) (Fig. 1B). As expected, YopJ suppressed TLR4-mediated NF-B activity (Fig. 1B). Expression of SseL suppressed NF-B activity induced by adapter proteins (MyD88, TNFR-associated factor (TRAF) 2, TRAF6) that link either TNFRs or TLR/IL-1Rs to downstream kinases involved in NF-B induction (Fig. 1, B and C). SseL also suppressed NF-B reporter gene induction stimulated by transfection of HEK293T cells with Bcl-10, involved in Ag receptor signaling (28), Cardiak (receptor-interacting protein 2) involved in NOD/nucleotide-binding domain-rich repeat containing signaling, and CD40, a TNF-family receptor that stimulates both classical and nonclassical pathways for NF-B induction (29) (Fig. 1, B–D). Thus, SseL appears to operate at a downstream point of convergence of diverse NF-B activation pathways.

View larger version (31K): [in this window] [in a new window]   FIGURE 1. SseL inhibits NF-B activation downstream of the IKK complex and upstream of p65 and p52 NF-B. A, HEK293T cells were transfected with empty vector (200 ng), or plasmids encoding SseL or SseL C285A mutant (SseL C/A). NF-B activity induced by TNF- was monitored by gene reporter assays (mean ± SD; n = 3). B, NF-B activity was also induced by transfecting HEK293N cells with expression plasmids (200–300 ng) encoding CD4/TLR4 or MyD88, in combination with empty vector (200 ng) or plasmids encoding SseL or YopJ. Cells transfected with IL-1R1-encoding plasmid or empty vector were cultured with IL-1β. B–F, To map the site of inhibition within the NF-B pathway, similar transfection experiments were conducted using expression plasmids encoding Bcl-10 (B), TRAF6, Cardiak, TRAF2 (C), CD40 (D), IKKβ, IKK (E), or p65 and p52 (F). G, β-Catenin transcriptional activity was induced by cotransfecting a β-catenin-luc reporter gene plasmid (100 ng) and β-catenin-encoding plasmid (500 ng) with plasmids encoding either SseL or YopJ or pcDNA3Myc, holding total transfected DNA at 1 µg. H, Expression of transfected TRAF2, TRAF6, Cardiak, IKKβ, IKK, and SseL-Myc was verified after cotransfection with SseL plasmid or pcDNA3Myc by immunoblotting (C–, untransfected cells). Arrowheads and asterisks denote specific and nonspecific bands, respectively.

Reporter gene assays of NF-B activity were then confirmed using other methods. Upon degradation of IB-family proteins, NF-B enters the nucleus. We therefore anticipated that expression of SseL in cells would inhibit nuclear entry of NF-B. Accordingly, relative levels of nuclear NF-B (p65 Rel-A subunit) were assessed before and after TNF- stimulation in control or SseL-expressing cells by immunoblot analysis of nuclear extracts. In control-transfected cells, TNF- induced a striking increase in the relative amount of nuclear p65-RelA compared with unstimulated cells (Fig. 2A). In contrast, levels of nuclear p65-RelA were unchanged in SseL-expressing cells after TNF- simulation. Probing the blots with Abs to nuclear (PARP) and cytosolic (caspase-3) marker proteins confirmed successful cell fractionation. Analysis of the cytosolic fraction showed similar levels of RelA in all samples, implying that most of the total cellular pool of RelA remained cytosolic under the conditions of these TNF- stimulation experiments. The ability of SseL to suppress nuclear import of RelA was also examined by an ELISA method using nuclear fractions from SseL- and control-transfected cells, before vs after TNF- stimulation (Fig. 2B), thereby independently confirming the results obtained by immunoblotting.

View larger version (12K): [in this window] [in a new window]   FIGURE 2. SseL inhibits RelA nuclear translocation upon TNF- stimulation. A, HEK293N cells were cotransfected with empty vector (–) or SseL plasmid (+). At 48 h posttransfection, cells were treated with TNF- (10 ng/ml) for 6 h. Nuclear and cytosolic extracts were subjected to immunoblot analysis with Abs specific for RelA, caspase-3, and PARP (as markers of cytosolic and nucleus extracts, respectively). B, Alternatively, nuclear extracts were analyzed by ELISA for RelA protein (mean ± SD; n = 3) (data are representative of several experiments; n 3).

The profile-profile algorithm FFAS03 matched the C-terminal 200 aa of SseL to a family of Ulp1 proteases and to other proteins from the sentrin-specific protease family with high confidence (Z score of 14.0, corresponding to a false-positive rate of <1%) (23). In addition, SseL was recently reported to be a cysteine protease, which hydrolyzes synthetic substrate ubiquitin-AMC, and branched ubiquitin polymers (23). Because the active site was predicted by three-dimensional modeling to include cysteine 285, we expressed in bacteria and purified the predicted catalytic domain of SseL (279–341) (CD-SseL), and C285A mutant (CD-SseL C/A), then tested the activity of these proteins using in vitro DUB assays. CD-SseL and CD-SseL C285A were incubated with ubiquitin-AMC substrate for 1 h to measure the release of AMC. Michaelis-Menten kinetics analysis performed using CD-SseL revealed a first-order kinetic behavior of the SseL catalytic domain, with apparent K_m for the ubiquitin-AMC substrate of 10.1 ± 1.0 µM (Fig. 3A). The catalytic efficiency (k_c/K_m) of CD-SseL was estimated at 102.1 M^–1 x s^–1, whereas the CD-SseL C285A mutant was inactive in these assays (Fig. 3A). As a positive control for DUB activity, isopeptidase T was also incubated with ubiquitin-AMC (Fig. 3B). The specificity of the proteolytic activity of SseL was further tested by submitting purified CD-SseL to deSUMOylation and deNEDDylation assays, using SUMO-AMC and NEDD8-AMC substrates. CD-SseL did not display hydrolase activity against either SUMO or NEDD8 (Fig. 3, C and D), whereas NEDD8-AMC was hydrolyzed by SENP8, used as positive control. Because YopJ was originally suggested to have DUB activity (16), but subsequently shown to be an acetyltransferase (18, 19), we also tested our preparation of SseL catalytic domain but detected no acetyltransferase activity (data not shown). Altogether, these data confirm that SseL has an intrinsic and specific DUB activity, and this activity is dependent on cysteine 285.

View larger version (30K): [in this window] [in a new window]   FIGURE 3. SseL catalytic domain cleaves ubiquitin-AMC in vitro. A, Michaelis-Menten analysis of SseL catalytic domain (CD-SseL) activity was performed by incubating CD-SseL or CD-SseL C285A (CD-SseL C/A) (3.6 µM) with increasing amounts of ubiquitin-AMC for 1 h, and measuring hydrolysis of ubiquitin-AMC continuously to determine the values for kcat, Km, and Vmax, as indicated (a representative experiment is shown; n 3). B, Various concentrations of isopeptidase T were incubated with ubiquitin-AMC (20 µM) (Ub-AMC) as positive control for deubiquitinating activity, or with ubiquitin-AMC and ubiquitin-aldehyde (8 µM) (Ub-Ald) or with SUMO-1-AMC (20 µM) to verify the specific deubiquitin activity of isopeptidase T. C, Various concentrations of CD-SseL were incubated with ubiquitin-AMC (20 µM) or SUMO-AMC (20 µM) as described above to verify the specificity of the enzymatic activity of CD-SseL. D, Logarithmic dilutions of purified CD-SseL and SENP8 (used as positive control for specific deNEDDylation activity) were incubated with NEDD8-AMC (3 µM) as substrate and deNEDDylation activity was measured by the release of fluorescent AMC (mean ± SEM; n = 3). Specific de-NEDDylation activity was verified by adding NEDD8-aldehyde (NEDD8-Ald) (8 µM) (data are representative of several experiments; n 3).

SseL impairs IB degradation and ubiquitination

The principal substrate of the IKK complex is IB, which becomes ubiquitinated following phosphorylation and then degraded by the proteasome, allowing p65/p50 NF-B heterodimers to translocate into the nucleus and mediate NF-B activity. Because the reporter gene assay results indicating that SseL inhibits NF-B at or distal to IKK complex, we hypothesized that SseL opposes IB ubiquitination, thus inhibiting its proteasome-mediated degradation. To test this hypothesis, we first compared IB levels by immunoblot analysis in HEK293T cells cotransfected with plasmids encoding IB and either SseL or SseL C285A (or empty control plasmid), then stimulated cells with TNF- to induce IB degradation. In control cells, TNF- induced a rapid decline in IB levels, decreasing to just barely detectable levels within 45 min. By comparison, in SseL-expressing cells, IB levels remained essentially unchanged throughout the time-course of TNF- stimulation evaluated. Mutation of cysteine 285 abolished this effect (Fig. 4A). Expression of SseL did not affect phosphorylation of IB. In both control- and SseL-transfected cells, TNF--induced phosphorylation of IB with a peak of phosphorylation seen at 10–20 min following TNF- stimulation (Fig. 4A). We conclude therefore that SseL impairs cytokine-induced IB degradation but not phosphorylation.

View larger version (65K): [in this window] [in a new window]   FIGURE 4. SseL inhibits NF-B downstream of the IKK complex by impairing IB degradation and ubiquitination. A, IB degradation is impaired by SseL expression. HEK293T cells were cotransfected with a plasmid encoding IB in combination with SseL or SseL C285A mutant-encoding (SseL C/A) plasmid or with pcDNA3Myc empty vector for 24 h before TNF- stimulation (30 ng/ml). Cell lysates were subjected to immunoblot analysis with Abs recognizing IB (top) or phospho-IB (middle). Membranes were reprobed using Abs to hsp60 for loading control (bottom). B, SseL expression inhibits IB ubiquitination. HEK293T cells were cotransfected as described above, and treated with TNF- (30 ng/ml) (left). Cell lysates normalized for protein content were IP using anti-FLAG mAbs. Immunoprecipitates or cell lysates were analyzed by immunoblotting (IB) using Abs to FLAG epitope (top), ubiquitin (second and fourth panels), and IB (third panel). As specificity controls for the experiment, HEK293T cells were transfected with plasmids encoding FLAG-tagged IB (lanes 1, 2) or untagged IB (lane 3). Immunoprecipitates were performed using anti-FLAG (lanes 1, 3) or a control IgG Ab (lane 2). IPs and lysates were analyzed by immunoblotting. Arrowheads and asterisks denote specific and nonspecific bands, respectively. Expression of SseL-Myc and equivalent protein loading were verified by immunoblotting using anti-Myc and anti-β-actin mAbs, respectively (data not shown). Representative experiments are shown; n 3.

