The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

The Journal of Immunology, 2008, 180, 4816 -4824
Copyright © 2008 by The American Association of Immunologists, Inc.
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rogers, K. A.
Right arrow Articles by Attanasio, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rogers, K. A.
Right arrow Articles by Attanasio, R.

Nonhuman Primate IgA: Genetic Heterogeneity and Interactions with CD891,2

Kenneth A. Rogers*, Lakshmi Jayashankar*, Franco Scinicariello{dagger} and Roberta Attanasio3,*

* Department of Biology, Georgia State University, Atlanta, GA 30303; and {dagger} Division of Toxicology and Environmental Medicine, Centers of Disease Control and Prevention, Agency for Toxic Substances and Disease Registry, Atlanta, GA 30341


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Nonhuman primates are extremely valuable animal models for a variety of human diseases. However, it is now becoming evident that these models, although widely used, are still uncharacterized. The major role that nonhuman primate species play in AIDS research as well as in the testing of Ab-based therapeutics requires the full characterization of structure and function of their Ab molecules. IgA is the Ab class mostly involved in protection at mucosal surfaces. By binding to its specific Fc receptor CD89, IgA plays additional and poorly understood roles in immunity. Therefore, Ig heavy {alpha} (IGHA) constant (C) genes were cloned and sequenced in four different species (rhesus macaques, pig-tailed macaques, baboons, and sooty mangabeys). Sequence analysis confirmed the high degree of intraspecies polymorphism present in nonhuman primates. Individual animals were either homozygous or heterozygous for IGHA genes. Highly variable hinge regions were shared by animals of different geographic origins and were present in different combinations in heterozygous animals. Therefore, it appears that although highly heterogeneous, hinge sequences are present only in limited numbers in various nonhuman primate populations. A macaque recombinant IgA molecule was generated and used to assess its interaction with a recombinant macaque CD89. Macaque CD89 was able to bind its native ligand as well as human IgA1 and IgA2. Presence of Ag enhanced macaque IgA binding and blocking of macaque CD89 N-glycosylation reduced CD89 expression. Together, our results suggest that, despite the presence of IgA polymorphism, nonhuman primates appear suitable for studies that involve the IgA/CD89 system.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
A variety of nonhuman primate (NHP)4 species are routinely used in biomedical research for studies related to the pathogenesis and vaccine prevention of infectious diseases, especially HIV infection and AIDS (1). In addition, NHP species are being increasingly used for testing Ab-based therapeutics (2, 3, 4, 5, 6, 7). Because Abs are one of the most important effector molecules generated during the immune response, it is essential to fully characterize their structure/function relationships as well as their interactions with the corresponding Fc receptors for all NHP species used in the above mentioned studies. Indeed, it is widely recognized that the characterization of NHP Ab molecules is still incomplete. Results from recent studies (8) indicate that, although NHP and human Ab molecules are very similar to each other, there are several differences that might lead to the incorrect interpretation of results from studies performed in these species.

IgA is the most abundant class of Ab secreted into the mucosal epithelial linings. As the mucosal immune system is the initial barrier against most pathogens, secretory IgA provides a first line of defense (9, 10). Secretory IgA is primarily polymeric. In human serum, IgA constitutes 15–20% of total immunoglobulins and is mostly monomeric (11). IgA mechanisms of defense include immune exclusion, intracellular neutralization, and virus excretion (12, 13, 14, 15, 16). Serum IgA interacts with several poorly characterized receptors specific for its Fc portion. The best characterized of these receptors is Fc{alpha}RI, or CD89, expressed on the surface of eosinophils, neutrophils, dendritic cells, monocytes, and macrophages (17). The mechanisms mediated by immune complexes of IgA cross-linked to CD89 include Ab-dependent cell-mediated cytotoxicity, phagocytosis, and respiratory burst, as well as release of cytokines and inflammatory mediators (14, 17).

The C region of the IgA H chain is encoded by Ig H chain {alpha} (IGHA) genes. In humans, IgA exists as two subclasses, IgA1 and IgA2 (encoded, for the C region of the {alpha}-chain, by IGHA1 and IGHA2 genes, respectively) (18, 19). Old World monkeys possess only one IGHA gene (20, 21). An IGHA coding region consists of a constant domain (CH1) and a hinge region followed by two other constant domains (CH2 and CH3). Each CH domain is encoded by separate exons, with the hinge uniquely encoded by the 5' end of the CH2 exon (18).

Interestingly, in NHPs, IGHA genes exhibit intraspecies sequence polymorphism. In particular, the hinge region of Old World monkeys is characterized by a partially reiterated structure with high sequence variability (22, 23, 24). This region accumulates mutations very rapidly, probably as a result of adaptive evolution due to selective pressure from bacterial proteases (22, 23).

Although partial IGHA sequences have been described for several NHP species, sequences of the complete IGHA coding regions are available only for rhesus macaques of Indian origin (25) and sooty mangabeys (26). Analysis of the complete Indian rhesus macaque sequences shows that the IGHA CH1 and CH2 domains are also polymorphic. The high levels of polymorphism found in rhesus macaques have not been described in humans, although it appears that IgA may be polymorphic in mice, pigs, and other primates (22, 23, 27, 28).

We recently demonstrated that the IgG/CD16 system differs between NHPs and humans. Recombinant NHP CD16 binds to human IgG subclasses different from those bound by human CD16, despite a nearly complete conservation of residues known to be involved in ligand binding (8). Because of its major role in mucosal and systemic immunity, and because of the possible therapeutic potential in modulating the IgA/CD89 interactions (29), IgA is an Ab class that requires full characterization in NHP species. Humanized IgA-based therapeutics should be tested in these species only if their ability to interact with NHP CD89 is ascertained.

In this study, we report the cloning and complete sequence characterization of IGHA genes from either Asian or African NHP species, i.e., rhesus macaques (Macaca mulatta) of Chinese origin, pig-tailed macaques (Macaca nemestrina), baboons (Papio hamadryas anubis), and sooty mangabeys (Cercocebus torquatus atys). IGHA genes from Indian rhesus macaques as well as two IGHA genes from sooty mangabeys have been previously described (25, 26). Because it is logical to speculate that this high sequence variability may result in different functional properties, we have developed a system for the generation of macaque recombinant IgA molecules and used a macaque recombinant IgA molecule to assess the IgA/CD89 interaction in this NHP species.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Blood samples and RNA Extraction

Blood samples from rhesus macaques of Chinese origin, pig-tailed macaques, baboons, and sooty mangabeys were obtained from the Yerkes National Primate Research Center (Emory University, Atlanta, GA) and the Southwest Foundation for Biomedical Research (San Antonio, TX). Total RNA was extracted from whole blood using the QiaAmp RNA blood mini kit (Qiagen). The animals were designated according to the standardized abbreviation rules of IMGT (the international ImMunoGeneTics) information system (30) as Papcynanu (baboons), Macmul (rhesus macaques), Macnem (pig-tailed macaques), and Certoraty (sooty mangabeys). Animal blood was collected under approval of the appropriate institutional review committees.

