Allelic and Isotypic Light Chain Inclusion in Peripheral B Cells from Anti-DNA Antibody Transgenic C57BL/6 and BALB/c Mice
J Immunol Witsch and Bettelheim
180: 3708
Data Supplement
Files in this Data Supplement:
Supplemental Table (PDF, 580 Kb) -
Supplemental Table 1A: Alignment of the degenerate primer Vk(S) to all mouse Vkappa genes. This table lists
the number of mismatches found in each of the 98 tested mouse Vkappa genes when aligned to the degenerate
primer Vk(S). The 98 Vkappa genes were pulled up from the IMGT database (available at
http://www.ncbi.nlm.nih.gov/igblast/showGermline.cgi). The degenerate primer Vk(S)
(ggctgcagcgttcagtggcagtggagtcatggagac) was then aligned to all Vkappa genes with a maximum of 10
mismatches allowed and occurred in 95 Vkappa L chain genes in the Framework Region (FR) 3 of the V gene.
Three V genes did match Vk(S) with 10 mismatches allowed (8-16, bt20, and bw20, see underneath this table).
Alignment was done using Fuzznuc Software as part of the Emboss Software Package.
Supplemental Table 1B–E: Kappa L chain sequence alignments
The following lists kappa L chains sequenced from 56R H chain transgenic mice either on a C57/BL/6 (B6) or on a BALB/c (BA) background. From both mice two different
splenic B cell subsets were sorted (marginal zone, MZ, and follicular zone compartment, Fo, B cells). Single cell PCR was done using specific primers for Vk21D (= 21-4)
and Vk38C (= gj38c) or using a degenerate primer Vk(S) which binds in the Framework Region (FR) 3 of most kappa L chains. In case of ambiguities in the sequencing
results both primers (forward and reverse) were used for sequencing and alignment and the consensus sequence is shown (depicted with the ending “Con”). FR3 of the V
genes is shown in the upper part of alignments. The result from the NCBI BLAST search is shown at the end of each line. Gaps with colons are created to allow alignments.
Gray areas with colons depict the number of bases missing in junctional parts of the genes. In some L chains missing bases lead to an out of frame product. L chains that
were found in B cells that had rearranged the other kappa allele or a lambda L chains product. The cells that are kappa/kappa or lambda/kappa or kappa/kappa/lambda
included and in frame are denoted as “in”, cells with a second product that was either not determined or was out of frame are denoted with “2nd” (product). Cells with
only one L chain are denoted with “ex”.
Supplemental Table 1B–E: Kappa L chain sequence alignments
The following lists kappa L chains sequenced from 56R H chain transgenic mice either on a C57/BL/6 (B6) or on a BALB/c (BA) background. From both mice two different
splenic B cell subsets were sorted (marginal zone, MZ, and follicular zone compartment, Fo, B cells). Single cell PCR was done using specific primers for Vk21D (= 21-4)
and Vk38C (= gj38c) or using a degenerate primer Vk(S) which binds in the Framework Region (FR) 3 of most kappa L chains. In case of ambiguities in the sequencing
results both primers (forward and reverse) were used for sequencing and alignment and the consensus sequence is shown (depicted with the ending “Con”). FR3 of the V
genes is shown in the upper part of alignments. The result from the NCBI BLAST search is shown at the end of each line. Gaps with colons are created to allow alignments.
Gray areas with colons depict the number of bases missing in junctional parts of the genes. In some L chains missing bases lead to an out of frame product. L chains that
were found in B cells that had rearranged the other kappa allele or a lambda L chains product. The cells that are kappa/kappa or lambda/kappa or kappa/kappa/lambda
included and in frame are denoted as “in”, cells with a second product that was either not determined or was out of frame are denoted with “2nd” (product). Cells with
only one L chain are denoted with “ex”.