Activation of the canonical NF-B pathway often requires Lys⁶³ polyubiquitination of TRAF2 and TRAF6 to mediate their activation of kinases leading to IB degradation (32). To determine whether SseL expression also targets other ubiquitination events acting upstream of IB, we assessed the effect of SseL expression on the expression and ubiquitination of TRAF2 and TRAF6. Expression of SseL did not reduce expression or polyubiquitination of TRAF2 or TRAF6 (Fig. 5). These results therefore suggest a specific effect of SseL on IB ubiquitination.

View larger version (51K): [in this window] [in a new window]   FIGURE 5. SseL does not deubiquitinate TRAF2 or TRAF6. A, SseL-Myc, ubiquitin-FLAG and TRAF2-HA or empty vectors were cotransfected into HEK293T cells after 24 h, cells were treated with TNF- (30 ng/ml) for 30 min and cell lysates were normalized for protein content before performing immunoprecipitations using anti-HA mAbs (IP-HA). Immunoprecipitates (IPs) were then subjected to immunoblots (IB) using anti-HA and anti-FLAG specific Abs to assess the expression and the ubiquitination of TRAF2, respectively. Expression of ubiquitin-FLAG and SseL-Myc was verified by immunoblotting of total lysates (Lysates) using anti-FLAG and anti-Myc mAbs, respectively. B, At 24 h posttransfection with the indicated plasmids or empty vectors, cells were treated with MG132 (40 µM) for 1 h. Cell lysates were immunoprecipitated using anti-HA mAbs (IP-HA). Immunoprecipitates (IP-HA) were immunoblotted with anti-HA- and anti-FLAG-specific Abs to verify the expression and the ubiquitination of TRAF6, respectively. Transfected ubiquitin-FLAG and SseL-Myc levels were verified by immunoblots with anti-FLAG and anti-Myc Abs, respectively. Equivalent protein loading was verified by immunoblotting using anti-β-actin mAbs (data not shown). Data are representative of several experiments (n 3). Asterisks denote nonspecific bands. Arrow indicates HA-tagged TRAFs.

SseL deficiency increases IB degradation and NF-B activation in Salmonella-infected macrophages

To delineate the physiological relevance of SseL in Salmonella pathogenesis, we generated a nonpolar, in frame deletion of sseL in S. enterica serotype typhimurium (sseL), in which the sseL gene was replaced with a Kan^r cassette using the "Red Swap" method (24). Loss of the allele and replacement by Kan^r gene were verified by PCR using gene-specific primers (Fig. 6A), and independent phage p22 transductants were selected for further study. Ablation of the gene encoding SseL did not alter the growth properties of S. typhimurium in either rich or nutrient-poor media (data not shown), indicating that SseL is not required for bacterial growth. Ablation of sseL did not impair the ability of S. typhimurium to invade and replicate in macrophages (Fig. 6B), despite the observation that SseL expression is induced upon exposure to macrophages (Fig. 6C) (22).

View larger version (32K): [in this window] [in a new window]   FIGURE 6. Ablation of sseL does not impair survival and replication of Salmonella in macrophages. A, Generation of sseL mutant Salmonella strains. Salmonella sseL mutant colonies were generated and analyzed for sseL disruption and for Kanr expression by PCR; C–: negative control; C+: S. typhimurium WT genomic DNA. B, Expression of SseL in RAW264.7 cells infected with S. typhimurium but not sseL mutant Salmonella was verified by immunoprecipitation followed by immunoblotting using polyclonal antiserum directed against SseL, after normalization of lysates for protein contents (a representative experiment is shown; n 3). C, S. typhimurium 14028 WT, and sseL were used to infect RAW264.7 cells (m.o.i. = 10), and the numbers of intracellular CFU were assessed at various times postinfection (p.i.) (a representative experiment is shown; mean ± SEM; n 3).

View larger version (37K): [in this window] [in a new window]   FIGURE 7. Ablation of sseL increases IB degradation and NF-B activation in macrophages. A, Lysates of RAW264.7 cells infected with WT or sseL bacteria (m.o.i. = 5) for the indicated times were analyzed for IB and β-actin (loading control) expression by immunoblotting. B, Presence of the sseL gene in WT, sseL mutant, and reconstituted sseL+pWSK-sseL bacteria (sseL bacteria transformed with pWSK-sseL plasmid) was determined by PCR. C, Murine primary macrophages were infected with WT, sseL, or sseL+pWSK-sseL bacteria (m.o.i. = 5), and the amount of p65 bound to the DNA probe in nuclear extracts was monitored by ELISA, expressing data as OD 450 mean values (mean of ± SD, n = 3). (Data are representative of several experiments; n 3). D, RAW264.7 cell were infected with WT, sseL or sseL+pWSK-sseL bacteria (m.o.i. = 10), and levels of IL-1β in the supernatant were measured by ELISA at the indicated times p.i. (mean ± SD; n = 3). E, RAW264.7 cells were infected as in D and percentages of dead cells were assessed by trypan blue exclusion test (mean ± SD; n = 3 separate experiments).

In addition to NF-B activity, we also observed a 2fold increase in production of an NF-B-dependent cytokine IL-1β in the supernatant of RAW264.7 cells infected with sseL strain vs WT or sseL plus pWSK-sseL Salmonella strains (Fig. 7D). These results thus provide additional confirmation of the inhibitory effect of SseL on NF-B activity in the context of Salmonella infection.

In addition to measuring nuclear NF-B DNA-binding activity and levels of NF-B-dependent cytokine, immunoblot analysis of RelA in cytosolic vs nuclear fractions also showed a difference between macrophages infected with WT vs sseL bacteria, such that 63–67% less RelA remained in the cytosol and 21–32% more RelA accumulated in the nuclei of cells infected with sseL bacteria (as determined by scanning densitometry, data not shown). Results were confirmed using several sseL strains obtained by independent p22 phage transduction (data not shown).

To explore whether the effect of the sseL mutant on IB expression and NF-B activity might be secondary to cytoxicity mediated by Salmonella infection, we measured cell death in RAW264.7 macrophages infected with WT, sseL, or sseL plus pWSK-sseL Salmonella strains. At each time point measured p.i. (8, 12, and 24 h), SseL-expressing Salmonella strains induced only 10% more cell death than sseL bacteria (Fig. 7E), suggesting that a difference in cell viability cannot account for the effects on NF-B and IB.

SseL deficiency increases IB degradation and ubiquitination in Salmonella-infected macrophages

Next, the effects of WT and sseL bacteria were compared with respect to IB ubiquitination in infected primary murine macrophages. Compared with WT Salmonella, sseL bacteria infection led to increased IB degradation and ubiquitination in infected cells, as shown by IB protein expression (measured by immunoblotting) and ubiquitination (determined by immunoprecipitation of IB, followed by immunoblot analysis with anti-ubiquitin Ab). In contrast, introduction in trans of sseL in sseL mutant bacteria (sseL plus pWSK-sseL) restored IB expression and ubiquitination to the same levels seen in WT-infected cells (Fig. 8). These genetic complementation experiments therefore also verify in infected primary macrophages that SseL is directly responsible for IB stabilization and deubiquitination in the context of Salmonella infection.

View larger version (52K): [in this window] [in a new window]   FIGURE 8. SseL prevents IB degradation and ubiquitination in infected mouse primary macrophages. Murine primary macrophages were infected with WT, sseL, or sseL+pWSK-sseL bacteria (m.o.i = 5), for 30 min. Cells remained untreated for negative control (Ctl–) or were treated with TNF- 30 min (30 ng/ml) for positive control (Ctl+). Cell lysates were normalized for protein contents and subjected to IP using anti-IB mAbs. IB expression levels and ubiquitination status were analyzed from the immunoprecipitates and from the lysates by immunoblotting (IB) using anti-IB, anti-ubiquitin mAbs, respectively. Probing with anti-β-actin mAbs served as a loading control. Data are representative of several experiments (n 3).

We used a mouse model to investigate the role of SseL in enteric salmonellosis (33, 34). First, the lethal dose of S. typhimurium 14028s was determined in BALB/c mice by orally injecting serial dilutions of bacteria. Because inoculation of 10⁴ WT bacteria induced 100% death by 5 days, mice were orally infected with 2 x 10³ WT or sseL S. typhimurium 14028s WT bacteria, and animals were sacrificed from days 3 to 9 p.i. Bacterial migration into liver and spleen after oral administration was comparable for both WT and sseL S. typhimurium strains, based on CFUs recovered from serial dilutions of organ lysates on LB plates (Fig. 9A). Histological analysis of internal organs revealed extensive inflammatory changes in the terminal ileum, cecum, and colon of both groups of mice, similar to those previously reported (33). However, clear differences in the host reactions to WT vs sseL bacteria were noted. At 4 days p.i., livers of mice infected with sseL bacteria displayed 4-fold more granulomas than livers from mice exposed to WT bacteria (Fig. 9B, a and b, and C). Similarly, the spleens of mice infected with sseL bacteria revealed the presence of granulomas, whereas these lesions were not detected at this stage of infection in the spleens of mice infected with WT bacteria (Fig. 9B, c and d).

View larger version (87K): [in this window] [in a new window]   FIGURE 9. Inactivation of sseL increases inflammatory response to Salmonella in mice. A, Bacterial enumeration in infected livers and spleens 4 and 9 days p.i. Streptomycin-treated mice were infected orally with 2 x 103 WT or sseL mutant bacteria. At 4 and 9 days p.i., organs were harvested aseptically for colony counts, and organ lysates were diluted before plating on selective LB plates. Bars indicate geometric means (a representative experiment is shown; n 3). B, Mice were infected with WT or sseL mutant bacteria and tissues scored for inflammation as described in Materials and Methods. Livers from WT-infected mice display fewer granulomas (a, arrows) than sseL mutant (b). Spleens from sseL-infected mice display numerous granulomatous lesions in the red pulp area (d, arrows), whereas they were not detected in the WT-infected mice (c). C, Average numbers of granulomas in liver per microscopy field and per group of mice (mean ± SD; n = 3). Original magnification is indicated (x200 or x400).

View larger version (23K): [in this window] [in a new window]   FIGURE 10. sseL S. typhimurium induces greater PMN infiltration and faster lethality than WT bacteria in mice. A, Intestines from four mice (per group) were harvested and processed for histopathology. Each bar represents a single mouse. Statistical significance was determined by Mann-Whitney U test (p 0.01) using total scores. B, Mice were left untreated (Ctl) or infected with WT or sseL mutant bacteria and serum samples were collected 4 and 9 days p.i. to measure levels of IL-12 p70, TNF-, and IL-1β by ELISA. C, Mice (10 per group) were infected with WT and sseL bacteria, then animal survival was monitored daily. Control animals infected with streptomycin and LB medium show 100% survival. Data shown are representative of several experiments (n 3).

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Because NF-B pathways make key contributions to host defense mechanisms, the activation of NF-B is tightly controlled by endogenous regulators acting at several sites. Ubiquitination regulates at least four steps in NF-B pathways, including targeting IB for degradation, processing of NF-B precursors to produce p50/p52 subunits of NF-B, and activation of kinases such as receptor-interacting protein or the regulatory subunit of the IKK complex IKK (NEMO) and activation of TRAF-family adapter proteins (TRAF2, TRAF6) (9, 35, 36). Ubiquitin is a 76-aa protein that is covalently attached to target proteins through an isopeptide bond, between the C terminus of ubiquitin and the -amino group of a lysine residue in the target proteins (9, 37). Ubiquitin contains seven lysine residues, but ubiquitin chains linked on Lys⁴⁸ and Lys⁶³ are the best characterized, to date. Whereas Lys⁴⁸-linked polyubiquitin chains represent a signal for proteosomal degradation of modified substrates such as IB, Lys⁶³-linked polyubiquitination acts as scaffolds to assemble signaling complexes and regulates protein localization, protein kinase activation, DNA repair, or transcription through proteasome-independent mechanisms (38, 39). However, both Lys⁴⁸- and Lys⁶³-mediated ubiquitination play roles in regulating NF-B activity (10, 35, 38, 40).

Several examples have been elucidated whereby pathogens inhibit or limit the duration of NF-B activation, thus blunting host responses. Many animal and plant pathogenic bacteria use type III and/or IV secretion systems to inject effector proteins into host cells, where they subvert host signaling cascades, such as ubiquitination and/or NF-B activation (41, 42). For example, the Yersinia type III effector protein YopJ, blocks signaling of the MAPK kinase and NF-B pathways by acetylating and/or deubiquitinating host MAPK kinases and NF-B-signaling kinases (TRAF6), thereby inactivating innate immune pathways (16, 17, 18, 19). The Salmonella AvrA protein and AopP, a recently identified secreted effector from Aeromonas salmonicida (spp. Salmonicida), were also shown to inhibit activation of NF-B downstream of IKKβ (27, 43). AvrA has recently been characterized as a DUB that removes ubiquitin from IB and β-catenin, thereby preventing their degradation and subsequent NF-B activation (13).

Here, we provide evidence that SseL, a recently identified DUB produced by S. enterica serovar typhimurium (23), inhibits cellular NF-B activity and impairs IB degradation and ubiquitination, thus suppressing multiple upstream signaling pathways that converge on IB to induce NF-B activation. SseL is an Salmonella pathogenicity island 2 effector encoded by the regulatory system ssrB and translocated into host cells by the type III secretion system during infection (22). Additionally, the amino acid primary sequence of SseL shows similarities with known DUBs in yeast (Ulp1), Chlamydia trachomatis (ChlaDUB1), human adenovirus L3, and Homo sapiens (SENP1) (23).

Our enzymatic analysis demonstrated that the catalytic domain of purified SseL possesses intrinsic deubiquitinating activity, requiring Cys²⁸⁵, as previously shown but reported as Cys²⁶² by Rytkonen et al. (23) due to a difference in assignment of the N terminus of the SseL protein deduced from genomic sequencing. We measured a K_m of 10 µM for the ubiquitin substrate, using the purified catalytic domain of SseL, compared with 1.5 µM reported by others for the full-length protein (23). This difference suggests the conserved 140 aa N-terminal domain of SseL makes contributions to the catalytic efficiency of this bacterial protease. The specificity of SseL appears to be highly selective for ubiquitin, as other substrates containing ubiquitin-related molecules, NEDD8 and SUMO, were not cleaved. The previous report by Rytkonen et al. (23) characterized the DUB activity of the full-length SseL in vitro and in cells, finding higher activity against Lys63-linked ubiquitin chains compared with Lys⁴⁸. In contrast, we observed inhibitory effects of SseL on ubiquitinylation of IB (predominantly Lys⁴⁸ ubiquitinylation) but not TRAF2 or TRAF6 (predominantly Lys⁶³). Thus, our findings favor a role for SseL in hydrolysis of Lys⁴⁸-linked ubiquitin chains, but do not exclude a role also for Lys⁶³-conjugated substrates.

Our results directly link the DUB activity of SseL to suppression of IB ubiquitination and degradation in epithelial cells and macrophages, showing that cysteine 285 is required for DUB activity and for the effects on NF-B activity. The modulation of NF-B activity by SseL was detected by expressing SseL in HEK293T cells by transfection, and also in RAW264.7 cells and primary cultured mouse macrophages by infection with WT and sseL-deficient Salmonella strains. These findings contrast with a previous report using J774 murine macrophage cells, which failed to detect effects of SseL deficiency on IB levels, and which found only a slight increase in production of NF-B-inducible cytokine TNF- in J774 cultures following cell infection with WT vs sseL-deficient strains (23). However, those studies did not directly measure NF-B activity. Additionally, theses differences could be due to the peculiarities of the transformed cell lines used and technical differences related to culture conditions, reagents, and the multiplicity of infection (m.o.i.) used. Unlike a prior report (23), we observed only a slight cytotoxic effect of SseL in infected RAW264.7 macrophages. This cytotoxic effect was evident at later stages of infection and did not account for the inhibition of IB degradation and NF-B activity reported here.

When produced in HEK293T cells, SseL prevents phospho-IB degradation and ubiquitination triggered by TNF- stimulation. Moreover, from comparisons of WT and sseL Salmonella in macrophage infection experiments, we deduced that SseL stabilizes IB expression. Thus, based on the data presented here, and on the observation that SseL binds mono- and polyubiquitinated proteins (23), we propose that SseL may bind ubiquitinated IB after its phosphorylation, removing ubiquitin conjugates, and preventing IB recognition and degradation by the 26S proteasome, thereby limiting NF-B activation.

A role for SseL in interfering with activation of NF-B in vivo is also supported by the observation that the inflammatory response induced upon infection was more severe with the sseL mutant than with the WT Salmonella strain. The elevated inflammatory response included PMN infiltration into intestinal tissues, granulomatous lesions in the liver, increased production of NF-B-inducible cytokines in the serum, and more rapid death. These findings were confirmed using at least two independently derived sseL mutant clones.

The increased rate of demise of mice infected with sseL suggests that the inflammatory response to the pathogen contributes to lethality, particularly because little difference was observed in bacterial colonization of liver and spleen in vivo, and measurement of bacterial invasion and growth in macrophages in culture were also similar. In fact, using more sensitive competition experiments where knockout and WT bacteria are coinoculated into mice, it was recently suggested that sseL bacteria have a slight competitive disadvantage with respect to early in vivo dissemination (22). Thus, the inability to inhibit NF-B seems to have rendered SseL-deficient Salmonella more virulent, as defined by lethality in mice.

In both intestinal and systemic forms of Salmonella infection, there is a clear selective advantage for bacteria to maintain long-term viability of the host, increasing the transmissibility of the organism. The hallmark of Salmonella epidemiology in natural settings is the establishment of the carrier state to maintain the bacteria within the host population (44). Thus, by suppressing NF-B, WT Salmonella reduces the host inflammatory response, which might promote more extensive tissue invasion or extend the long-term survival and replication of these pathogenic bacteria by maintaining a viable host for propagation. This "stealth" capability would also favor establishment of chronic carriers, providing a reservoir from which to seed new infections. Similar to SseL, the AvrA protein, also impairs NF-B activation by impairing deubiquitination and subsequent degradation of IB (13), but studies of AvrA Salmonella in mice have not focused on NF-B-driven or inflammatory events. OspG, a kinase produced by S. flexneri also prevents phospho-IB degradation and subsequent NF-B activation. In accordance with the phenotype of mice infected with sseL Salmonella, inactivation of OspG increases the host inflammatory response to S. flexneri infection (14).

It remains to be determined whether the ubiquitin hydrolase activity of SseL is relevant to cellular substrates beyond IB, which might dysregulate other components of the host immune response. The AvrA protease, for example, was reported to reduce ubiquitin-mediated degradation of both IB and β-catenin (13). Thus, while other substrates may exist, we propose that the suppression of NF-B activation by SseL is at least one mechanism that endows pathogenic bacteria with virulence capabilities in specific contexts of host-pathogen interactions, the full consequences of which remain to be determined.

	Acknowledgments

 
We thank M. Hanaii and T. Siegfried for manuscript preparation, J. M. Bruey and C. Kress for technical assistance, R. Newman, P. Godoi, and G. Tiscornia for helpful discussions.

	Disclosures

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
The authors have no financial conflict of interest.

	Footnotes

 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ This work was supported by the Crohn’s and Colitis Foundation of America, Association de la Recherche contre le Cancer, and National Institutes of Health AI-055789 and AI-32178.

² Address correspondence and reprint requests to Dr. John C. Reed, Burnham Institute for Medical Research, 10901 North Torrey Pines Road, La Jolla, CA 92037. E-mail address: reedoffice{at}burnham.org

³ Abbreviations used in this paper: IKK, IB kinase; SCF, stem cell factor; DUB, deubiquitinating enzyme; WT, wild type; SseL, Salmonella secreted factor L; LB, Luria-Bertani; Kan, kanamycin; HA, hemagglutinin; PARP, poly(ADP-ribose) polymerase; IP, immunoprecipitation; p.i., postinfection; AMC, 7-amino-4-methylcoumarin; PMN, polymorphonuclear neutrophil; m.o.i., multiplicity of infection; hsp, heat shock protein; SUMO, small ubiquitin-related modifier; NEDD8, neural precursor cell-expressed developmentally down-regulated 8.

Received for publication September 7, 2007. Accepted for publication January 30, 2008.

	References

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 

1. Monack, D. M., D. M. Bouley, S. Falkow. 2004. Salmonella typhimurium persists within macrophages in the mesenteric lymph nodes of chronically infected Nramp1^+/+ mice and can be reactivated by IFN neutralization. J. Exp. Med. 199: 231-241. [Abstract/Free Full Text]
2. Fang, F. C., J. Fierer. 1991. Human infection with Salmonella dublin. Medicine 70: 198-207. [Medline]
3. Falkow, S.. 2006. Is persistent bacterial infection good for your health?. Cell 124: 699-702. [Medline]
4. Dharmana, E., M. Keuter, M. G. Netea, I. C. Verschueren, B. J. Kullberg. 2002. Divergent effects of tumor necrosis factor- and lymphotoxin- on lethal endotoxemia and infection with live Salmonella typhimurium in mice. Eur. Cytokine Netw. 13: 104-109. [Medline]
5. Koebernick, H., L. Grode, J. R. David, W. Rohde, M. S. Rolph, H. W. Mittrucker, S. H. Kaufmann. 2002. Macrophage migration inhibitory factor (MIF) plays a pivotal role in immunity against Salmonella typhimurium. Proc. Natl. Acad. Sci. USA 99: 13681-13686. [Abstract/Free Full Text]
6. John, B., D. Rajagopal, A. Pashine, S. Rath, A. George, V. Bal. 2002. Role of IL-12-independent and IL-12-dependent pathways in regulating generation of the IFN- component of T cell responses to Salmonella typhimurium. J. Immunol. 169: 2545-2552. [Abstract/Free Full Text]
7. Bao, S., K. W. Beagley, M. P. France, J. Shen, A. J. Husband. 2000. Interferon- plays a critical role in intestinal immunity against Salmonella typhimurium infection. Immunology 99: 464-472. [Medline]
8. Hayden, M. S., S. Ghosh. 2004. Signaling to NF-B. Genes Dev. 18: 2195-2224. [Abstract/Free Full Text]
9. Chen, Z. J.. 2005. Ubiquitin signalling in the NF-B pathway. Nat. Cell Biol. 7: 758-765. [Medline]
10. Scheidereit, C.. 2006. IB kinase complexes: gateways to NF-B activation and transcription. Oncogene 25: 6685-6705. [Medline]
11. Brummelkamp, T. R., S. M. Nijman, A. M. Dirac, R. Bernards. 2003. Loss of the cylindromatosis tumour suppressor inhibits apoptosis by activating NF-B. Nature 424: 797-801. [Medline]
12. Wertz, I. E., K. M. O’Rourke, H. Zhou, M. Eby, L. Aravind, S. Seshagiri, P. Wu, C. Wiesmann, R. Baker, D. L. Boone, et al 2004. De-ubiquitination and ubiquitin ligase domains of A20 downregulate NF-B signalling. Nature 430: 694-699. [Medline]
13. Ye, Z., E. O. Petrof, D. Boone, E. C. Claud, J. Sun. 2007. Salmonella effector AvrA regulation of colonic epithelial cell inflammation by deubiquitination. Am. J. Pathol. 171: 882-892. [Abstract/Free Full Text]
14. Kim, D. W., G. Lenzen, A. L. Page, P. Legrain, P. J. Sansonetti, C. Parsot. 2005. The Shigella flexneri effector OspG interferes with innate immune responses by targeting ubiquitin-conjugating enzymes. Proc. Natl. Acad. Sci. USA 102: 14046-14051. [Abstract/Free Full Text]
15. Orth, K., Z. Xu, M. B. Mudgett, Z. Q. Bao, L. E. Palmer, J. B. Bliska, W. F. Mangel, B. Staskawicz, J. E. Dixon. 2000. Disruption of signaling by Yersinia effector YopJ, a ubiquitin-like protein protease. Science 290: 1594-1597. [Abstract/Free Full Text]
16. Zhou, H., D. M. Monack, N. Kayagaki, I. Wertz, J. Yin, B. Wolf, V. M. Dixit. 2005. Yersinia virulence factor YopJ acts as a deubiquitinase to inhibit NF-B activation. J. Exp. Med. 202: 1327-1332. [Abstract/Free Full Text]
17. Sweet, C. R., J. Conlon, D. T. Golenbock, J. Goguen, N. Silverman. 2007. YopJ targets TRAF proteins to inhibit TLR-mediated NF-B, MAPK and IRF3 signal transduction. Cell. Microbiol. 9: 2700-2715. [Medline]
18. Mittal, R., S. Y. Peak-Chew, H. T. McMahon. 2006. Acetylation of MEK2 and IB kinase (IKK) activation loop residues by YopJ inhibits signaling. Proc. Natl. Acad. Sci. USA 103: 18574-18579. [Abstract/Free Full Text]
19. Mukherjee, S., G. Keitany, Y. Li, Y. Wang, H. L. Ball, E. J. Goldsmith, K. Orth. 2006. Yersinia YopJ acetylates and inhibits kinase activation by blocking phosphorylation. Science 312: 1211-1214. [Abstract/Free Full Text]
20. Monack, D. M., J. Mecsas, D. Bouley, S. Falkow. 1998. Yersinia-induced apoptosis in vivo aids in the establishment of a systemic infection of mice. J. Exp. Med. 188: 2127-2137. [Abstract/Free Full Text]
21. Misaghi, S., Z. R. Balsara, A. Catic, E. Spooner, H. L. Ploegh, M. N. Starnbach. 2006. Chlamydia trachomatis-derived deubiquitinating enzymes in mammalian cells during infection. Mol. Microbiol. 61: 142-150. [Medline]
22. Coombes, B. K., M. J. Lowden, J. L. Bishop, M. E. Wickham, N. F. Brown, N. Duong, S. Osborne, O. Gal-Mor, B. B. Finlay. 2007. SseL is a Salmonella-specific translocated effector integrated into the SsrB-controlled salmonella pathogenicity island 2 type III secretion system. Infect. Immun. 75: 574-580. [Abstract/Free Full Text]
23. Rytkonen, A., J. Poh, J. Garmendia, C. Boyle, A. Thompson, M. Liu, P. Freemont, J. C. Hinton, D. W. Holden. 2007. SseL, a Salmonella deubiquitinase required for macrophage killing and virulence. Proc. Natl. Acad. Sci. USA 104: 3502-3507. [Abstract/Free Full Text]
24. Datsenko, K. A., B. L. Wanner. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97: 6640-6645. [Abstract/Free Full Text]
25. Newman, R. M., P. Salunkhe, A. Godzik, J. C. Reed. 2006. Identification and characterization of a novel bacterial virulence factor that shares homology with mammalian Toll/interleukin-1 receptor family proteins. Infect. Immun. 74: 594-601. [Abstract/Free Full Text]
26. Coburn, B., Y. Li, D. Owen, B. A. Vallance, B. B. Finlay. 2005. Salmonella enterica serovar typhimurium pathogenicity island 2 is necessary for complete virulence in a mouse model of infectious enterocolitis. Infect. Immun. 73: 3219-3227. [Abstract/Free Full Text]
27. Collier-Hyams, L. S., H. Zeng, J. Sun, A. D. Tomlinson, Z. Q. Bao, H. Chen, J. L. Madara, K. Orth, A. S. Neish. 2002. Cutting edge: Salmonella AvrA effector inhibits the key proinflammatory, anti-apoptotic NF-B pathway. J. Immunol. 169: 2846-2850. [Abstract/Free Full Text]
28. Ruland, J., G. S. Duncan, A. Elia, I. del Barco Barrantes, L. Nguyen, S. Plyte, D. G. Millar, D. Bouchard, A. Wakeham, P. S. Ohashi, T. W. Mak. 2001. Bcl10 is a positive regulator of antigen receptor-induced activation of NF-B and neural tube closure. Cell 104: 33-42. [Medline]
29. Coope, H. J., P. G. Atkinson, B. Huhse, M. Belich, J. Janzen, M. J. Holman, G. G. Klaus, L. H. Johnston, S. C. Ley. 2002. CD40 regulates the processing of NF-B2 p100 to p52. EMBO J. 21: 5375-5385. [Medline]
30. Orth, K., L. E. Palmer, Z. Q. Bao, S. Stewart, A. E. Rudolph, J. B. Bliska, J. E. Dixon. 1999. Inhibition of the mitogen-activated protein kinase kinase superfamily by a Yersinia effector. Science 285: 1920-1923. [Abstract/Free Full Text]
31. Xiao, W.. 2004. Advances in NF-B signaling transduction and transcription. Cell. Mol. Immunol. 1: 425-435. [Medline]
32. Xia, Z. P., Z. J. Chen. 2005. TRAF2: a double-edged sword?. Sci. STKE 2005: pe7[Abstract/Free Full Text]
33. Barthel, M., S. Hapfelmeier, L. Quintanilla-Martinez, M. Kremer, M. Rohde, M. Hogardt, K. Pfeffer, H. Russmann, W. D. Hardt. 2003. Pretreatment of mice with streptomycin provides a Salmonella enterica serovar typhimurium colitis model that allows analysis of both pathogen and host. Infect. Immun. 71: 2839-2858. [Abstract/Free Full Text]
34. Hapfelmeier, S., W. D. Hardt. 2005. A mouse model for S. typhimurium-induced enterocolitis. Trends Microbiol. 13: 497-503. [Medline]
35. Haglund, K., I. Dikic. 2005. Ubiquitylation and cell signaling. EMBO J. 24: 3353-3359. [Medline]
36. Li, H., M. Kobayashi, M. Blonska, Y. You, X. Lin. 2006. Ubiquitination of RIP is required for tumor necrosis factor -induced NF-B activation. J. Biol. Chem. 281: 13636-13643. [Abstract/Free Full Text]
37. Hershko, A., A. Ciechanover. 1998. The ubiquitin system. Annu. Rev. Biochem. 67: 425-479. [Medline]
38. Adhikari, A., M. Xu, Z. J. Chen. 2007. Ubiquitin-mediated activation of TAK1 and IKK. Oncogene 26: 3214-3226. [Medline]
39. Mukhopadhyay, D., H. Riezman. 2007. Proteasome-independent functions of ubiquitin in endocytosis and signaling. Science 315: 201-205. [Abstract/Free Full Text]
40. Wullaert, A., K. Heyninck, S. Janssens, R. Beyaert. 2006. Ubiquitin: tool and target for intracellular NF-B inhibitors. Trends Immunol. 27: 533-540. [Medline]
41. Angot, A., A. Vergunst, S. Genin, N. Peeters. 2007. Exploitation of eukaryotic ubiquitin signaling pathways by effectors translocated by bacterial type III and type IV secretion systems. PLoS Pathog. 3: e3[Medline]
42. Munro, P., G. Flatau, E. Lemichez. 2007. Bacteria and the ubiquitin pathway. Curr. Opin. Microbiol. 10: 39-46. [Medline]
43. Fehr, D., C. Casanova, A. Liverman, H. Blazkova, K. Orth, D. Dobbelaere, J. Frey, S. E. Burr. 2006. AopP, a type III effector protein of Aeromonas salmonicida, inhibits the NF-B signalling pathway. Microbiology 152: 2809-2818. [Abstract/Free Full Text]
44. Karin, M., A. Lin. 2002. NF-B at the crossroads of life and death. Nat. Immunol. 3: 221-227. [Medline]
45. Monack, D. M., A. Mueller, S. Falkow. 2004. Persistent bacterial infections: the interface of the pathogen and the host immune system. Nat. Rev. Microbiol. 2: 747-765. [Medline]

This article has been cited by other articles:

				J. Shanks, M. N. Burtnick, P. J. Brett, D. M. Waag, K. B. Spurgers, W. J. Ribot, M. A. Schell, R. G. Panchal, F. C. Gherardini, K. D. Wilkinson, et al. Burkholderia mallei tssM Encodes a Putative Deubiquitinase That Is Secreted and Expressed inside Infected RAW 264.7 Murine Macrophages Infect. Immun., April 1, 2009; 77(4): 1636 - 1648. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Le Negrate, G. Articles by Reed, J. C. Search for Related Content PubMed PubMed Citation Articles by Le Negrate, G. Articles by Reed, J. C.