Amplification of IGHA constant region from total RNA

After reverse transcription of total RNA into cDNA using oligo(dT) primers followed by primer extension with the AMV reverse transcriptase (Roche Diagnostic Corp), the full length IGHA cDNA was amplified by PCR using the forward primer IgA10 (5'-ATGGATCCATGGGCATCCCCGACCAGCCCC) and reverse primer IgA4 (5'-CAACAGACACATTGACATGGGTG) corresponding to CH3 codons 132 to 138. For the IgA10 primer, nucleotides 13–30 correspond to the CH1 codons 1.4 to 1.1, 1 and 2, according to the IMGT unique numbering for C-DOMAIN (31) (GenBank, EMBL, DDBJ, IMGT/LIGM-DB accession number J00220). For primer IgA10, at the 5'-end are added nucleotides containing the underlined BamHI restriction enzyme site. The reaction was run for 40 cycles, with each cycle consisting of 94°C for 1 min, 58°C for 1 min, and 72°C for 2 min.

Cloning of amplified sequences

Cloning, screening, sequencing, and sequence analysis of amplified gene sequences was performed as previously described (32), except that DNA sequences were determined using an ABI model 3100 automated sequencer (PerkinElmer). All sequences were obtained two times from two independent RT-PCR. IGHA sequences were aligned with the published human and Indian rhesus macaques IGHA genes using the CLUSTAL function of the Megalign part of the Lasergene software package (DNASTAR Inc). The IMGT standardized nomenclature and numbering have been used to show and discuss IGHA data (31).

Production of recombinant IgA with a rhesus IGHA

Recombinant IgA was generated by transfection of an Ig IgH expression vector containing a variable heavy domain with affinity for hapten 5-iodo-4-hydroxy-3-nitrophenacetyl (VHNIP) and IGHA cDNA of a rhesus macaque of Chinese origin (GEDI accession number AY294614). The Ig H chain expression vector was engineered from pLNOH2 (provided by Drs. Lars Norderhaug and Inger Sandlie, University of Oslo and Ab Design AS, Nesoddtangen, Norway). pLNOH2, derived from pcDNA3 (Invitrogen), encodes a human IGHG3 constant region (CH) and a variable heavy domain (VHNIP) (33).

To construct the IgA H chain expression vector, both VHNIP and human IGHG3 genes were removed from pLNOH2 by digestion at BsmI and BamHI restriction sites and replaced by ligation with a similarly digested cassette containing the VHNIP cDNA and IGHA cDNA. Production of the cassette was done by separate PCR amplification of the VHNIP and IGHA cDNAs followed by the joining of the two overlapping products by a third PCR amplification. The VHNIP gene was amplified from pLNOH2 using primers FVH5FW (5'-GGTGTGCATTCCCAGGTCCAATTGCAGCAGCCT) and FVH3RW (5'-GACCTTGGGGCTGGTCGGGGATGCTGAAGAGACTGTGAGAGTGG). IGHA was amplified from the appropriate HindIII-linearized pCR 2.1 clone using primers FCAFwear1 (142–164, accession number J00220) (ACTCTCACAGTCTCTTCAGCATCCCCGACCAGCCCCAAGGTC) and FCARV (1635–1584, accession number J00220) (5'-AGTGGATCCATTACTAGTAGCAGGTGCCGTCCACCTCCGCCATGACAACAGACACATTGACATGGGTG). Primers FVH3RW and FCAF correspond to 6 codons of the J-REGION and to CH1 codons 1.4 to 1.1, 1 to 4. Primer FCARV corresponds to CH3 codons 132 to 148 and stop codon. The final cassette was produced in a PCR containing the VHNIP and IGHA fragments using primers FVH5FW and FCARV. PCR conditions for all the reactions were the same as described above except that the annealing temperature was 56°C. The complete expression vector was transformed into Escherichia coli. After verifying the vector sequence, a clone was expanded and vector prepared with an EndoFree plasmid maxi kit (Qiagen).

J558L cells (a gift from Dr. S. L. Morrison, UCLA) do not produce a mouse Ig as a result of a spontaneous loss of the Ig H chain from their parental cell line J558 (34), but continue to secrete a Ig {lambda} L chain, which when combined with VNIP H chain forms Abs with affinity for 5-iodo-4-hydroxy-3-nitrophenacetyl (NIP). Twenty micrograms of expression vector DNA was electroporated into 1 x 107 J558L cells resuspended in ice-cold PBS by pulsing once with 300 V using an Electroporator II (Invitrogen) with its settings at 1000 µF and infinite resistance. Following 10 min of incubation on ice, cells were grown in IMDM with penicillin (100 IU/ml), streptomycin (100 µg/ml), and 10% FCS at 37°C with 5% CO2. At 72 h post-transfection, G418 (Invitrogen) was added to the growth medium at 400 µg/ml for selection of stable transfectants. Transfection with pLNOH2 was used as a positive control for Ab production.

Detection of Ig {lambda} (IGL) and complete recombinant IgA from J558L cell supernatants

Production of Ig {lambda} (IGL) L chain and complete recombinant IgA from J558L cell supernatants was determined by capture ELISAs. Microtiter plates were coated with goat anti-mouse Ig {lambda} Ab (Invitrogen) at 4 and 8 µg/ml or with NIP-BSA at 15 µg/ml in 1x coating buffer (KPL). After incubation at 4°C overnight, the plate was blocked with 5% FCS diluted in PBS at 37°C for 30 min. After washing, samples were added. For Ig {lambda} assays, tissue culture supernatant from untransfected J558L cells, purified mouse myeloma IgG1 with a {lambda}-chain (Sigma-Aldrich) (positive control), or 5% FCS in either culture media, or PBS (negative control) was added and incubated at 37°C for 1 h. For the IgA assays, supernatants from the transfected and untransfected cells were added and incubated overnight at 4°C. After washing, HRP-labeled secondary Abs were added. Anti-mouse Ig {lambda} (Invitrogen) was used to detect Ig {lambda} and IgA. In addition, for IgA assays, anti-rhesus Ig {alpha} was added (KPL). Plates were incubated for 1 h at 37°C washed and developed by addition of ABTS/H2O2 followed by addition of stop solution. Absorbance was measured at 405 nm using an automated Benchmark microplate reader (Bio-Rad).

Generation of HeLa cell clones expressing recombinant rhesus macaque CD89

Clones of HeLa cells expressing rhesus macaque CD89 were generated. First, rhesus macaque CD89 cDNA was inserted into pcDNA3.1 (Invitrogen) by methods previously described (35). From the resulting vector a product containing the cDNA of rhesus macaque CD89, a cytomegalovirus promoter and a bovine growth hormone polyadenylation signal was amplified using PCR primers PcHp (5'-CTGCTGTTAACCGTTAGGGTTAGGCGTTTTGCG) and PcSa (5'-ACTTTGTCGACGCTCAGCGGCCGGCCATCGATCCACAGAATTAATTCGCGTT). After digestion with HpaI and SalI, the resulting fragment was ligated into HpaI and XhoI digested pLXSN (Clontech Laboratories) to create an expression vector with long-terminal repeats that allow for stable integration into host chromosomes. Twenty micrograms of vector was electroporated into 250 µl of HeLa cells suspended in DMEM at 14 x 106 cells/ml by the methods described above. Cells were diluted serially into 96-well microtiter plates and grown in 100 µl of DMEM (containing 10% FCS and consisting of 50% fresh medium and 50% 0.2 µm filtered HeLa cell-conditioned media) with 400 µg/ml G418. Wells with single cells were identified by microscopy and the clones subsequently expanded. Flow cytometric analysis was used to identify clones expressing CD89. In brief, adherent cells were removed from flasks with 0.25% trypsin/EDTA. Aliquots of 0.5 x 106 cells were stained with 5 µl of anti-human CD89 PE (clone A59) or a mouse isotype control (BD Biosciences) for 30 min at 4°C, washed three times with PBS to remove unbound Ab, and suspended in 1% paraformaldehyde. Fluorescent cells were counted on a FACSCalibur machine and analyzed with CellQuest software (BD Biosciences).

Determination of recombinant IgA binding to CD89

Binding of recombinant IgA to CD89 was assessed by flow cytometry using Abs that were heat aggregated at 63°C for 1 h. IgA1, IgA2, IgG, and IgM (human myeloma proteins; Binding Site Ltd.) with Ig {kappa} light chains were added to 0.5 x 106 cells at 20 µg/ml and incubated for 1 h at 4°C. PBS washed cells were then stained with 5 µl of either FITC-conjugated mouse anti-human Ig {kappa} (Invitrogen), FITC-conjugated mouse anti-human IG {alpha} (KPL, Inc.) or FITC-conjugated mouse isotype control (BD Biosciences) for 30 min at 4°C. For some experiments, mouse anti-human CD89 PE was also added. Cells were washed and analyzed by flow cytometry as described above. For N-glycosylation blocking experiments, tunicamycin was added to half of the cell cultures at 1 µg/ml 30 h before harvesting cells. Experiments to determine binding of recombinant rhesus macaque IgA were performed as variations of the above protocol. Supernatant from J558L cells secreting recombinant IgA or supernatant from control J558L cells was first mixed with NIP (5) BSA (15 µg/ml final concentration) and incubated for 2 h at 37°C. Supernatants were then incubated with cells as described above. Finally, cells were washed with PBS, stained with 20 µl of goat anti-mouse Ig {lambda} FITC and 5 µl of anti-human CD89 for 20 min at 4°C, washed 3 times with PBS, and fixed with 1% paraformaldehyde.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
Sequencing of NHP IGHA

IGHA sequences were obtained from three pig-tailed macaques, four baboons, and three sooty mangabeys. The alignment of these sequences with the three human IgA sequences, as well as previously described NHP sequences (25, 26) are shown in Fig. 1. Animals were presumed homozygous for IGHA when all ten or more clones were determined to have the same sequence. Four unique IGHA gene sequences were identified in the pig-tailed macaques, with one monkey homozygous and two heterozygous. The sequence from the homozygous pig-tailed macaque was also found in one of the heterozygous pig-tailed macaques. Four sequences were present within the four baboons. Two baboons were homozygous and two heterozygous, each having one unique sequence and one in common with a homozygous baboon. Five different gene sequences were present in the three sooty mangabeys. One of these sequences was identical with the one previously reported by us (26).


Figure 1
View larger version (67K):
[in this window]
[in a new window]

  		FIGURE 1. Alignment of human (Homsap), rhesus macaque (Macmul), pig-tailed macaque (Macnem), sooty mangabey (Certoraty), and baboon (Papcynanu) IGHA-derived amino acid sequences. GEDI Accession numbers are given in parentheses. Homsap IGHA1, Homo sapiens IGHA1; Homsap IGHA2 A2m1 and Homsap IGHA2 A2m2, Homo sapiens IGHA2 coding the A2m1 and A2m2 allotypes, respectively (18 56 57 ). Macmul A-G represent sequences from individual rhesus macaques designated as A-G (GEDI accession numbers AY039245-AY03952, AY294614-AY2946615). Similar alphabetical designations are given for individual animals from other NHP species. I and II refer to distinct alleles within a single animal. Macmul G.I is derived from a reported contig of the rhesus macaque genome project. Rhesus macaques E and F are of Chinese origin; all others are of Indian origin. Some alleles within individual animals are identical with those found in others of the same species at the amino acid level (Macmul A.II and D.I; Macmul C.II and D.II; Mannem A.I and C.II; Macnem B.I and C.I; Certoraty A1*2 and B.II; Papcyanu A.I and D.I; Papcyanu B.I and C.II). The remaining GEDI accession numbers are as follows: human (J00220, J00221, M60192), pig-tailed macaque (DQ868438-DQ868441), sooty mangabey (AY544580-AY544581, DQ868431-DQ868433, and DQ868442-DQ868443), and baboon (DQ86843437). Absent amino acids are indicated by dots and residues matching Homsap IGHA1 are indicated by dashes.

 
The baboon IGHA allelic sequences exhibit 83% amino acid identity to the corresponding human IGHA1 sequence (18). They share 91.2–94.8% identity with the corresponding rhesus macaque IGHA alleles, 91.8–96.0% with the corresponding pig-tailed macaques IGHA alleles and 90.6–95.4% with the mangabey counterparts. Among the rhesus macaque species, IGHA alleles exhibit 81.2–83.7% amino acid identity to human IGHA1. They share 91.0–98.8% sequence identity with the corresponding pig-tailed macaque IGHA alleles and 90–96% sequence identity with the mangabey counterparts. An 81.8–84.4% sequence identity exists between pig-tailed macaque IGHA alleles when compared with the human IGHA1 and they share 90.3–96.4% sequence identity with the mangabey IGHA alleles. Sequence identity between mangabey IGHA alleles and the human counterparts is 82.3–83.9%.

The human (Homsap) CH1 exon of IGHA1 is composed of 306 nucleotides, encoding 102 aa (18). In the baboons, the IGHA alleles have a deletion of glycine at position 17 resulting in a CH1 domain of 101 amino acids. A similar deletion at position 17 is present in rhesus macaques (Macmul) of both Chinese and Indian origin. In addition, animal Macmul B had a deletion at position 124, resulting in a domain of 100 aa. The mangabey (Certoraty) CH1 domain encodes 101 aa with deletion at either position 17 or 124, whereas the pig-tailed macaque (Macnem) CH1 exon encodes either 101 or 100 aa depending on the presence of deletions at either one or two positions (17 and 124).

In humans, the second exon of the IGHA genes encode hinge regions that differ in length (19 aa for IGHA1 and 6 aa for IGHA2), and a CH2 domain of 101 aa. In the NHPs analyzed in this study, the hinge regions consist of 8–13 aa, whereas the CH2 domains exhibit highly conserved sequences and are all 101 aa long. Fig. 2 shows the IGHA hinge amino acid sequences from the various NHPs included in this study. Clearly, a high degree of heterogeneity characterizes the hinge region of these Ab molecules. Two different IGHA hinge sequences were identified in several animals, whereas some others exhibited only one hinge sequence. Interestingly, hinge region sequences present in some NHPs were also present in others, although in combination with different alleles. Hinge sequences from 3 baboon IGHA alleles (Papcynanu A.I, C.II, and D.I) were also observed in two mangabey IGHA alleles (Certoraty B.II and C.II). Similarly, Chinese and Indian rhesus macaque sequences share some hinge sequences with each other and also with pig-tailed macaques. In humans, IgA1 proteases cleave proline-serine and proline-threonine bonds in the hinge region, but not at all positions (36). Only two or three of these bonds can be identified in the NHP hinge sequences, specifically one in a sequence from a rhesus macaque and potentially two in a sequence from a pig-tailed macaque (Fig. 2). Similar bonds are present in two other hinge sequences (that shared by a mangabey and a baboon as well as that shared by a rhesus macaque and a pig-tailed macaque). These bonds align with a similar bond found in human IgA1, which is not cut. The arginine-glycine (RG) bond found in the hinge sequence shared between a baboon and a mangabey is another possible cleavage site. This corresponds to a proline-valine bond found in humans and cut by a Clostridium ramosum IgA protease. The same substitutions (RG) are also present in IgA1 from chimpanzee, which is cut (36). Possibly the position itself could be important, but a human IgA2m (2) is also cut here despite a truncated hinge (37). IgA cleavage sites must be presented to bacterial proteases in the context of the larger IgA molecule for efficient digestion. No cleavage is observed when the human IgA1 hinge is replaced by that of IgG2. By contrast, cleavage is observed when the IgA1 has its hinge replaced with that of IgA2 (37). Therefore, the various NHP IgA molecules should be individually examined for resistance/susceptibility to bacterial proteases.


Figure 2
View larger version (30K):
[in this window]
[in a new window]

  		FIGURE 2. A, Deduced amino acid sequences of primate IgA hinge regions (italics) and their flanking residues. Known protease cleavage sites of human IgA1 and hypothetical sites of NHP hinge regions are indicated in bold. GenBank accession numbers are the following: X53385 (orangutan); X53386 (Gibbon IgA1-allele 1); X53387 (Gibbon IgA1-allele2; X53388 (Gibbon IgA2); X53389 (M. fascicularis). B, Nucleotide sequences corresponding to the hinge regions and flanking residues shown in A. The hinge codons are numbered. Nucleotides not matching Homsap IHA1 are in lowercase.

 
In humans, conserved cysteines are located in IgA CH2 at positions 1.2 and 1.1 in the IMGT unique numbering for C-DOMAIN (31). At least one of these cysteines is conserved at the same position in all the NHP hinge regions, although in more than half of the sequence, one of these is substituted. Specifically, the cysteines were replaced with serine at position 1.2 in three mangabey alleles (Certoraty A.II, B.II, and C.I) and by aspartate at position 1.1 in baboons (Papcynanu B.I and C.II), rhesus macaques (Macmul A.I, A.II, B.II, C.II, D.I, D.II, F.I, and G.I), pig-tailed macaques (Macnem A.I and C.II) and mangabeys (Certoraty A.I, B.I, C.II, and D.I).

The human CH3 domain consists of 131 aa. Very high similarities exist between human, baboon, rhesus macaques, pig-tailed macaques, and mangabey CH3 exons (Fig. 1). The length of the NHP CH3 domain was not confirmed by our sequences, which lack the last ten amino acid residues. However, through analysis of the rhesus macaque genome, a full-length IGHA gene was identified within a contig (accession number NW0011220011). The encoded gene product (Fig. 1, Macmul F.I) has a CH3 domain consisting of 131 aa.

Sequence analysis of all the NHP IGHA allelic variants shows that the residues in the CH2 and CH3 domains involved in Fc{alpha}/Fc{alpha}RI interactions (15) are conserved with the exception of a serine at position 46 and a glutamate at position 48 (positions 45 and 45.2 in the IMGT unique numbering, respectively) in CH3, which are substituted by threonine and glutamine, respectively.

Generation of recombinant IgA with a rhesus macaque Fc region

To evaluate expression and function of NHP IgA, a chimeric Ab with specificity for the hapten NIP and with rhesus macaque IGHA region was generated. This was done by constructing a vector for expression of a rhesus macaque Ig {alpha}-chain with a murine NIP-specific variable domain. Transfection of this vector into J558L cells, which produce a murine NIP-specific Ig {lambda} L chain, resulted in the production of IgA. Expression of the fully formed chimeric IgA molecules was determined from cell supernatants by ELISA using NIP coupled to BSA-coated microtiter plates and either anti-rhesus Ig {alpha} or anti-murine Ig {lambda} secondary Ab (Fig. 3).


Figure 3
View larger version (13K):
[in this window]
[in a new window]

  		FIGURE 3. Production of recombinant Abs with macaque Fc as detected by binding to NIP-BSA using ELISA. Supernatants from J588L cells transfected with an expression vector for rhesus IGHA, untransfected, or transfected with vector pLNOH2 encoding human IgG H chain specific for NIP were incubated on NIP-BSA coated plates to capture Abs. Bound Abs were detected with anti-mouse Ig {lambda}. Additionally, detection was done with anti-monkey Ig {alpha} for macaque Fc recombinant Ab supernatant and the untransfected negative control, or with anti-human Ig {gamma} for the pLNOH2 positive control.

 
Rhesus macaque IgA binds to recombinant rhesus CD89 expressed on HeLa cells

In humans, IgA/Ag complexes can initiate a variety of cellular immune responses by binding and cross-linking CD89 expressed on cells of the myeloid lineage. We have previously identified CD89 in cynomolgus and rhesus macaques (34). To assess rhesus macaque IgA interactions with CD89, stable HeLa cell clones expressing high levels of recombinant rhesus macaque CD89 were generated. CD89 presence on these clones was verified by positive staining with anti-human CD89 (data not shown). Expression was specific, because neither clones incubated with an isotype control nor untransfected HeLa cells incubated with anti-human CD89 stained positive. When recombinant rhesus macaque IgA binding was tested in the presence of the Ag NIP (5) BSA, cells expressing CD89 stained positive for bound IgA after incubation with IgA supernatant (mean fluorescence intensity (MFI) ± SD: 10.81 ± 8.15), but not after incubation with control supernatant (5.00 ± 4.61) (Fig. 4). Untransfected HeLa cells lacking CD89 expression did not bind IgA when incubated with NIP (5) BSA and IgA supernatant (5.45 ± 3.37). Staining of the same cells for CD89 expression had a positive correlation with staining for bound rhesus macaque IgA. Thus, rhesus macaque IgA binds in proportion to levels of rhesus macaque CD89 expressed on HeLa cells. The requirement of the Ag for the interaction of rhesus macaque IgA with CD89 was assessed using a similar assay in which the supernatant was pre-incubated with different concentration of Ag. Rhesus macaque IgA was able to bind CD89 in the absence of Ag (27.6 MFI versus control supernatant 22.4 ± 1.8), although this binding was enhanced by the presence of Ag (31.6 and 31.3 MFI for Ag at 1.88 and 7.5 µg/ml, respectively, it was reduced in the presence of excess Ag (26.6 MFI for 15 µg/ml Ag). Macaque CD89 was also capable of binding to heat-aggregated human IgA1 and IgA2, but not to human IgM (Fig. 5) of IgG. As shown for rhesus macaque IgA, human IgA bound in proportion to the amount of CD89 expressed on cells.


Figure 4
View larger version (41K):
[in this window]
[in a new window]

  		FIGURE 4. Rhesus IgA binds to rhesus macaque CD89. HeLa cells expressing recombinant rhesus macaque CD89 were incubated with supernatant of J588L cells expressing recombinant rhesus IgA (containing a mouse Ig {lambda}) or control supernatant and stained with anti-mouse Ig {lambda} FITC and anti-human CD89 PE. A, Histogram plot of HeLa cells expressing CD89 incubated with rhesus macaque IgA (filled), or control supernatant (dashed line), and untransfected control HeLa cells incubated with IgA (thick line). Two-color dot plots (C) HeLa cells with IgA supernatant, (B) and (D) HeLa cells expressing CD89 with control supernatant and IgA supernatant, respectively.

 

Figure 5
View larger version (28K):
[in this window]
[in a new window]

  		FIGURE 5. Recombinant rhesus macaque CD89 binds to heat-aggregated human myeloma IgA1 and IgA2; however, blocking N-glycosylation reduces expression of recombinant rhesus macaque CD89 and decreases in binding of human IgA1 and IgA2. Cells were stained with anti-human CD89 PE and anti-human Ig {alpha} FITC. Some HeLa cells were treated with tunicamycin to inhibit the N-glycosylation pathway; 10,000 cells were counted for each assay. Transfected with gene for rhesus CD89 HeLa cells; transfected HeLa cells with N-glycosylation blocked; control untransfected HeLa cells.

 
Fc receptor glycans have been shown to be important for receptor expression and Ig Fc binding (38). The effects of blocking N-glycosylation with tunicamycin on rhesus CD89 expression and binding properties were examined, because rhesus macaque CD89 has N-glycosylation motifs conserved with sites in human CD89 occupied by N-glycans (Fig. 5). Expression of CD89 was dramatically reduced in cells treated with tunicamycin (57–73% reduction) with a disproportionately greater decrease in ability to bind to human IgA1 and IgA2 (84–95%).


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
Despite the wide use of NHP species as animal models for a variety of human diseases as well as for vaccine development and Ab-based therapeutics, NHP Ab molecules and corresponding receptors are still uncharacterized. NHP species are especially used in AIDS research, which includes studies that require the assessment of IgA responses because of the role that the mucosal immune system plays in HIV entry and establishment of infection and because of the potential development of HIV mucosal vaccines (39). Exceptionally high levels of IGHA hinge region polymorphism are known to be present in many NHP species. Previously, we have demonstrated that, in addition to the hinge region, the entire IGHA genes of rhesus macaques of Indian origin are highly polymorphic. Therefore, we expanded our previous studies to include all exons from IGHA genes from two Asian species (rhesus macaques of Chinese origin and pig-tailed macaques) and two African species (baboons and sooty mangabeys).

Several lines of evidence indicate that individual macaques vary in their susceptibility to infectious diseases, especially AIDS. Rhesus macaques infected with a single challenge stock exhibit different patterns of disease susceptibility, some showing disease progression within a year or two and others becoming long-term survivors. Species-specific variation with regards to pathogenesis of SIV between Chinese and Indian subspecies has been particularly confounding. Infection with SIV virulent isolates resulted in lower viremic loads, stronger Ab responses, maintenance of CD4+ lymphocytes, and longer survival of Chinese macaques as compared with Indian macaques (40, 41, 42). However, a study using vaginal inoculation with SIVmac showed no significant difference, though the strength of the anti-SIV Ab response was more variable in Indian macaques (43). More recently, attenuated SIV pathogenicity in rhesus macaques of Chinese origin as compared with those of Indian origin has again been demonstrated on the basis of levels of plasma virus, CD4+ T cell numbers and survival (44). Therefore, we included in this study the analysis of IGHA genes of rhesus macaques of Chinese descent. On the opposite side of the spectrum of infection in NHPs, sooty mangabeys replicate naturally acquired SIV to high levels without evidence of immune defects or AIDS (45). Although SIV replicates predominately at mucosal sites in this species, such viral replication is not accompanied by extensive immune activation. Considering the emerging view that HIV immunopathogenesis at the mucosa during acute and chronic infection may be a decisive factor in disease progression (46) and the immunomodulatory potential of IgA, it is prudent to evaluate the variability of genes involved in mucosal immune responses.

Our results clearly show the high degree of sequence hypervariability of the hinge regions, which contributes to segmental flexibility as well as to intermolecular covalent assembly. These results confirm the evolutionary instability of this region. We identified two different IGHA hinge sequences in several animals, whereas some others showed only one hinge sequence. Interestingly, IGHA hinge region sequences present in some NHPs were also present in others, although in combination with different alleles, as observed between African and Asian species studied. Therefore, it appears that there is only a limited number of hinge sequences present in the various NHP populations. These sequences are shared by animals of different geographic origins and are present in different combinations in heterozygous animals. The hinge sequences differed in the number of proline residues, which may influence the flexibility of NHP IgA molecules with respect to immune complex formation. In addition, because different hinge sequences are responsible for the differential susceptibility of Ab molecules to proteolysis, NHP and human IgAs may differ with respect to sensitivity to bacterial proteases.

As mentioned above, SIV pathogenesis differs greatly between macaques and mangabeys, including the extent of immune activation, which is minimal in mangabeys. Immune activation may involve the action of gut microbes, which are controlled by intact IgA (47). Thus, in mangabeys, presence of intact IgA would minimize immune activation. The high extent of hinge variability in NHP species could result in presence of different cleavage sites, different susceptibility to the action of proteases and different levels of intact IgA. Intact IgA can potentially control gut microbes, or alternatively, following breaching of the gut barrier, IgA-opsonized bacteria might modulate the immune responses for example by causing immune activation through cross-linking of CD89 expressed on systemic myeloid lineage cells and subsequent release of cytokines. On the basis of hinge sequences, it is reasonable to assume that the four NHP species examined in this study express protease-resistant IgA molecules. However, specific alleles identified in individual animals from each species might encode molecules susceptible to cleavage. Therefore, although the variability in IgA hinge sequences might result in SIV pathogenesis differences at the individual level, it is not likely involved in differences at the species level. Clearly, NHP IgA molecules with different sequences should be evaluated for their protease resistance/susceptibility.

The IGHA CH2 domain contains a variable number of cysteines, which form the interchain disulfide bonds by connecting two parallel polyproline double helices. In humans, conserved cysteines are located at CH2 positions 1.2 and 1.1 in the IMGT unique numbering (31), right after the hinge (48). As expected, these hydrophobic cysteines are present at the same position in NHP; however, although one of two cysteines is always present, there is a change to serine at position 1.1 (C1.1 > S) in some alleles of Certoraty and there is a frequent change to aspartate at position 1.2 (C1.2>D). It remains to be seen whether the substitution of cysteines affects the flexibility or alters the interactions between the H chains.

Very high intra- and inter-species heterogeneity is present in all the CH domains for the NHPs studied. Specifically, sequence variability was observed in clusters in CH1, CH2, and CH3 domains. The amino acid substitutions present between IGHA allelic variants of one species differs not only from each other but also from other NHP IGHA sequences in the hinge region and in the CH1 domain. The other amino acid substitutions present between the IGHA allelic variants are clustered toward the end of the CH2 and in the middle of the CH3. These substitutions, which are present over a stretch of amino acids, include the majority of differences within human, macaque, baboon, and mangabey IGHA sequences and may contain mutation hot spots. Such regions may have evolved by slowly accumulating point mutations. IGHA hypervariability may potentially result in molecules with new functional properties. Different IGHA alleles may provide different degrees of protection against different pathogens.

As mentioned, many effector functions mediated by IgA molecules are triggered by interaction of their Fc region with Fc {alpha} receptors (Fc{alpha}RI). Fc {alpha} is a two-fold symmetric dimer of CH2 and CH3 of IgA H chains (37). Critical IgA residues in Fc{alpha}RI (CD89) interactions, although located in CH2 and CH3 domains, lie close enough for the Fc{alpha}RI domain to readily interact with both (15). In human IgA the binding remains relatively unaffected by amino acid substitutions of the hinge region (15), probably because CD89 binds to the CH2/CH3 interface.

Sequence analysis of all the NHP IGHA allelic variants showed that the residues involved in the IgA/CD89 interactions are conserved with the exception of serine at position 45 and glutamate at position 45.2 in CH3 in the IMGT unique numbering (31). Specifically, S45 and E45.2 in all the NHPs studied were substituted by threonine and glutamine, respectively. Although these amino acid changes result in no major change in the hydrophilic/hydrophobic profile, the charge nature of the residue at position 45.2 is changed. The human IgA/CD89 interface is composed of a central hydrophobic core flanked by charged residues, one being glutamate at position 45.2 (48). Interestingly, mutational studies involving removal of the charged nature of glutamate at position 12 and aspartate at position 13 in CH2 (adjacent to the AB/helix loop) and glutamate at position 109 in CH3 (in the FG loop) appear to have little effect on the ability of the Abs to interact with CD89 (49). Similarly, the substitution of charged glutamate to neutral glutamine at position 45.2 in NHPs does not appear to disrupt this interaction, because recombinant macaque CD89 binds to macaque IgA as well as to both human IgA isotypes.

Previously we have shown that macaque CD89 is highly homologous to its human counterpart, and that macaque and human CD89 share a common expression pattern on different cell types (35). Here, we show that macaque CD89 is able to bind to its native ligand as well as to both human IgA1 and IgA2. Furthermore, we show that macaque IgA binding is enhanced in the presence of the Ag (NIP (5) BSA). Interestingly, blocking of macaque CD89 N-glycosylation reduced CD89 expression and possibly the ability of the residual CD89 to bind IgA. It will be interesting to determine whether or not similar effects characterize the IgA/CD89 interaction in humans. Indeed, NHPs might represent the only valid model to study this interaction, as mice, the preferred immunological model, lack CD89 (50). In addition, studies focusing on modeling the role of CD89 in IgA nephropathy, including those using mice transgenic for human CD89, have given conflicting results (51, 52, 53).

Clearly, to select a specific NHP model for each experimental protocol, it is necessary to confirm and fully understand the extent of the variations existing between them. Selecting or breeding animals that are well characterized and as homogenous as possible in immune response genes will improve these models. Indeed, rhesus macaques are characterized by an extremely high polymorphism of MHC genes (54, 55). The high degree of IGHA gene polymorphism existing in NHP species represents the first and, for the moment, only description of high levels of intraspecies IGHA heterogeneity. Despite the presence of this polymorphism, the similarity of the IgA/CD89 interaction between macaques and humans suggests that these models appear suitable for the testing of IgA-based therapeutics. Clearly, the system described in this study for the generation of recombinant NHP IgA molecules will provide an invaluable tool for future studies designed to characterize the functional properties of the IgA corresponding to the various identified genes and represents a first step for the generation of NHP secretory IgA.


   Acknowledgment
 
We thank Francois Villinger for helpful comments and discussion of the manuscript.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported in part by the National Institutes of Health AIDS Research and Reference Reagent Program, by the Research Program Enhancement from the Georgia State University Office of Research and Sponsored Programs, and by the Georgia Research Alliance. Support for K.A.R. was provided by the Molecular Basis of Disease program at Georgia State University. Back

2 The findings and conclusions in this report are those of the authors and do not necessarily represent the views of the National Institutes of Health and the Agency for Toxic Substances and Disease Registry. Back

3 Address correspondence and reprint requests to Dr. Roberta Attanasio, Department of Biology, Georgia Sate University, P.O. Box 4010, Atlanta, GA 30302. E-mail address: rattanasio{at}gsu.edu Back

4 Abbreviations used in this paper: NHP, nonhuman primate; NIP, 5-iodo-4-hydroxy-3-nitrophenacetyl; MFI, mean fluorescence intensity. Back

Received for publication August 3, 2007. Accepted for publication January 21, 2008.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Carlsson, H. E., S. J. Schapiro, I. Farah, J. Hau. 2004. Use of primates in research: A global overview. Am. J. Primatol. 63: 225-237. [Medline]
  2. Yang, X. D., J. R. Corvalan, P. Wang, C. M. Roy, C. G. Davis. 1999. Fully human anti-interleukin-8 monoclonal antibodies: potential therapeutics for the treatment of inflammatory disease states. J. Leukocyte Biol. 66: 401-410. [Abstract]
  3. Yang, X. D., X. C. Jia, J. R. Corvalan, P. Wang, C. G. Davis, A. Jakobovits. 1999. Eradication of established tumors by a fully human monoclonal antibody to the epidermal growth factor receptor without concomitant chemotherapy. Cancer Res. 59: 1236-1243. [Abstract/Free Full Text]
  4. Hinton, P. R., M. G. Johlfs, J. M. Xiong, K. Hanestad, K. C. Ong, C. Bullock, S. Keller, M. T. Tang, J. Y. Tso, M. Vasquez, N. Tsurushita. 2004. Engineered human IgG antibodies with longer serum half-lives in primates. J. Biol. Chem. 279: 6213-6216. [Abstract/Free Full Text]
  5. Hahn, C. S., O. G. French, P. Foley, E. N. Martin, R. P. Taylor. 2001. Bispecific monoclonal antibodies mediate binding of dengue virus to erythrocytes in a monkey model of passive viremia. J. Immunol. 166: 1057-1065. [Abstract/Free Full Text]
  6. Weinberg, A. D., C. Thalhofer, N. Morris, J. M. Walker, D. Seiss, S. Wong, M. K. Axthelm, L. J. Picker, W. J. Urba. 2006. Anti-OX40 (CD134) administration to nonhuman primates: immunostimulatory effects and toxicokinetic study. J. Immunother. 29: 575-585. [Medline]
  7. ‘t Hart, B. A., H. P. Brok, E. Remarque, J. Benson, G. Treacy, S. Amor, R. Q. Hintzen, J. D. Laman, J. Bauer, E. L. Blezer. 2005. Suppression of ongoing disease in a nonhuman primate model of multiple sclerosis by a human-anti-human IL-12p40 antibody. J. Immunol. 175: 4761-4768. [Abstract/Free Full Text]
  8. Rogers, K. A., F. Scinicariello, R. Attanasio. 2006. IgG Fc receptor III homologues in nonhuman primate species: genetic characterization and ligand interactions. J. Immunol. 177: 3848-3856. [Abstract/Free Full Text]
  9. Hexham, J. M., L. Carayannopoulos, J. D. Capra. 1997. Structure and function in IgA. Chem. Immunol. 65: 73-87. [Medline]
  10. Janoff, E. N., C. Fasching, J. M. Orenstein, J. B. Rubins, N. L. Opstad, A. P. Dalmasso. 1999. Killing of Streptococcus pneumoniae by capsular polysaccharide-specifc polymeric IgA, complement and phagocytes. J. Clin. Invest. 104: 1139-1147. [Medline]
  11. van Egmond, M., C. A. Damen, A. B. van Spriel, G. Vidarsson, E. van Garderen, J. G. van de Winkel. 2001. IgA and the IgA Fc receptor. Trend. Immunol. 22: 205-211.
  12. Yan, H., M. E. Lamm, E. Bjorling, Y. T. Huang. 2002. Multiple functions of IgA in mucosal defense against viruses: an in vitro measles virus model. J. Virol. 76: 10972-10979. [Abstract/Free Full Text]
  13. Langford, T. D., M. P. Housley, M. Boes, J. Chen, M. F. Kagnoff, F. D. Gillin, L. Eckmann. 2002. Central importance of IgA in host defense against Giardia spp. Infect. Immun. 70: 11-18. [Abstract/Free Full Text]
  14. Motegi, Y., H. Kita, M. Kato, A. Morikawa. 2000. Role of secretory IgA, secretory component and eosinophils in mucosal inflammation. Int. Arch. Allergy Immunol. 122: S25-S27.
  15. Pleass, R. J., J. I. Dunlop, C. M. Anderson, J. M. Woof. 1999. Identification of residues in the CH2/CH3 domain interface of IgA essential for interaction with the human Fc{alpha} receptor CD89. J. Biol. Chem. 274: 23508-23514. [Abstract/Free Full Text]
  16. Goldblum, R. M.. 1990. The role of IgA in local immune protection. J. Clin. Immunol. 10: 64S-70S. [Medline]
  17. van der Boog, P. J., G. van Zandbergen, J. W. de Fijter, N. Klar-Mohamad, A. van Seggelen, P. Brandtzaeg, M. R. Daha, C. van Kooten. 2002. FcalphaRI/CD89 circulates in human serum covalently linked in a polymeric state. J. Immunol. 168: 1252-1258. [Abstract/Free Full Text]
  18. Flanagan, J. G., M. P. Lefranc, T. H. Rabbitts. 1984. Mechanisms of divergence and convergence of the human immunoglobulin {alpha} 1 and {alpha} 2 constant region gene sequences. Cell 36: 681-688. [Medline]
  19. Lefranc, M.-P., G. Lefranc. 2001. The Immunoglobulin FactsBook Academic Press, San Diego, CA.
  20. Kawamura, S., H. Tanabe, Y. Watanabe, K. Kurosaki, N. Saitou, S. Ueda. 1991. Evolutionary rate of immunoglobulin {alpha} noncoding region is greater in hominoids than in Old World monkeys. Mol. Biol. Evol. 8: 743-752. [Abstract]
  21. Shimizu, A., N. Takahashi, Y. Yaoita, T. Honjo. 1982. Organization of the constant-region gene family of the mouse immunoglobulin heavy chain. Cell 28: 499-506. [Medline]
  22. Sumiyama, K., N. Saitou, S. Ueda. 2002. Adaptive evolution of the IgA hinge region in primates. Mol. Biol. Evol. 19: 1093-1099. [Abstract/Free Full Text]
  23. Sumiyama, K., S. Kawamura, O. Takenaka, S. Ueda. 1998. A high sequence variety in the Immunoglobulin C {alpha} hinge region among Old World monkeys. Anthropo. Sci. 106: 31-39.
  24. Kawamura, S., K. Omoto, S. Ueda. 1990. Evolutionary hypervariability in the hinge region of the immunoglobulin {alpha} gene. J. Mol. Biol. 215: 201-206. [Medline]
  25. Scinicariello, F., R. Attanasio. 2001. Intraspecies heterogeneity of immunoglobulin {alpha}-chain constant region genes in rhesus macaques. Immunology 103: 441-448. [Medline]
  26. Scinicariello, F., F. Masseoud, L. Jayashankar, R. Attanasio. 2006. Sooty mangabey (Cercocebus torquatus atys) IGHG and IGHA genes. Immunogenetics 58: 955-965. [Medline]
  27. Phillips-Quagliata, J. M.. 2002. Mouse IgA allotypes have major differences in their hinge regions. Immunogenetics 53: 1033-1038. [Medline]
  28. Navarro, P., R. K. Christenson, G. Ekhardt, B. Bosworth, J. K. Lunney, M. Rothschild, J. Lemke, J. E. Butler. 2000. Genetic differences in the frequency of the hinge variants of porcine IgA is breed dependent. Vet. Immunol. Immunopathol. 73: 287-295. [Medline]
  29. Presta, L. G.. 2002. Engineering antibodies for therapy. Curr. Pharm. Biotechnol. 3: 237-256. [Medline]
  30. Lefranc, M.-P., V. Giudicelli, Q. Kaas, E. Duprat, J. Jabado-Michaloud, D. Scaviner, C. Ginestoux, O. Clement, D. Chaume, G. Lefranc. 2005. IMGT, the international ImMunoGeneTics information system. Nucleic. Acid Res. 33: D593-D597. [Abstract/Free Full Text]
  31. Lefranc, M.-P., C. Pommie, Q. Kaas, E. Duprat, N. Bosc, D. Guiraudou, C. Jean, M. Ruiz, I. Da Piedade, M. Rouard, E. Foulquier, V. Thouvenin, G. Lefranc. 2005. IMGT unique numbering for immunoglobulin and T cell receptor constant domains and Ig superfamily C-like domains. Dev Comp Immunol. 29: 185-203. [Medline]
  32. Scinicariello, F., C. N. Engleman, L. Jayashankar, H. M. McClure, R. Attanasio. 2004. Rhesus macaque antibody molecules: sequences and heterogeneity of {alpha} and {gamma} constant regions. Immunology 111: 66-74. [Medline]
  33. Norderhaug, L., T. Olafsen, T. E. Michaelsen, I. Sandlie. 1997. Versatile vectors for transient and stable expression of recombinant antibody molecules in mammalian cells. J. Immunol. Methods. 204: 77-87. [Medline]
  34. Oi, V. T., S. L. Morrison, L. A. Herzenberg, P. Berg. 1983. Immunoglobulin gene expression in transformed lymphoid cells. Proc. Natl. Acad. Sci. USA 80: 825-829. [Abstract/Free Full Text]
  35. Rogers, K. A., F. Scinicariello, R. Attanasio. 2004. Identification and characterization of macaque CD89 (IgA Fc Receptor). Immunology 113: 178-186. [Medline]
  36. Qiu, J., G. P. Brackee, A. G. Plaut. 1996. Analysis of the specificity of bacterial immunoglobulin I (IgA) proteases by a comparative study of ape serum IgAs as substrates. Infect. Immun. 64: 933-937. [Abstract]
  37. Chintalacharuvu, K. R., P. D. Chuang, A. Dragoman, C. Z. Fernandez, J. Qiu, A. G. Plaut, K. R. Trinh, F. A. Gala, S. L. Morrison. 2003. Cleavage of the human immunoglobulin A1 (IgA1) hinge region by IgA1 protease requires structures in the Fc region of IgA. Infect. Immun. 71: 2563-2570. [Abstract/Free Full Text]
  38. Drescher, B., T. Witte, R. E. Schmidt. 2003. Glycosylation of Fc{gamma}RIII in N163 as mechanism of regulation receptor affinity. Immunology 110: 335-340. [Medline]
  39. Letvin, N. L.. 2006. Progress and obstacles in the development of an AIDS vaccine. Nat. Rev. Immunol. 6: 930-939. [Medline]
  40. Joag, S. V., R. J. Adams, L. Foresman, D. Galbreath, M. C. Zink, D. M. Pinson, H. McClure, O. Narayan. 1994. Pathogenesis of SIVmac infection in Chinese and Indian rhesus macaques: effects of splenectomy on virus burden. Virology 200: 436-446. [Medline]
  41. Ling, B., R. S. Veazey, A. Luckay, C. Penedo, K. Xu, J. D. Lifson, P. A. Marx. 2002. SIV(mac) pathogenesis in rhesus macaques of Chinese and Indian origin compared with primary HIV infections in humans. AIDS 16: 1489-1496. [Medline]
  42. Trichel, A. M., P. A. Rajakumar, M. Murphey-Corb. 2002. Species-specific variation in SIV disease progression between Chinese and Indian subspecies of rhesus macaque. J. Med. Primatol. 31: 171-178. [Medline]
  43. Marthas, M. L., D. Lu, M. C. Penedo, A. G. Hendrickx, C. J. Miller. 2001. Titration of a SIVmac251 stock by vaginal inoculation of Indian and Chinese origin rhesus macaques: transmission efficiency, viral loads, and antibody responses. AIDS Res. Hum. Retroviruses. 17: 1455-1466. [Medline]
  44. Reimann, K. A., P. A. Parker, M. S. Seaman, K. Beaudry, M. Beddall, L. Peterson, K. C. Williams, R. S. Veazey, D. C. Montefiori, J. R. Mascola, G. J. Nabel, N. L. Letvin. 2005. Pathogenicity of simian-human immunodeficiency virus SHIV-89.6P and SIVmac is attenuated in cynomolgus macaques and associated with early T-lymphocyte responses. J. Virol. 79: 8878-8885. [Abstract/Free Full Text]
  45. Villinger, F., T. M. Folks, S. Lauro, J. D. Powell, J. B. Sundstrom, A. Mayne, A. A. Ansari. 1996. Immunological and virological studies of natural SIV infection of disease-resistant nonhuman primates. Immunol. Lett. 51: 59-68. [Medline]
  46. Picker, L. J.. 2006. Immunopathogenesis of acute AIDS virus infection. Curr. Opin. Immunol. 18: 399-405. [Medline]
  47. Brenchley, J. M., D. A. Price, T. W. Schacker, T. E. Asher, G. Silvestri, S. Rao, Z. Kazzaz, E. Bornstein, O. Lambotte, D. Altmann, B. R. Blazar, B. Rodriguez, L. Teixeira-Johnson, A. Landay, J. N. Martin, F. M. Hecht, L. J. Picker, M. M. Lederman, S. G. Deeks, D. C. Douek. 2006. Microbial translocation is a cause of systemic immune activation in chronic HIV infection. Nat. Immunol. 12: 1365-1371.
  48. Herr, A. B., E. R. Ballister, P. J. Bjorkman. 2003. Insights into IgA-mediated immune responses from the crystal structures of human FcalphaRI and its complex with IgA1-Fc. Nature 423: 614-620. [Medline]
  49. Pleass, R. J., P. K. Dehal, M. J. Lewis, J. M. Woof. 2003. Limited role of charge matching in the interaction of human immunoglobulin A with the immunoglobulin A Fc receptor (Fc{alpha}RI) CD89. Immunology 109: 331-335. [Medline]
  50. Decot, V., G. Woerly, M. Loyen, S. Loiseau, B. Quatannens, M. Capron, D. Dombrowicz. 2005. Heterogeneity of expression of IgA receptors by human, mouse, and rat eosinophils. J. Immunol. 174: 628-635. [Abstract/Free Full Text]
  51. Launay, P., B. Grossetête, M. Arcos-Fajardo, E. Gaudin, S. P. Torres, L. Beaudoin, N. Patey-Mariaud de Serre, A. Lehuen, R. C. Monteiro. 2000. Fc{alpha} receptor (CD89) mediates the development of immunoglobulin A (IgA) nephropathy (Berger’s disease). Evidence for pathogenic soluble receptor-IgA complexes in patients and CD89 transgenic mice. J. Exp. Med. 191: 1999-2009. [Medline]
  52. Van der Boog, P. J. M., J. W. de Fijter, C. van Kooten, R R. van der Holst, A. van Seggelen, L. A. van Es, M. R. Daha. 2003. Complexes of IgA with FcalphaI/CD89 are not specific for primary IgA nephropathy. Kidney Int. 63: 514-521. [Medline]
  53. Van der Boog, P. J. M., C. van Kooten, G. van Zandbergen, N. Klar-Mohamad, Bb. Oortwijn, N. A. Bos, A. van Remoortere, C. H. Hokke, J. W. de Fijter, M. R. Daha. 2004. Injection of recombinant FcalphaRI/CD89 in mice does not induce mesangial IgA deposition. Nephrol. Dial. Transplant. 19: 2729-2736. [Abstract/Free Full Text]
  54. Penedo, M. C., R. E. Bontrop, C. M. Heijmans, N. Otting, R. Noort, A. J. Rouweler, N. de Groot, N. G. de Groot, T. Ward, G. G. Doxiadis. 2005. Microsatellite typing of the rhesus macaque MHC region. Immunogenetics 57: 198-209. [Medline]
  55. Muhl, T., M. Krawczak, P. Tan Haaft, G. Hunsmann, U. Saurmann. 2002. MHC class I alleles influence set-point viral load and survival time in simian immunodeficiency virus-infected rhesus monkeys. J. Immunol. 169: 3438-3446. [Abstract/Free Full Text]
  56. Lefranc, M.-P., T. H. Rabbits. 1984. Human immunoglobulin heavy chain A2 gene allotype determination by restriction fragment length polymorphism. Nucleic Acids Res. 12: 1303-1311. [Abstract/Free Full Text]
  57. Bensmana, M., P. Chuchana, P. G. Lefranc, M.-P. Lefranc. 1991. Sequence of the CH1 and hinge-CH2 exons of the human immunoglobulin IGHA2 A2m(2) allele: comparison with the nonallelic and allelic IGHA genes. Cytogenet. Cell Genet. 56: 128[Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rogers, K. A.
Right arrow Articles by Attanasio, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rogers, K. A.
Right arrow Articles by Attanasio, R.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS