The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


The Journal of Immunology, 2008, 180, 3926 -3937
Copyright © 2008 by The American Association of Immunologists, Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Butler, N. S.
Right arrow Articles by Perlman, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Butler, N. S.
Right arrow Articles by Perlman, S.

Structural and Biological Basis of CTL Escape in Coronavirus-Infected Mice1

Noah S. Butler2,*,{dagger}, Alex Theodossis2,{ddagger}, Andrew I. Webb§, Michelle A. Dunstone{ddagger}, Roza Nastovska§, Sri Harsha Ramarathinam§, Jamie Rossjohn{ddagger}, Anthony W. Purcell3,§ and Stanley Perlman3,*,{dagger}

* Department of Microbiology and {dagger} Immunology Graduate Program, University of Iowa, Iowa City, IA 52242; {ddagger} The Protein Crystallography Unit, Department of Biochemistry and Molecular Biology, School of Biomedical Sciences, Monash University, Clayton; and § Department of Biochemistry and Molecular Biology, Bio21 Molecular Science and Biotechnology Institute, University of Melbourne, Parkville, Victoria, Australia


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Cytotoxic T lymphocyte escape occurs in many human infections, as well as mice infected with the JHM strain of mouse hepatitis virus, which exhibit CTL escape variants with mutations in a single epitope from the spike glycoprotein (S510). In all CTL epitopes prone to escape, only a subset of all potential variants is generally detected, even though many of the changes that are not selected would result in evasion of the T cell response. It is postulated that these unselected mutations significantly impair virus fitness. To define more precisely the basis for this preferential selection, we combine x-ray crystallographic studies of the MHC class I (Db)/S510 complexes with viral reverse genetics to identify a prominent TCR contact residue (tryptophan at position 4) prone to escape mutations. The data show that a mutation that is commonly detected in chronically infected mice (tryptophan to arginine) potently disrupts the topology of the complex, explaining its selection. However, other mutations at this residue, which also abrogate the CTL response, are never selected in vivo even though they do not compromise virus fitness in acutely infected animals or induce a significant de novo CTL response. Thus, while structural analyses of the S510/Db complex provide a strong basis for why some CTL escape variants are selected, our results also show that factors other than effects on virus fitness limit the diversification of CD8 T cell epitopes.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Cytotoxic T lymphocytes recognize viral Ags displayed on the surface of infected cells in the context of MHC class I (reviewed in Ref. 1). CTL that recognize their cognate Ags are critically important for eliminating virus-infected cells. The resultant immune pressure can result in the selective outgrowth of viruses that have undergone mutation in targeted, immunodominant CD8 T cell epitopes. These CTL escape viruses contribute to enhanced pathogenesis and disease progression (2, 3). Such escape viruses have been identified in humans infected with HIV and hepatitis C virus (HCV)4, and in nonhuman primates infected with SIV and HCV (reviewed in Ref. 4). CTL escape in HIV-infected patients has been associated with progression to AIDS (5). Sequential mutation of CD8 T cell epitopes in nonhuman primates infected with HCV is also strongly associated with persistent infection and disease progression (6). Although these data provide strong evidence for the clinical relevance of CTL escape, only some CD8 T cell epitopes undergo escape and, within individual epitopes, specific residues are mutated preferentially. The limited variability of certain CD8 T cell epitopes is postulated to reflect the functional constraints of mutation on virus fitness, although this has not been directly demonstrated in vivo (7, 8, 9, 10, 11). Other factors may also contribute to the selection of a limited subset of CTL escape viruses, such as the development of de novo CD8 T cell responses (12, 13, 14) and cross-recognition of variant epitopes by existing CTL, which has been described in the setting of HIV infection (15). Furthermore, and paradoxically, CTL escape is sometimes detected in the presence of a robust immune response, without resulting in apparent enhancement of virus replication or disease progression. Perhaps the best example of this is shown in HIV-infected HLA-B57 and HLA-B*5801-positive individuals, in which mutation in a dominant CTL epitope, TW10, commonly occurs but is not associated with progression to AIDS (16, 17, 18). Likewise, SIV-infected rhesus monkeys expressing Mamu-A*01 progress to AIDS more slowly than do monkeys expressing other MHC class I haplotypes (19, 20), despite frequent escape in a well-defined immunodominant CD8 T cell epitope, CM9, restricted by Mamu-A*01. The obvious explanation for these observations is that virus fitness has been compromised by mutation in TW10 and CM9 epitopes. Consistent with this, these mutations occur early in the infection, but variant virus is not predominant until disease progression occurs, and at least in the case of CM9, epitope variants are only selected in the presence of a second compensatory mutation that restores viral core assembly to wild-type (WT) levels (4, 20, 21).

Because CTL escape variant viruses are most commonly detected only in humans infected with HIV or HCV, and in nonhuman primates infected with SIV, mutational effects on virus fitness or prospective studies of de novo CD8 T cell responses that may suppress CTL escape variant virus replication are difficult or impossible to test in vivo. Thus, current data that define the basis for the selection of CTL escape variant viruses are, in large part, correlative. CTL escape also commonly occurs in C57BL/6 (B6) mice persistently infected with neurovirulent mouse hepatitis virus strain JHM (JHMV) and correlates with disease progression (22, 23). In these studies, suckling mice are inoculated with virus and nursed by JHMV-immune dams, resulting in maternal Ab-mediated protection from lethal acute encephalitis. However, between days 21 and 60 postinfection (p.i.), a proportion of mice develop hindlimb paresis/paralysis and demyelination on histological examination. Infectious virus is present in mice with clinical disease and is mutated in the immunodominant epitope S510 (spanning residues 510–518 of the spike (S) glycoprotein, CSLWNGPHL, H-2Db-restricted). A subdominant CD8 T cell epitope from the same Ag (epitope S598, spanning residues 598–605 of the S glycoprotein, RCQIFANI, H-2Kb-restricted) is never mutated. In contrast to human and nonhuman primate infections, this murine model is easily manipulable, and reverse-genetic approaches allow the introduction of mutations into the JHMV genome (24), allowing in vivo testing of mutated viruses. Importantly, mutations are detected within epitope S510, facilitating direct in vitro and in vivo studies of the mechanisms of CTL escape.

As in humans or nonhuman primates infected with HCV, HIV, or SIV (10, 11, 25, 26), only a limited subset of possible CTL escape mutations in epitope S510 are detected in mice persistently infected with JHMV (22, 27, 28, 29). There is also selectivity within the set of mutations observed at a given residue. For example, almost 90% of CTL escape variants at position 4 of the S510 epitope (Wp4) are tryptophan to arginine substitutions (W513R) (Table I). These apparent constraints on antigenic plasticity are not predicted, as the region of the spike glycoprotein encoding epitope S510 is prone to mutation and deletion (reviewed in Ref. 30). Thus, the basis for the selection of a limited subset of CTL escape variant viruses in mice persistently infected with JHMV is unclear.


View this table:
[in this window]
[in a new window]

 
Table I. CTL escape mutations identified in mice persistently infected with MHV strain JHMa

 
Herein, we have solved the crystal structure of the H-2Db/S510 complex to gain insight into how specific mutations in the epitope abrogate recognition by CD8 T cells. CTL escape is observed in both MHC-anchoring residues and TCR-accessible residues. However, of the two most prominent solvent-accessible residues, only the tryptophan at position 4 is observed to generate escape variants. Molecular virological and immunological studies have been used to dissect out the basis of the near complete bias of tryptophan to arginine substitution at this position in escape variants isolated from afflicted mice.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
X-ray crystallographic studies

Crystals of H-2DbS510-Aba were grown at 21°C in 0.1 M of citrate (pH 7.5), 28% polyethylene glycol (PEG) 3350, and 0.2 M of LiSO4 using a protein concentration of 3 mg/ml. Crystals were cryoprotected by equilibration against mother liquor containing 5% glycerol and flash frozen by placement in a nitrogen stream. The 2.1 Å dataset were collected at the Advanced Photon Source (Chicago, IL) synchrotron facility. Crystals of H-2DbS510W513S-Aba were grown at 21°C in 0.1 M of citrate (pH 6.4), 28% PEG 3350, and 0.15 M of LiSO4 using a protein concentration of 6 mg/ml. Crystals were cryoprotected using perfluoropolyether before flash freezing. The 2.7-Å dataset was collected at the Australian Synchrotron Facility in Melbourne, Australia. In both cases the data were integrated in Mosflm (31) and scaled/merged using Scala (32). The structures were solved by molecular replacement in Phaser (33) against a previously solved H-2Db complex (PDBid: 1BZ9). The resulting models were subjected to iterative cycles of refinement in Refmac5 (34), followed by model building/correction in Coot (35). The solvent structures were built using ARP/wARP (36) and then Coot. A summary of the processing and refinement statistics is presented in Table II.


View this table:
[in this window]
[in a new window]

 
Table II. Data collection and refinement statistics

 
Viruses

Recombinant, WT, and epitope S510 variants of JHMV were generated using overlapping extension PCR as previously described (24, 37). Primers that overlapped the tryptophan at residue 513 of the spike glycoprotein were (5' to 3') W513G: fwd, GTGAGTGTTCTCTTGGGAATGGGCCCCATTTGCGCTCGGC, rev, AGCGCAAATGGGGCCCATTCCCAAGAGAACACTCAC; W513L: fwd, GTGAGTGTTCTCTTTTGAATGGGCCCCATTTGCGCTCGGC, rev, AGCGCAAATGGGGCCCATTCAAAAGAGAACACTCAC; W513S: fwd, GTGAGTGTTCTCTTTCGAATGGGCCCCATTTGCGCTCGGC, rev, AGCGCAAATGGGGCCCATTCGAAAGAGAACACTCAC; W513R: fwd, GTGAGTGTTCTCTTCGGAATGGGCCCCATTTGCGCTCGGC, rev, AGCGCAAATGGGGCCCATTCCGAAGAGAACACTCAC. The outer primers were fwd, TGTTGATTGCGCCAGCAGCTACATTAG; and rev, ACCTACGGATTGAACGCTATCATTGAC. Recombinant viruses encoding variant S510 epitopes (rJ.SW513G, rJ.SW513L, rJ.SW513S, rJ.SW513R) were selected, propagated, and titered as previously described (38). At least two independent isolates of each recombinant virus were plaque purified and analyzed.

Mice

Specific pathogen-free B6 and BALB/c mice were obtained from National Cancer Institute (Bethesda, MD). Suckling mice were infected intranasally with 2–4 x 104 PFU of recombinant JHMV at 10 days of age and nursed by JHMV-immune dams (39). After weaning, survivors of the acute infection were monitored for development of hindlimb paralysis out to 60 days p.i.. For experiments using epitope S510 variant viruses, half of each litter served as an internal control: one half of each litter was infected with variant virus, and the other half was infected with recombinant WT JHMV (rJ). All animal studies were approved by the University of Iowa Animal Care and Use Committee.

RNA sequence analysis

Total RNA was purified with TRIzol (Invitrogen) from the CNS of infected mice. The region encompassing epitope S510 was amplified by RT-PCR and PCR products sequenced directly as previously described (22).

One-step viral growth kinetics

Virus was inoculated onto confluent 17Cl-1 monolayers in a 12-well plate at a multiplicity of infection (MOI) of 1.0. Groups of cells were harvested at the indicated time points and total virus (cell-associated and cell-free) was titered as previously described (39).

In vitro and in vivo virus competition assays

For in vitro competition assays, equal PFU of rJ and rJ.SW513G, rJ.SW513L, rJ.SW513S, or rJ.SW513R were combined (each at an MOI of 1) and inoculated onto confluent 17Cl-1 monolayers. Cell-free supernatants from infected cultures were sequentially passaged every 24 h for 4 days. At passages 2 and 4, total RNA was isolated from infected cells, and the relative representation of WT vs variant virus template was determined by RT-PCR followed by direct sequencing of PCR products. This assay can specifically detect a given species of template when that species comprises at least 20% of a heterogeneous pool (40). Two isolates of each rJ.SW513 variant were assayed in triplicate, and the results from all six samples were pooled. For in vivo competition assays, equal PFU (2–4 x 104) of rJ and rJ.SW513G, rJ.SW513L, rJ.SW513S, or rJ.SW513R were combined and mice were inoculated intranasally. Total RNA was harvested from the brains of mice 7 days p.i. and the relative representation of WT vs variant template was determined as described above.

Dendritic cell-based vaccination

LPS-matured dendritic cells (5 x 105) (DC) were prepared, coated with OVA or S510 peptides, and injected via tail vein into groups of 5-wk-old mice as previously described (41). Seven days following DC vaccination, mice were infected i.p. with 3 x 105 PFU rJ.SW513G or rJ.SW513R. Seven days later, spleens were harvested from mice and the frequencies of epitope-specific CD8 T cells were determined by ex vivo peptide stimulation and intracellular cytokine staining as described below.

Intracellular cytokine staining and flow cytometry

Mononuclear cells were harvested from the brains of acutely ill mice 7 days p.i. and analyzed for expression of IFN-{gamma} by an intracellular cytokine assay as previously described (42). Unless otherwise noted, peptides corresponding to the native S510 epitope or each S510 variant epitope were used at a final concentration of 1 µM. Cells were analyzed using a FACScan flow cytometer (BD Biosciences). Data sets were analyzed using FlowJo software (TreeStar). All Abs and reagents were purchased from BD Pharmingen.

Peptide binding and stability assays

In some experiments, peptide binding was assessed using RMA-S cells as previously described (22). In other cases, the thermostability of recombinant MHC-peptide complexes were used to assess peptide binding using circular dichroism (CD). CD spectra were measured on a Jasco 810 spectropolarimeter using a thermostatically controlled cuvette at temperatures between 20 and 90°C as described in detail elsewhere (43, 44). Far-UV spectra from 195 to 250 nm were collected and averaged over 10 individual scans; 218 measurements for the thermal melting experiments were made at intervals of 0.1°C at a rate of 1°C/min. The midpoint of thermal denaturation (Tm) for each protein was calculated by taking the first derivative of the elipticity data and identifying the inflection point.

T cell functional avidity determination

Mononuclear cells were harvested from the brains of individual rJ-, rJ.SW513G-, rJ.SW513L-, rJ.SW513S-, or rJ.SW513R-infected mice 7 days p.i. and stimulated ex vivo in the presence of EL-4 cells pulsed with 10-fold dilutions of the relevant peptide. After 5.5 h, cells were stained for intracellular IFN-{gamma} as described above. For each epitope-specific population, data were normalized to the frequency of Ag-specific CTL recorded at the highest titration of peptide (1 µM).

TCR Vβ-chain usage

Cells were harvested from the CNS of mice 7 days p.i. and stimulated ex vivo with S510 or S510W513R peptides. Cell aliquots were subsequently stained for CD8 (PE-Cy7-anti-CD8{alpha}) and each Vβ-chain (FITC-anti-Vβ2, 3, 4, 5.1/5.2, 6, 7, 8, 9, 10b, 11, 12, 13, or 14) followed by intracellular staining for IFN-{gamma} (PE-anti-IFN-{gamma}). Data were collected using a BD LSR II instrument (BD Biosciences) at the University of Iowa Flow Cytometry Facility and are expressed as the frequency of Ag-specific CD8 T cells that express each Vβ-chain.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Crystal structure of immunodominant JHMV CD8 T cell epitope H-2Db/S510–518

To evaluate the molecular nature of residues targeted for CTL escape during JHMV infection, we determined the crystal structure of the immunodominant JHMV CD8 T cell epitope H-2Db/S510–518 (S510; CSLWNGPHL). Initially, we observed that crystals of diffraction quality did not readily form due to oxidation of the N-terminal cysteine residue of S510 during in vitro refolding of the MHC-peptide complex. Substitution of this cysteine residue with L-{alpha}-aminobutyric acid (Aba), an isostereomer of cysteine, has previously been used to stabilize peptide epitopes (45). Aba-modified peptides are impervious to oxidative damage, cysteinylation, or dimerization, and in data not shown we demonstrated that Aba-modified S510 was equally stimulatory as native peptide when reacted with CNS-derived lymphocytes in IFN-{gamma} intracellular staining assays. Furthermore, no additive effects were observed when mixtures of native and Aba-modified peptides were used to stimulate S510-specific CTL. Collectively, these results indicate that both peptides stimulate the same population of S510-specific CTL and validate the use of S510-Aba peptides for x-ray crystallographic analyses.

The structure of H-2Db/S510-Aba consists of four heterodimers in the asymmetric unit, with each copy containing the S510-Aba peptide bound in the H chain’s Ag-binding cleft (Fig. 1). In all four heterodimers the S-510 peptide, residues are highly ordered (Table III) and occupy virtually identical conformations (with root mean square deviation (rmsd) values of only 0.14 Å for all peptide atoms). Therefore, unless otherwise stated the structural features described below were observed in four copies.


Figure 1
View larger version (79K):
[in this window]
[in a new window]

 
FIGURE 1. Refined structures of WT and W513S S510-Aba bound to H-2Db. Cartoon representations of the Ag binding cleft in the refined H-2Db structures, where the {alpha}2 helix (residues 124–180) has been removed to reveal the bound S510-Aba peptides. The peptide and selected residues of the H2-Db H chain are shown in stick format. A, Refined model of H-2Db in complex with epitope H-2Db/S510–518 (S510; CSLWNGPHL). The peptide is shown in green and the H-2Db H chain in cyan. Key hydrogen bonding interactions are represented by dashed lines. Peptide residues are labeled in italics. B, Equivalent view in the structure of H-2Db in complex with the W513S mutant of S510-Aba. H-2Db is colored slate and the peptide is in yellow. C, Superposition of the WT and W513S peptides in their complex with H-2Db. D, Cartoon representation of the H-2Db Ag binding cleft as seen from above, with the WT S510-Aba peptide shown in stick format. Overlay: The unbiased Fo-Fc map density for the peptide contoured at 2 {varsigma}. E, Equivalent view of the W513S complex.

 

View this table:
[in this window]
[in a new window]

 
Table III. B factor analysis for the WT and W513S mutant S510-Aba peptidesa

 
The peptide adopts an extended conformation with a backbone kink at Pro7. The side chains of Trp4 and His8 extend prominently out of the cleft and are predicted to dominate T cell recognition. MHC-anchoring interactions are made by Asn5 and Leu9 (Table IV). The peptide is anchored within the cleft primarily at positions 1, 2, 5, and 9. Aba1 forms a hydrogen bond via its main chain with Tyr7, Tyr159, and Tyr171, while its side chain is positioned within hydrogen bonding distance of Lys66, suggesting a potential interaction for the original cysteine at that position. These interactions are consistent with a typical P1 amino acid complexed to H-2Db, and they confirm the role of Aba as a potent peptidomimetic (Fig. 2). Ser2 hydrogen bonds with Glu63 and Lys66, while Asn5 is hydrogen bonded to Gln70 and Gln97. The main chain of Leu9 hydrogen bonds with Ser77, Asn80, Tyr84, and Thr143, while its side chain is buried within a hydrophobic pocket formed by Trp73, Leu81, Leu95, Phe116, Tyr123 and, Trp147 (Fig. 2).


View this table:
[in this window]
[in a new window]

 
Table IV. Surface accessibility of the WT and W513S mutant S510-Aba peptidesa

 

Figure 2
View larger version (75K):
[in this window]
[in a new window]

 
FIGURE 2. Images of the WT and W513S mutant S510-Aba peptides bound to H-2Db. A, Cartoon representation of the refined model of H-2Db/S510-Aba showing the Ag binding cleft from the peptide’s N-terminus. All residues of S510-Aba (in green), as well as selected residues of the H-2Db H chain (in cyan), are shown in stick format. Dashed lines represent key interactions between S510-Aba and H-2Db. Also shown are residues of a crystallographically related molecule (in gray) involved in crystal contacts with the Ag binding cleft, as well as an ordered sulfate ion observed at the interface between symmetry-related peptide chains. Peptide residues are labeled in italics and residues from the symmetry-related molecule are labeled with an inverted comma. B, The H-2Db/S510-Aba Ag binding cleft viewed from the peptide’s C-terminal. A section of the {alpha}2 helix of the H chain has been removed to reveal the bound peptide. C and D, Equivalencies to A and B for the W513S H-2Db/S510–518 structure. In these images the H-2Db H chain is drawn in slate and the W513S mutant S510-Aba peptide is shown in yellow.

 
Unlike the anchoring residues, positions 3, 4, 6, 7, and 8 are involved in fewer interactions with H-2Db (Fig. 1A). Trp4 is hydrogen bonded via its main chain carbonyl with His155. Gly6 and Pro7 interact with Trp73 and Tyr156, while His8 interacts with Trp147 (Fig. 2).

Crystal structure of mutant W513SH-2Db/S510–518

We also determined the crystal structure of H-2Db in complex with the W513S mutant of S510 (Fig. 1B), which contains a tryptophan to serine substitution at position 4 of the peptide in addition to having the cysteine at position 1 replaced by Aba. The structure of W513S/H-2Db/S510–518 consists of two heterodimers in the asymmetric unit, with each copy containing the W513S S510-Aba peptide bound in the H chain’s Ag-binding cleft. In both heterodimers the W513S peptide residues appear highly ordered (Fig. 1, D and E, Tables II and III) and occupy virtually identical conformations (rmsd values of only 0.06 Å for all peptide atoms). The peptide adopted the same structure as observed in the WT complex (rmsd for peptide C-alpha atoms between the two structures is 0.35 Å) and forms equivalent interactions with H-2Db (Fig. 1C). The side chain of Ser4 is oriented in the same way as the C-beta and C-gamma atoms of Trp4 in the index peptide. The only notable deviations in structure are observed at positions 3 and 4, where the peptide backbone of the W513S mutant is shifted down into the cleft by ~0.7Å and is accompanied by a rearrangement in the side chain conformation of Leu3. These minor differences may be due to the loss of steric clashes at position 4 in the W513S mutant and may account for the enhanced thermostability of the mutant complex.

CTL escape targets both TCR-accessible and anchor residues within the S510 epitope

Mutations at anchor residues are the simplest way for CTL escape variants to be generated, because they result in failure of the variant sequence to bind to the MHC. Consistent with this assumption, >25% of all CTL escape variants bear mutations at positions 2 and 5 (Table I). Interestingly, no mutations at Leu9 were detected in mice, suggesting that mutation of anchor residues is not a global strategy for JHMV escape. Leu3, another buried amino acid residue, is also a common target of immune escape, while the partially buried Cys1 is never mutated in infected animals. Mutations are also commonly observed at Gly6 and Pro7, and such changes in these residues would most likely change the peptide’s backbone conformation affecting TCR recognition. Mutations at the two most solvent accessible residues, Trp4 and His8, are expected to directly influence TCR recognition; however, only mutations at position 4 are detected. Moreover, the mutation at position 4 is restricted to Trp to Arg changes in >90% of persistently infected mice (Table I).

These data highlight the surprising diversity of CTL escape variants in this model and suggest multiple mechanisms of T cell escape. Even more surprising is the conservation of some variants, such as the propensity of Trp4 to Arg4 mutants. Single nucleotide changes in the Trp4 could also result in mutations to Gly, Leu, Ser, and Cys. To begin to understand the basis of selectivity of CTL escape at position 4, we compared the serological stability and thermostability of the Db/S510 and four variant complexes (Arg4, Gly4, Leu4, and Ser4, also referred to as W513R/G/L/S) using the TAP1/2-deficient RMA-S cell line (46) and CD analyses. We found no difference in the ability of the variant peptides to bind H-2Db in epitope stabilization assays (Fig. 3A). However, individual substitutions at Trp4 altered the thermostability of epitope S510/H-2Db complexes. The Gly4 variant peptide was least able to stabilize the complex, relative to the other variant epitopes. This is consistent with a stabilizing role of van der Waals interactions between the indole side chain of the Trp residue and H-2Db. In contrast, the Ser4 variant epitope enhanced the stability of H-2Db complexes (Fig. 3B). Taken together, these results support the structural studies that indicate that position 4 of the S510 epitope is primarily involved in TCR recognition. However, some substitutions, such as Gly4 or Ser4, can also subtly influence the stability of the H-2Db/epitope complex.


Figure 3
View larger version (98K):
[in this window]
[in a new window]

 
FIGURE 3. H-2Db binding and surface accessibility of the S510-Aba peptide. A, RMA-S cells were incubated in the presence of the indicated concentrations of peptides corresponding to the native S510 epitope or each variant epitope and analyzed for surface H-2Db as described in Materials and Methods. Data are means ± SEM for four independent experiments. B, CD analysis of native epitope S510 and each variant epitope complexed with H-2Db. CD spectra were measured as described in Materials and Methods. C, Surface representation of H-2Db (cyan), showing the bound S510-Aba peptide in stick format. Those peptide residues where mutations are never observed have carbon atoms drawn in wheat color. Trp4 is drawn with yellow carbons, while the other residues for which mutations have been detected have green carbons. D, Identical view of the H-2Db/S510-Aba complex, but with a surface representation of the peptide. The color scheme use in C has been maintained. E–H, To gauge the effect of mutating Trp4 to either an Arg, Leu, Ser, or Gly, each of these residues was modeled at position 4 using Coot: (E) arginine, (F) leucine, (G) serine, and (H) glycine.

 
Next, we used the WT and W513S mutant H-2Db/S510 complexes as templates for modeling how the mutations at position 4 could influence binding to S510-specific TCR. Of the four mutants, only the arginine substitution cannot be accommodated within the space occupied by the tryptophan’s indole ring, due to unfavorable contacts between its guanadinium group and H-2Db, which results in an altered side chain orientation (Fig. 3, CH). Consequently, the side chain in the Arg4 variant would be expected to extend out of the Ag binding cleft and interfere with WT-specific CTL recognition, while the Leu and Gly mutations could be accommodated with minimal structural perturbations, as was the case for the Ser4 variant peptide complex. The difference in polarity and size between these residues and the native Trp, however, is substantial and is predicted to significantly affect TCR recognition.

rJ and Trp4 variant viruses are equally fit in tissue culture cells and in mice with acute encephalitis

The structural data highlight why mutation at Trp4 results in evasion of the epitope S510-specific CD8 T response, but they do not explain the lack of outgrowth of Gly4, Leu4, and Ser4 variant viruses in persistently infected mice. To directly test whether functional constraints on virus fitness explain these results, we generated a series of isogenic recombinant viruses encoding Gly4, Leu4, and Ser4 substitutions (herein referred to as rJ.SW513G, rJ.SW513L, and rJ.SW513S, respectively). Recombinant WT virus (rJ) and virus encoding the Arg4 substitution (rJ.SW513R) were also generated. We found no differences among the viruses in analyses of one-step growth kinetics in 17Cl-1 cells (Fig. 4A). Furthermore, there were no marked differences following in vitro competition assays in which relative recovery of rJ vs each variant was assessed by RT-PCR and sequencing (Fig. 4B). In general, rJ outgrew variant viruses in 17Cl-1 cells, although mutated virus was still detected after four passages in 50% or more of cultures (Fig. 4C). In vitro analyses may not reflect the relative replicative capacity of viruses within the intact animal. However, all of the variant viruses grew as least as well as rJ in B6 mice and in BALB/c (H-2d) mice, which do not recognize epitope S510 and therefore do not exert immune selection on this region of the virus (Fig. 4D).


Figure 4
View larger version (28K):
[in this window]
[in a new window]

 
FIGURE 4. In vitro and in vivo growth comparisons of rJ and rJ.SW513 variant viruses. A, 17Cl-1 cells were infected with rJ and rJ.SW513 variant viruses at an MOI of 1.0. Cells and supernatants were harvested at the indicated times, and titers were measured by plaque assay on Hela-MHVR cells as described in Materials and Methods. Data are means ± SEM for three independent experiments. B, Representative sequencing chromatograms from RT-PCR analyses of brain RNA samples in which only rJ (top), a mixture of rJ and rJ.SW513G (middle), or only rJ.SW513G (bottom) virus templates were detected. C, 17Cl-1 cells were infected with equal PFU of rJ and each variant (MOI of 1) and propagated for four passages. Total RNA was harvested from infected wells at passages 2 (left panel) and 4 (right panel) and relative representation of rJ or variant was determined as described in Materials and Methods. Data for passages 2 and 4 are pooled results obtained by analyzing 6 wells for each virus mixture. D, B6 mice (left panel) and BALB/c (right panel) mice were infected with virus mixtures consisting of equal PFU of rJ and each variant. Seven days later total RNA was harvested from the brains of infected mice and relative representation of virus template was determined via RT-PCR and direct sequencing of PCR products as described in Materials and Methods. Numbers in parentheses indicate the number of mice examined for each group. E, Survival analysis of maternal Ab-protected suckling mice infected with rJ or rJ.SW513 variant viruses. Mice were scored as deceased after developing clinical signs of hindlimb paralysis/paresis (day of tissue harvest).

 
Viruses encoding W513R/S but not W513G/L cause enhanced disease in Ab-protected infected mice

We previously showed that when Ab-protected, suckling mice are infected with naturally occurring CTL escape viruses, the mice exhibit increased morbidity and mortality, relative to infection with WT JHMV (23). Thus, as a measure of in vivo virus fitness, we infected maternal Ab-protected, suckling mice with WT or variant S510 recombinant viruses (Fig. 4E). As expected, ~80% of mice infected with rJ survived the acute infection. By comparison, rJ.SW513S and rJ.SW513R behaved as expected for true CTL escape variants, with only 20% of infected mice surviving the acute infection (death before 14 days p.i.). Less expected were the results for mice infected with rJ.SW513G and rJ.SW513L viruses: we found substantially less morbidity and mortality during infection with either virus when compared with rJ-infected mice. These results are remarkable given that both rJ.SW513G and rJ.SW513L viruses cause lethal encephalitis in mice not protected by maternal Abs, and they compete with rJ in acutely infected adult animals. This inability to cause encephalitis suggests that the Leu4 and Gly4 mutations would not outgrow rJ even if the mutations arose in persistently infected mice. As described below, this may reflect differences in cellular tropism or inflammatory milieu in persistently as opposed to acutely infected mice. Subsequently, we focused on the Ser4 mutation, which should be (but is not) selected in persistently infected mice.

Recombinant viruses bearing Arg4, but not Ser4, substitutions prime CTL responses

Another possibility is that de novo CTL responses develop to the Ser4, but not Arg4, variants, thereby minimizing the likelihood that this variant would be selected in vivo. First, we demonstrated that CNS-derived WT S510-specific CD8 T cells do not recognize either variant epitope in direct ex vivo intracellular IFN-{gamma} staining assays (Fig. 5A, Table V), confirming results obtained with splenic cells (29). Next, to determine whether either variant elicited a novel CTL response, we assayed CNS-derived lymphocytes from variant virus-infected mice for epitope-specific CD8 T cell responses. We found that mice mounted a low-level CD8 T cell response to the Arg4 epitope, but no response to the Ser4 epitope (Fig. 5B and Table V). Based on the modeled structures, the Arg4 variant is predicted to elicit a TCR profile different from that elicited by the WT epitope; consistent with this prediction, S510- and S510W513R-specific CTL exhibit different TCR Vβ-chain profiles (Fig. 5C) with the emergence of Vβ4 and Vβ11+ T cell populations and retraction of the Vβ13+ population.


Figure 5
View larger version (36K):
[in this window]
[in a new window]

 
FIGURE 5. De novo recognition of variant S510 epitopes in variant virus-infected B6 mice. A, Dot plots demonstrating ex vivo detection of epitope S510- and S598-specific CD8 T cells from the brain of a representative rJ-infected mouse. Approximately 1% of cells produced IFN-{gamma} when stimulated with peptides corresponding to any of the variant epitopes or an irrelevant peptide (OVA, not shown). B, Dot plots demonstrating recognition of variant epitopes by CD8 T cells isolated from the brains of mice infected with rJ.SW513S or rJ.SW513R viruses. Seven days p.i., CNS-derived mononuclear cells were stimulated ex vivo with peptides corresponding to irrelevant control (OVA), native S510, subdominant S598, or matching variant epitopes. Numbers in A and B represent percentages of IFN-{gamma}+CD8+ cells for each virus-infected mouse. C, TCR Vβ-chain usage between S510- and S510W513R-specific CD8 T cells. Total mononuclear cells were harvested from mice infected with rJ or rJ.SW513R and stimulated ex vivo with the peptides corresponding to native S510 and S510W513R epitopes, respectively. Following stimulation, aliquots of cells were surface stained for CD8 and the indicated Vβ-chain followed by intracellular cytokine staining for IFN-{gamma}. Data represent the fraction of IFN-{gamma}+CD8+ T cells expressing each Vβ-chain and are derived from cells pooled from 2–3 individual mice. D, Representative dot plots demonstrating detection of epitope-specific CD8 T cells in the spleens of mice 7 days after vaccination with S510- or S510W513S-coated DCs. Data shown are representative of four independent experiments. E, Frequency of S510-specific CD8 T cells in the spleens of mice 7 days after vaccination with OVA peptide- or S510 peptide-coated DCs. Data are means ± SEM for 3 individual mice. F, Frequency of S510W513R-specific CD8 T cells in the spleens of mice after DC-peptide priming followed by peripheral infection with rJ.SW513R virus. Data are means ± SEM for 3 individual mice and are representative of three independent experiments.

 

View this table:
[in this window]
[in a new window]

 
Table V. Frequency of total and epitope-specific CD8 T cells in the CNS of recombinant WT MHV and S510 variant-infected micea

 
The lack of priming to Ser4 could reflect differences in Ag processing and presentation of this variant epitope or a hole in the TCR repertoire. To address the latter possibility, we evaluated the ability of the Ser4 epitope to prime CTL responses using peptide-pulsed DC-based vaccination. We found that the Ser4 epitope failed to prime a CTL response, while native S510-pulsed DCs primed a robust response (Fig. 5D). Therefore, the lack of priming to Ser4 likely reflects a hole in the TCR repertoire or tolerance to this epitope. These results further suggest that the Ser4 variant should be selected in persistently infected mice.

The response to epitope Arg4 was unexpected because virus expressing this variant epitope is recovered in vivo and is highly virulent. One possible explanation was that in mice persistently infected with rJ, the phenomenon of original antigenic sin occurred (expansion of native epitope-specific CTL, rather than priming a de novo variant-specific CTL response (47)). To explore this possibility, we used a combination of DC-S510 peptide priming followed by peripheral infection with rJ.SW513R. However, as shown in Fig. 5, E and F, we found that these mice mount splenic CD8 T cell responses of similar magnitude to the Arg4 variant epitope, regardless of whether they were vaccinated with DC-S510 or DC-OVA (an irrelevant epitope), and they do not mount a secondary response to the WT epitope.

To further assess the biological significance of this modest S510W513R-specific CD8 T cell response, we examined the functional avidity of these cells. As shown in Fig. 6, the relative functional avidity of CNS-derived cells responding to the native and the variant epitopes was not different. A low functional avidity may have explained why the response does not prevent the outgrowth of variant viruses expressing the Arg4 epitope; however, this does not appear to be the case for this escape variant.


Figure 6
View larger version (16K):
[in this window]
[in a new window]

 
FIGURE 6. Functional avidity of S510W513R-specific CD8 T cells. A, Mononuclear cells were harvested from mice infected with rJ or rJ.SW513R at 7 days p.i. and stimulated ex vivo in the presence of 10-fold dilutions of the relevant peptides. The frequency of epitope-specific CD8 T cells per brain was determined as described in Materials and Methods. For each group, data are normalized to the frequency of epitope-specific CD8 T cells observed using 1 µM of peptide. B, Data from A plotted as a function of the amount of peptide required to elicit the one-half maximal response. Data shown are means ± SEM for 4–5 individual mice and are representative of three independent experiments.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Herein, we combine structural studies of the H-2Db/S510 epitope and a nonselected variant W513S S510 epitope with biological studies of viruses expressing variant epitopes to begin to understand selectivity in CTL escape development. While the structures of CTL variants of a single epitope (lymphocytic choriomeningitis virus (LCMV) gp33) have been solved (48), our study is the first to combine structural analyses with biological assays using recombinant viruses expressing variant epitopes. Our results show that selection is more complicated than previously postulated because a mutation, W513S, that results in CTL evasion without impairing virus replication is not selected in infected mice. Previous reports have concluded that some CTL escape variants are not selected because they compromise virus fitness. Moreover, many of those that do become selected are postulated to negatively affect virus fitness, as evidenced by rapid reversion to WT sequence when transmitted to hosts that lack the appropriate restriction element, or the requirement for co-selection of compensatory mutations that restore virus fitness (8, 49, 50). In a few cases, deleterious effects on virus fitness have been demonstrated directly in in vitro assays, using tissue culture cells or virus replicons (11, 50, 51). Consequently, a conclusion from these studies is that only a few mutations are selected because, despite their ability to evade CTL recognition, the vast majority negatively impact virus fitness. However, our results indicate that epitope diversification is also limited by features other than virus fitness, as discussed below.

The epitope S510 mutation at position 4 that is selected in vivo, Trp to Arg, alters the topology of the Db/S510 complex and likely directly diminishes or abrogates binding by the TCR. Other studies showed that single amino acid changes that result in altered topology of the epitope/MHC complexes can significantly skew the TCR repertoire. For example, an Arg to Ala mutation at position 7 of the influenza A-specific PA224 epitope, which removes the most prominent feature of the complex (52), still induces a CD8 T cell response, but it is much less diverse compared with the response to the native epitope. Similarly, we observed that the Trp to Arg single amino acid change in epitope S510 significantly altered the TCR repertoire distribution of responding CTL based on Vβ usage (Fig. 5C). The importance of the Trp4 determinant is also illustrated by the complete abrogation of the response by other mutations, including Leu, Gly, and Ser. This focus on a single amino acid residue is especially notable because the S510-specific response is highly diverse, consisting of ~1000–2000 different TCR clonotypes (53, 54); thus, although the response is highly diverse, it is functionally monospecific.

We expected that the lack of recovery of Gly4, Leu4, and Ser4 variants would be explained by significant deleterious effects on virus fitness, as has been described for certain mutations in CTL epitopes derived from HIV, SIV, or HCV (11, 50, 51). However, our results demonstrate that effects of mutations on fitness may be very subtle and appear only under certain conditions. For example, while there were no gross effects on fitness in either acutely infected adult mice or tissue culture cells (Fig. 4, A, C, and D), both the Gly4 and Leu4 substitutions result in a nearly complete loss of virulence in Ab-protected suckling mice (Fig. 4E). One difference between mice with acute lethal encephalitis and maternal Ab-protected mice is that different types of CNS cells are predominantly infected in each scenario. In mice with acute encephalitis, neurons are preferentially infected, whereas glial cells (oligodendrocytes, microglia, and astrocytes) are infected in persistently infected mice, including those protected by maternal Ab (39, 55, 56, 57, 58). Single amino acid changes in the JHMV S glycoprotein have been shown to change tropism from glia to neurons in previous studies (59, 60); one possibility is that rJ.SW513G and r.J.SW513L exhibit diminished growth in one or more type of glial cell in vivo when compared with rJ.SW513S and r.J.SW513R.

In addition to virus tropism, the inflammatory milieu of the acute vs persistently infected CNS may differ with perhaps important and direct effects on local T cell responses and the resultant selective pressure exerted by CTL. Inflammation, MHC class I expression, and CTL effector function wane dramatically during persistent JHMV infection (61, 62). Similar effects on CTL have been observed in mice persistently infected with LCMV and humans chronically infected with HIV (63, 64, 65, 66) and they correlate with PD-1 expression on dysfunctional CTL (67, 68). Thus, in maternal Ab-protected, persistently infected mice, the role of S510-specific CD8 T cells in driving diversification may be less potent than in acutely infected mice. If viruses, such as rJ.SW513G and rJ.SW513L, are subtly less fit in the persistently infected animal, a diminished CTL response would result in less immune pressure and perhaps in the lack of continued outgrowth of these viruses, even though they express mutations predicted to abrogate the CTL response.

Although these results provide a partial explanation for why some mutations (Leu4 and Gly4) that abrogate the S510-specific response are not selected in mice, the lack of selection of variant viruses encoding W513S mutations is puzzling. This mutation does not affect virus viability, and rJ.SW513S behaves like a CTL escape virus, causing disease severity equivalent to that of rJ.SW513R when inoculated into Ab-protected suckling mice (Fig. 4E). Furthermore, there is no recognition of this epitope in B6 mice (Fig. 5, B and D), suggesting a hole in the TCR repertoire. In support of this possibility, we have identified a nonamer in murine ADAM23 that is predicted to bind H-2Db (CSLSNGAHC) and could potentially induce deletion of epitope S510W513S-specific CD8 T cells during thymic selection. We also considered the possibility that the lack of outgrowth of the Ser4 variant might be explained by functional constraints related to codon usage or transition (vs transversion) mutation bias, as has been described for hepatitis G virus (HGV) (69). Transition mutations are favored by a factor of 104 in HGV-infected cells, but both a transition (UGG to CGG) and a transversion (UGG to AGG) result in the W513R mutation and both occur with the same frequency.

Our results showing enhanced virulence of viruses encoding Arg4 or Ser4 substitutions demonstrate a critical protective role for S510-specific CTL in Ab-protected mice. Although worsened disease is likely related to enhanced virus replication, the effect may also involve immunopathologic mechanisms, with the anti-JHMV CD4 T cell response largely responsible for clinical disease (38, 42). Thus, it is possible that enhanced disease occurs in mice infected with CTL escape virus, because increased virus replication elicits a compensatory antiviral CD4 T cell response, with immunopathological consequences.

Collectively, our results suggest that, at least for some variant epitopes, the forces that influence the selection of CTL escape variant viruses are complex and extend beyond the postulates of virus fitness and de novo CTL recognition. Thus, additional understanding of the immune response during persistent viral infection may be key to understanding the mechanisms of CTL escape. For example, subtle changes in cell tropism and/or replicative capacity during persistence may shape the unique subset of CTL escape mutations that are selected. The monospecific nature of antiviral T cells responding to the immunodominant S510 epitope results in JHMV viral escape, suggesting that the avoidance of such focused responses by targeted vaccination programs is warranted.


    Acknowledgments
 
We thank the staff at the Advanced Photon Source and the Australian Synchrotron for assistance with data collection and John T. Harty for critical reading of the manuscript.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflicts of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by National Institutes of Health Grant R01 NS036592-09 (to S.P. and A.W.P.), and a National Institutes of Health Predoctoral Training Grant on Mechanisms of Parasitism (T32 AI007511 to N.S.B.). A.W.P. is a Senior Research Fellow, M.A.D. is a Doherty Post-doctoral Fellow, and A.I.W. is a C. J. Martin Fellow of the National Health and Medical Research Council of Australia. J.R. is an Australian Research Council Federation Fellow. Back

2 N.B. and A.T. contributed equally to this work. Back

3 Address correspondence and reprint requests to Dr. Stanley Perlman, Department of Microbiology, Bowen Science Building 3-712, University of Iowa, Iowa City, IA 52242. E-mail address: Stanley-perlman{at}uiowa.edu or Dr. Anthony Purcell, Department of Biochemistry and Molecular Biology, The Bio21 Molecular Science and Biotechnology Institute, University of Melbourne, 3010 Victoria, Australia. E-mail address: apurcell{at}unimelb.edu.au Back

4 Abbreviations used in this paper: HCV, hepatitis C virus; JHMV, JHM strain of mouse hepatitis virus; S510, the immunodominant H-2Db-restricted epitope from the spike glycoprotein of JHMV (CSLWNGPHL); S598, subdominant H-2Kb-restricted epitope spanning residues 598–605 of the spike glycoprotein of JHMV (RCQIFANI); p.i., postinfection; Aba, L-{alpha} aminobutyric acid; W513R, position 4 Arg-substituted S510 epitope (CSLRNGPHL); W513G, position 4 Gly-substituted S510 epitope (CSLGNGPHL); W513S, position 4 Ser-substituted S510 epitope (CSLSNGPHL); W513L, position 4 Leu-substituted S510 epitope (CSLLNGPHL); PEG, polyethylene glycol; rJ, recombinant JHMV; rJ.SW513G, recombinant JHMV bearing the W513G mutation introduced by reverse genetics; rJ.SW513S, recombinant JHMV bearing the W513S mutation introduced by reverse genetics; rJ.SW513L, recombinant JHMV bearing the W513L mutation introduced by reverse genetics; rJ.SW513R, recombinant JHMV bearing the W513R mutation introduced by reverse genetics; MOI, multiplicity of infection; WT, wild type; OVA, chicken ovalbumin; DC, dendritic cell; CD, circular dichroism; Tm, midpoint of thermal denaturation; rmsd, root mean square deviation; LCMV, lymphocytic choriomeningitis virus; HGV, hepatitis G virus. Back

Received for publication November 6, 2007. Accepted for publication January 5, 2008.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Yewdell, J. W.. 2006. Confronting complexity: real-world immunodominance in antiviral CD8+ T cell responses. Immunity 25: 533-543. [Medline]
  2. Oxenius, A., D. A. Price, A. Trkola, C. Edwards, E. Gostick, H. T. Zhang, P. J. Easterbrook, T. Tun, A. Johnson, A. Waters, et al 2004. Loss of viral control in early HIV-1 infection is temporally associated with sequential escape from CD8+ T cell responses and decrease in HIV-1-specific CD4+ and CD8+ T cell frequencies. J. Infect. Dis. 190: 713-721. [Medline]
  3. Perlman, S., L. Pewe. 1998. Role of CTL mutants in demyelination induced by mouse hepatitis virus, strain JHM. Adv. Exp. Med. Biol. 440: 515-519. [Medline]
  4. Goulder, P. J., D. I. Watkins. 2004. HIV and SIV CTL escape: implications for vaccine design. Nat. Rev. Immunol. 4: 630-640. [Medline]
  5. McMichael, A. J., R. E. Phillips. 1997. Escape of human immunodeficiency virus from immune control. Annu. Rev. Immunol. 15: 271-296. [Medline]
  6. Bowen, D. G., C. M. Walker. 2005. Mutational escape from CD8+ T cell immunity: HCV evolution, from chimpanzees to man. J. Exp. Med. 201: 1709-1714. [Abstract/Free Full Text]
  7. Berkhoff, E. G., E. de Wit, M. M. Geelhoed-Mieras, A. C. Boon, J. Symons, R. A. Fouchier, A. D. Osterhaus, G. F. Rimmelzwaan. 2005. Functional constraints of influenza A virus epitopes limit escape from cytotoxic T lymphocytes. J. Virol. 79: 11239-11246. [Abstract/Free Full Text]
  8. Friedrich, T. C., E. J. Dodds, L. J. Yant, L. Vojnov, R. Rudersdorf, C. Cullen, D. T. Evans, R. C. Desrosiers, B. R. Mothe, J. Sidney, et al 2004. Reversion of CTL escape-variant immunodeficiency viruses in vivo. Nat. Med. 10: 275-281. [Medline]
  9. Jones, N. A., X. Wei, D. R. Flower, M. Wong, F. Michor, M. S. Saag, B. H. Hahn, M. A. Nowak, G. M. Shaw, P. Borrow. 2004. Determinants of human immunodeficiency virus type 1 escape from the primary CD8+ cytotoxic T lymphocyte response. J. Exp. Med. 200: 1243-1256. [Abstract/Free Full Text]
  10. Peyerl, F. W., D. H. Barouch, W. W. Yeh, H. S. Bazick, J. Kunstman, K. J. Kunstman, S. M. Wolinsky, N. L. Letvin. 2003. Simian-human immunodeficiency virus escape from cytotoxic T-lymphocyte recognition at a structurally constrained epitope. J. Virol. 77: 12572-12578. [Abstract/Free Full Text]
  11. Soderholm, J., G. Ahlen, A. Kaul, L. Frelin, M. Alheim, C. Barnfield, P. Liljestrom, O. Weiland, D. R. Milich, R. Bartenschlager, M. Sallberg. 2006. Relation between viral fitness and immune escape within the hepatitis C virus protease. Gut 55: 266-274. [Abstract/Free Full Text]
  12. Allen, T. M., X. G. Yu, E. T. Kalife, L. L. Reyor, M. Lichterfeld, M. John, M. Cheng, R. L. Allgaier, S. Mui, N. Frahm, et al 2005. De novo generation of escape variant-specific CD8+ T-cell responses following cytotoxic T-lymphocyte escape in chronic human immunodeficiency virus type 1 infection. J. Virol. 79: 12952-12960. [Abstract/Free Full Text]
  13. Bailey, J. R., T. M. Williams, R. F. Siliciano, J. N. Blankson. 2006. Maintenance of viral suppression in HIV-1-infected HLA-B*57+ elite suppressors despite CTL escape mutations. J. Exp. Med. 203: 1357-1369. [Abstract/Free Full Text]
  14. Allen, T. M., M. Altfeld, S. C. Geer, E. T. Kalife, C. Moore, M. O’Sullivan, K. , I. Desouza, M. E. Feeney, R. L. Eldridge, E. L. Maier, et al 2005. Selective escape from CD8+ T-cell responses represents a major driving force of human immunodeficiency virus type 1 (HIV-1) sequence diversity and reveals constraints on HIV-1 evolution. J. Virol. 79: 13239-13249. [Abstract/Free Full Text]
  15. Turnbull, E. L., A. R. Lopes, N. A. Jones, D. Cornforth, P. Newton, D. Aldam, P. Pellegrino, J. Turner, I. Williams, C. M. Wilson, et al 2006. HIV-1 epitope-specific CD8+ T cell responses strongly associated with delayed disease progression cross-recognize epitope variants efficiently. J. Immunol. 176: 6130-6146. [Abstract/Free Full Text]
  16. Altfeld, M., M. M. Addo, E. S. Rosenberg, F. M. Hecht, P. K. Lee, M. Vogel, X. G. Yu, R. Draenert, M. N. Johnston, D. Strick, et al 2003. Influence of HLA-B57 on clinical presentation and viral control during acute HIV-1 infection. AIDS 17: 2581-2591. [Medline]
  17. Migueles, S. A., M. S. Sabbaghian, W. L. Shupert, M. P. Bettinotti, F. M. Marincola, L. Martino, C. W. Hallahan, S. M. Selig, D. Schwartz, J. Sullivan, M. Connors. 2000. HLA B*5701 is highly associated with restriction of virus replication in a subgroup of HIV-infected long term nonprogressors. Proc. Natl. Acad. Sci. USA 97: 2709-2714. [Abstract/Free Full Text]
  18. Kaslow, R. A., M. Carrington, R. Apple, L. Park, A. Munoz, A. J. Saah, J. J. Goedert, C. Winkler, S. J. O’Brien, C. Rinaldo, et al 1996. Influence of combinations of human major histocompatibility complex genes on the course of HIV-1 infection. Nat. Med. 2: 405-411. [Medline]
  19. Muhl, T., M. Krawczak, P. Ten Haaft, G. Hunsmann, U. Sauermann. 2002. MHC class I alleles influence set-point viral load and survival time in simian immunodeficiency virus-infected rhesus monkeys. J. Immunol. 169: 3438-3446. [Abstract/Free Full Text]
  20. O’Connor, D. H., T. M. Allen, T. U. Vogel, P. Jing, I. P. DeSouza, E. Dodds, E. J. Dunphy, C. Melsaether, B. Mothe, H. Yamamoto, et al 2002. Acute phase cytotoxic T lymphocyte escape is a hallmark of simian immunodeficiency virus infection. Nat. Med. 8: 493-499. [Medline]
  21. O’Connor, D., T. Friedrich, A. Hughes, T. M. Allen, D. Watkins. 2001. Understanding cytotoxic T-lymphocyte escape during simian immunodeficiency virus infection. Immunol. Rev. 183: 115-126. [Medline]
  22. Pewe, L., G. F. Wu, E. M. Barnett, R. F. Castro, S. Perlman. 1996. Cytotoxic T cell-resistant variants are selected in a virus-induced demyelinating disease. Immunity 5: 253-262. [Medline]
  23. Pewe, L., S. Xue, S. Perlman. 1998. Infection with cytotoxic T-lymphocyte escape mutants results in increased mortality and growth retardation in mice infected with a neurotropic coronavirus. J. Virol. 72: 5912-5918. [Abstract/Free Full Text]
  24. Ontiveros, E., L. Kuo, P. S. Masters, S. Perlman. 2001. Inactivation of expression of gene 4 of mouse hepatitis virus strain JHM does not affect virulence in the murine CNS. Virology 289: 230-238. [Medline]
  25. Barouch, D. H., J. Kunstman, M. J. Kuroda, J. E. Schmitz, S. Santra, F. W. Peyerl, G. R. Krivulka, K. Beaudry, M. A. Lifton, D. A. Gorgone, et al 2002. Eventual AIDS vaccine failure in a rhesus monkey by viral escape from cytotoxic T lymphocytes. Nature 415: 335-339. [Medline]
  26. O’Connor, D. H., B. R. Mothe, J. T. Weinfurter, S. Fuenger, W. M. Rehrauer, P. Jing, R. R. Rudersdorf, M. E. Liebl, K. Krebs, J. Vasquez, et al 2003. Major histocompatibility complex class I alleles associated with slow simian immunodeficiency virus disease progression bind epitopes recognized by dominant acute-phase cytotoxic-T-lymphocyte responses. J. Virol. 77: 9029-9040. [Abstract/Free Full Text]
  27. Dandekar, A. A., G. Jacobsen, T. J. Waldschmidt, S. Perlman. 2003. Antibody-mediated protection against cytotoxic T-cell escape in coronavirus-induced demyelination. J. Virol. 77: 11867-11874. [Abstract/Free Full Text]
  28. Kim, T. S., S. Perlman. 2003. Protection against CTL escape and clinical disease in a murine model of virus persistence. J. Immunol. 171: 2006-2013. [Abstract/Free Full Text]
  29. Pewe, L., S. Xue, S. Perlman. 1997. Cytotoxic T-cell-resistant variants arise at early times after infection in C57BL/6 but not in SCID mice infected with a neurotropic coronavirus. J. Virol. 71: 7640-7647. [Abstract/Free Full Text]
  30. Weiss, S. R., S. Navas-Martin. 2005. Coronavirus pathogenesis and the emerging pathogen severe acute respiratory syndrome coronavirus. Microbiol. Mol. Biol. Rev. 69: 635-664. [Abstract/Free Full Text]
  31. Leslie, A. G. W.. 1992. Recent changes to the MOSFLM package for processing film and image plate data. CCP4 and ESF-EAMCB Newsletter on Protein Crystallography No. 26. Daresbury Laboratory, Warrington.
  32. Evans, P. R.. 1992. Data reduction: data collection and processing. L. Sawyer, and N. W. Isaacs, and S. Bailey, eds. Proceedings of the CCP4 study weekend. Data collection and processing 114-122. Daresbury Laboratory, Warrington.
  33. Storoni, L. C., A. J. McCoy, R. J. Read. 2004. Likelihood-enhanced fast rotation functions. Acta Crystallogr. D Biol. Crystallogr. 60: 432-438. [Medline]
  34. Murshudov, G. N., A. A. Vagin, E. J. Dodson. 1997. Refinement of macromolecular structures by the maximum-likelihood method. Acta Crystallogr. D Biol. Crystallogr. 53: 240-255. [Medline]
  35. Emsley, P., K. Cowtan. 2004. Coot: model-building tools for molecular graphics. Acta Crystallogr. D Biol. Crystallogr. 60: 2126-2132. [Medline]
  36. Lamzin, V. S., K. S. Wilson. 1993. Automated refinement of protein models. Acta Crystallogr. D Biol. Crystallogr. 49: 129-147. [Medline]
  37. Kuo, L., G. J. Godeke, M. J. Raamsman, P. S. Masters, P. J. Rottier. 2000. Retargeting of coronavirus by substitution of the spike glycoprotein ectodomain: crossing the host cell species barrier. J. Virol. 74: 1393-1406. [Abstract/Free Full Text]
  38. Anghelina, D., L. Pewe, S. Perlman. 2006. Pathogenic role for virus-specific CD4 T cells in mice with coronavirus-induced acute encephalitis. Am. J. Pathol. 169: 209-222. [Abstract/Free Full Text]
  39. Perlman, S., R. Schelper, E. Bolger, D. Ries. 1987. Late onset, symptomatic, demyelinating encephalomyelitis in mice infected with MHV-JHM in the presence of maternal antibody. Microb. Pathog. 2: 185-194. [Medline]
  40. Ogino, S., T. Kawasaki, M. Brahmandam, L. Yan, M. Cantor, C. Namgyal, M. Mino-Kenudson, G. Y. Lauwers, M. Loda, C. S. Fuchs. 2005. Sensitive sequencing method for KRAS mutation detection by Pyrosequencing. J. Mol. Diagn. 7: 413-421. [Abstract/Free Full Text]
  41. Hamilton, S. E., J. T. Harty. 2002. Quantitation of CD8+ T cell expansion, memory, and protective immunity after immunization with peptide-coated dendritic cells. J. Immunol. 169: 4936-4944. [Abstract/Free Full Text]
  42. Wu, G. F., A. A. Dandekar, L. Pewe, S. Perlman. 2000. CD4 and CD8 T cells have redundant but not identical roles in virus-induced demyelination. J. Immunol. 165: 2278-2286. [Abstract/Free Full Text]
  43. Rognan, D., L. Scapozza, G. Folkers, A. Daser. 1995. Rational design of nonnatural peptides as high-affinity ligands for the HLA-B*2705 human leukocyte antigen. Proc. Natl. Acad. Sci. USA 92: 753-757. [Abstract/Free Full Text]
  44. Webb, A. I., N. A. Borg, M. A. Dunstone, L. Kjer-Nielsen, T. Beddoe, J. McCluskey, F. R. Carbone, S. P. Bottomley, M. I. Aguilar, A. W. Purcell, J. Rossjohn. 2004. The structure of H-2Kb and Kbm8 complexed to a herpes simplex virus determinant: evidence for a conformational switch that governs T cell repertoire selection and viral resistance. J. Immunol. 173: 402-409. [Abstract/Free Full Text]
  45. Webb, A. I., M. A. Dunstone, N. A. Williamson, J. D. Price, A. de Kauwe, W. Chen, A. Oakley, P. Perlmutter, J. McCluskey, M. I. Aguilar, et al 2005. T cell determinants incorporating β-amino acid residues are protease resistant and remain immunogenic in vivo. J. Immunol. 175: 3810-3818. [Abstract/Free Full Text]
  46. Ljunggren, H. G., N. J. Stam, C. Ohlen, J. J. Neefjes, P. Hoglund, M. T. Heemels, J. Bastin, T. N. Schumacher, A. Townsend, K. Karre, et al 1990. Empty MHC class I molecules come out in the cold. Nature 346: 476-480. [Medline]
  47. Klenerman, P., R. M. Zinkernagel. 1998. Original antigenic sin impairs cytotoxic T lymphocyte responses to viruses bearing variant epitopes. Nature 394: 482-485. [Medline]
  48. Achour, A., J. Michaelsson, R. A. Harris, J. Odeberg, P. Grufman, J. K. Sandberg, V. Levitsky, K. Karre, T. Sandalova, G. Schneider. 2002. A structural basis for LCMV immune evasion: subversion of H-2Db and H-2Kb presentation of gp33 revealed by comparative crystal structure analyses. Immunity 17: 757-768. [Medline]
  49. Leslie, A. J., K. J. Pfafferott, P. Chetty, R. Draenert, M. M. Addo, M. Feeney, Y. Tang, E. C. Holmes, T. Allen, J. G. Prado, et al 2004. HIV evolution: CTL escape mutation and reversion after transmission. Nat. Med. 10: 282-289. [Medline]
  50. Crawford, H., J. G. Prado, A. Leslie, S. Hue, I. Honeyborne, S. Reddy, M. van der Stok, Z. Mncube, C. Brander, C. Rousseau, et al 2007. Compensatory mutation partially restores fitness and delays reversion of escape mutation within the immunodominant HLA-B*5703-restricted Gag epitope in chronic human immunodeficiency virus type 1 infection. J. Virol. 81: 8346-8351. [Abstract/Free Full Text]
  51. Yeh, W. W., E. M. Cale, P. Jaru-Ampornpan, C. I. Lord, F. W. Peyerl, N. L. Letvin. 2006. Compensatory substitutions restore normal core assembly in simian immunodeficiency virus isolates with Gag epitope cytotoxic T-lymphocyte escape mutations. J. Virol. 80: 8168-8177. [Abstract/Free Full Text]
  52. Turner, S. J., K. Kedzierska, H. Komodromou, N. L. La Gruta, M. A. Dunstone, A. I. Webb, R. Webby, H. Walden, W. Xie, J. McCluskey, et al 2005. Lack of prominent peptide-major histocompatibility complex features limits repertoire diversity in virus-specific CD8+ T cell populations. Nat. Immunol. 6: 382-389. [Medline]
  53. Pewe, L. L., J. M. Netland, S. B. Heard, S. Perlman. 2004. Very diverse CD8 T cell clonotypic responses after virus infections. J. Immunol. 172: 3151-3156. [Abstract/Free Full Text]
  54. Pewe, L., S. B. Heard, C. Bergmann, M. O. Dailey, S. Perlman. 1999. Selection of CTL escape mutants in mice infected with a neurotropic coronavirus: quantitative estimate of TCR diversity in the infected central nervous system. J. Immunol. 163: 6106-6113. [Abstract/Free Full Text]
  55. Fleming, J. O., M. D. Trousdale, F. A. el-Zaatari, S. A. Stohlman, L. P. Weiner. 1986. Pathogenicity of antigenic variants of murine coronavirus JHM selected with monoclonal antibodies. J. Virol. 58: 869-875. [Abstract/Free Full Text]
  56. Jacobsen, G., S. Perlman. 1990. Localization of virus and antibody response in mice infected persistently with MHV-JHM. Adv. Exp. Med. Biol. 276: 573-578. [Medline]
  57. Parker, S. E., T. M. Gallagher, M. J. Buchmeier. 1989. Sequence analysis reveals extensive polymorphism and evidence of deletions within the E2 glycoprotein gene of several strains of murine hepatitis virus. Virology 173: 664-673. [Medline]
  58. Phillips, J. J., M. M. Chua, G. F. Rall, S. R. Weiss. 2002. Murine coronavirus spike glycoprotein mediates degree of viral spread, inflammation, and virus-induced immunopathology in the central nervous system. Virology 301: 109-120. [Medline]
  59. Wang, F. I., D. R. Hinton, W. Gilmore, M. D. Trousdale, J. O. Fleming. 1992. Sequential infection of glial cells by the murine hepatitis virus JHM strain (MHV-4) leads to a characteristic distribution of demyelination. Lab. Invest. 66: 744-754. [Medline]
  60. Tsai, J. C., B. D. Zelus, K. V. Holmes, S. R. Weiss. 2003. The N-terminal domain of the murine coronavirus spike glycoprotein determines the CEACAM1 receptor specificity of the virus strain. J. Virol. 77: 841-850. [Medline]
  61. Bergmann, C. C., J. D. Altman, D. Hinton, S. A. Stohlman. 1999. Inverted immunodominance and impaired cytolytic function of CD8+ T cells during viral persistence in the central nervous system. J. Immunol. 163: 3379-3387. [Abstract/Free Full Text]
  62. Ramakrishna, C., R. A. Atkinson, S. A. Stohlman, C. C. Bergmann. 2006. Vaccine-induced memory CD8+ T cells cannot prevent central nervous system virus reactivation. J. Immunol. 176: 3062-3069. [Abstract/Free Full Text]
  63. Day, C. L., D. E. Kaufmann, P. Kiepiela, J. A. Brown, E. S. Moodley, S. Reddy, E. W. Mackey, J. D. Miller, A. J. Leslie, C. DePierres, et al 2006. PD-1 expression on HIV-specific T cells is associated with T-cell exhaustion and disease progression. Nature 443: 350-354. [Medline]
  64. Moskophidis, D., F. Lechner, H. Hengartner, R. M. Zinkernagel. 1994. MHC class I and non-MHC-linked capacity for generating an anti-viral CTL response determines susceptibility to CTL exhaustion and establishment of virus persistence in mice. J. Immunol. 152: 4976-4983. [Abstract]
  65. Moskophidis, D., F. Lechner, H. Pircher, R. M. Zinkernagel. 1993. Virus persistence in acutely infected immunocompetent mice by exhaustion of antiviral cytotoxic effector T cells. Nature 362: 758-761. [Medline]
  66. Robinson, H. L.. 2003. T cells versus HIV-1: fighting exhaustion as well as escape. Nat. Immunol. 4: 12-13. [Medline]
  67. Barber, D. L., E. J. Wherry, D. Masopust, B. Zhu, J. P. Allison, A. H. Sharpe, G. J. Freeman, R. Ahmed. 2006. Restoring function in exhausted CD8 T cells during chronic viral infection. Nature 439: 682-687. [Medline]
  68. Velu, V., S. Kannanganat, C. Ibegbu, L. Chennareddi, F. Villinger, G. J. Freeman, R. Ahmed, R. R. Amara. 2007. Elevated expression levels of inhibitory receptor programmed death 1 on simian immunodeficiency virus-specific CD8 T cells during chronic infection but not after vaccination. J. Virol. 81: 5819-5828. [Abstract/Free Full Text]
  69. Shao, L., H. Shinzawa, X. Zhang, D. B. Smith, H. Watanabe, H. Mitsuhashi, K. Saito, T. Saito, H. Togashi, T. Takahashi. 2000. Diversity of hepatitis G virus within a single infected individual. Virus Genes 21: 215-221. [Medline]

Related articles in The JI:

IN THIS ISSUE

The JI 2008 180: 3623-3624. [Full Text]  




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Butler, N. S.
Right arrow Articles by Perlman, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Butler, N. S.
Right arrow Articles by Perlman, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS