The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


The Journal of Immunology, 2008, 180, 3485 -3491
Copyright © 2008 by The American Association of Immunologists, Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Semaan, N.
Right arrow Articles by Sibilia, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Semaan, N.
Right arrow Articles by Sibilia, J.

Etk/BMX, a Btk Family Tyrosine Kinase, and Mal Contribute to the Cross-Talk between MyD88 and FAK Pathways1

Noha Semaan*, Ghada Alsaleh*, Jacques-Eric Gottenberg{dagger}, Dominique Wachsmann2,3,* and Jean Sibilia2,{ddagger}

* Laboratoire Physiopathologie des Arthrites, Université Louis Pasteur de Strasbourg, Unité de Formation et de Recherche Sciences Pharmaceutiques, Illkirch, France; {dagger} Rhumatologie Institut National de la Santé et de la Recherche Médicale U802, Hôpital Bicêtre (Assistance Publique-Hôpitaux de Paris) Université Paris-Sud 11, Le Kremlin Bicêtre, France; and {ddagger} Département de Rhumatologie, Hôpitaux Universitaires de Strasbourg, Strasbourg, France


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
MyD88 and focal adhesion kinase (FAK) are key adaptors involved in signaling downstream of TLR2, TLR4, and integrin {alpha}5β1, linking pathogen-associated molecule detection to the initiation of proinflammatory response. The MyD88 and integrin pathways are interlinked, but the mechanism of this cross-talk is not yet understood. In this study we addressed the involvement of Etk, which belongs to the Tec family of tyrosine kinases, in the cross-talk between the integrin/FAK and the MyD88 pathways in fibroblast-like synoviocyte s (FLS) and in IL-6 synthesis. Using small interfering RNA blockade, we report that Etk plays a major role in LPS- and protein I/II (a model activator of FAK)-dependent IL-6 release by activated FLS. Etk is associated with MyD88, FAK, and Mal as shown by coimmunoprecipitation. Interestingly, knockdown of Mal appreciably inhibited IL-6 synthesis in response to LPS and protein I/II. Our results also indicate that LPS and protein I/II induced phosphorylation of Etk and Mal in rheumatoid arthritis FLS via a FAK-dependent pathway. In conclusion, our data provide support that, in FLS, Etk and Mal are implicated in the cross-talk between FAK and MyD88 and that their being brought into play is clearly dependent on FAK.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Toll-like receptors play an important role in activating the innate immune system. These receptors, expressed by a variety of immune and nonimmune cells, recognize microbial components as well as some host-derived molecules (1, 2). Eleven TLRs that activate signal transduction pathways have been identified in mammals, with specificity regarding recruitment of the four proximal adaptor molecules Mal, MyD88, TRIF (Toll/IL-1R domain-containing adaptor inducing IFN-β), and TRAM (TRIF-related adaptor molecule). MyD88 and TRIF control distinct signaling pathways that activate either NF-{kappa}B and AP-1 (Mal/MyD88) or IRF transcriptions factors (TRIF/TRAM) (3). Very recent data (4, 5) showed that TIRAP (Toll/IL-1R domain-containing adaptor protein)/Mal, which is never used without MyD88, functions to recruit MyD88 to phosphatidyl inositol 4,5-biphosphate (PIP2)4-rich plasma membrane subdomains to initiate TLR2 and TLR4 signaling. PIP2 production is controlled by many signaling pathways and, among them, integrins are known to regulate PIP2 turnover through activation of the ARF6 (ADP ribosylation factor 6) GTPase.

MyD88 is also a key adaptor involved in other signaling pathways. We demonstrated previously (6) that MyD88 plays a major role in protein I/II/integrin-induced cytokine release and that this effect is independent of TLR2, TLR4, and TLR6. We also showed that focal adhesion kinase (FAK), involved in signaling downstream of integrins (7), is critical for signaling by LPS via TLR4 and by Pam3CSK ((S)-[2,3-bis(palmitoyloxy)-(2-RS)-propyl]-N-palmitoyl-(R)-Cys-(S)-Ser-(S)-Lys4-OH, 3HCl) via TLR2. The MyD88 and FAK pathways are interlinked, but the mechanism of this cross-talk is not yet understood.

MyD88 is not essential for FAK activation, as this kinase is phosphorylated in MyD88–/– macrophages stimulated with either LPS or protein I/II. Thus, FAK seems to occur upstream of MyD88 recruitment and might be a key proximal effector of MyD88. FAK possesses neither a Toll/IL-1R (TIR) domain nor a death domain for direct interaction with MyD88, but alternatively FAK may participate to the MyD88-induced signaling pathway by interacting with or activating another component.

Bruton’s tyrosine kinase (Btk), the prototype member of the Tec family of tyrosine kinases, is an early component of the TLR signaling pathway (8, 9, 10). Btk is activated following stimulation with LPS. Its activation fits into a two-step model requiring first the disruption of the intracellular interaction between the SH3 (Src homology 3) domain and the proline-rich regions of this kinase by binding the pleckstrin homology (PH) domain to phosphoinositides or β{gamma} subunits of G protein or the FERM (protein 4.1 ezrin/radixin/moesin) domain of FAK. Btk is then translocated to the membrane, where its kinase activity is induced by Src kinases. Recently, Mal was identified as one substrate that is phosphorylated by Btk during TLR2 and TLR4 signal transduction (11). Btk expression is restricted to myeloid cells. Conversely, Etk, another member of the Tec family of tyrosine kinases, is present in various cell types such as epithelial and endothelial cells and fibroblasts (12, 13). Activation of Etk is also regulated by FAK through interaction between the PH domain of Etk and the FERM domain of FAK (14). Based on these observations, we investigated the possible role of Etk in the cross-talk between the integrin/FAK and MyD88 pathways in fibroblast-like synoviocytes (FLS) and in IL-6 synthesis.

Our data indicate that Etk and Mal are the main components of the cross-talk activated by TLR4 or integrin {alpha}5β1 ligands and that FAK plays an essential role in their recruitment and activation.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Purification of protein I/II

Recombinant protein I/II of Streptococcus mutans OMZ 175 was purified from pHBsr-1-transformed Escherichia coli cell extract by gel filtration and immunoaffinity chromatography as described previously (15). Potential endotoxin in protein I/II preparation was removed by using polymyxin B-agarose (Detoxi-Gel) according to the manufacturer’s recommendation (Pierce). Protein I/II had an endotoxin content of <0.01 ng/125 pM protein I/II as tested by the Limulus chromogenic assay (Charles River Laboratories). Throughout this study, buffers were prepared with apyrogenic water obtained from Braun Medical.

Cell culture

Human FLS were isolated from rheumatoid arthritis (RA) synovial tissues at the time of knee joint arthroscopic synovectomy and cultured as previously described (16). FLS (5 x 103 cells per well) were grown to confluence in 96-well plates and serum starved for 24 h before the activation experiments. FAK+/+ and FAK–/– primary mouse embryo fibroblasts (CRL-2644 and CRL-2645; American Type Culture Collection) were cultured as previously described (17). Cells were plated in 96-well plates (5 x 104 cells/well) and serum starved 24 h before activation experiments.

Mice deficient for Btk and their control littermates were obtained from V. Quesniaux (The Transgenose Institute, Centre National de la Recherche Scientifique, Orleans, France). Murine bone marrow cells were isolated from the femurs of Btk-deficient and control mice and cultivated as previously described (18). The bone marrow-derived macrophages were plated in 96-well plates (105 cells/well) before the activation experiments.

siRNA duplexes and transfections

The small interfering RNA (siRNA) duplexes used in our study were designed to target sequences for human Etk/BMX (GenBank accession no. NM_001721) and Mal/TIRAP (GenBank accession no. NM_148910) genes. Four selected siRNA oligonucleotides consisting of sequences of 21 nucleotides were supplied by Dharmacon (Perbio Science).

The four Etk/BMX siRNA sequences are as follows: 1, GUACCAGUCUAGCGCAAUAUU (sense sequence) and 5'-P UAUUGCGCUAGACUGGUACUU (antisense sequence); 2, GAAGAUACCUCGGGCAGUUUU (sense sequence) and 5'-P AACUGCCCGAGGUAUCUUCUU; 3, GAAGAGAGCCGAAGUCAGUUU (sense sequence) and 5'-P ACUGACUUCGGCUCUCUUCUU (antisense sequence); 4, GAGCAUUUAUGGUUAGAAAUU (sense sequence) and 5'-P UUUCUAACCAUAAAUGCUCUU (antisense sequence).

The four Mal/TIRAP siRNA sequences are as follows: 1, GAGCAAAGACUAUGACGUCUU (sense sequence) and 5'-P GACGUCAUAGUCUUUGCUCUU (antisense sequence); 2, GAAAGCACCUCCAGCGAUGUU (sense sequence) and 5'-P CAUCGCUGGAGGUGCUUUCUU (antisense sequence); 3, CAAAGAAGCUGUCAUGCGUUU (sense sequence) and 5'-P ACGCAUGACAG CUUCUUUGUU (antisense sequence); 4, CAGCCUACCUCACAGGACAUU (sense sequence) and 5'-P UGUCCUGUGAGGUAGGCUGUU (antisense sequence).

Transient transfection of FLS with siRNA (100 nM) was performed using the Human Dermal Fibroblast Nucleofector kit from Amaxa as previously described (4). FLS were then plated in 12-well plates (2 x 105 cells per well). All assays were performed 48 h after transfection. The control was conducted with the Dharmacon siControl nontargeting siRNA consisting of a four-oligonucleotides pool. Transfection efficiency was evaluated with the pmaxGFP control vector. Cell numbers and cell viability were assessed using the MTT test as described elsewhere (19).

Cell activation

Cells were stimulated with protein I/II (125 pM) diluted in serum-free RPMI 1640 with antibiotics or LPS (1 µg/ml) (Salmonella abortus-equi; Sigma-Aldrich) diluted in medium containing 5% heat-inactivated FCS. After stimulation, supernatants were harvested and assayed for cytokine content by using commercially available ELISA reagents for human (DuoSet; R&D Systems) and mouse (OptEIA kits, BD Pharmingen) IL-6.

Western blot detection of tyrosine phosphorylation

FLS (106 cells) were incubated for various times with LPS (1 µg/ml) or protein I/II (125 pM). Controls were performed with cells maintained in serum free-medium (protein I/II) or medium with 5% FCS (LPS) for 15 min. After stimulation, cells were centrifuged and the pellets were suspended 20 min on ice in 100 µl of ice-cold lysis buffer (1% Triton X-100, 20 mM Tris-HCl (pH 8.0), 130 mM NaCl, 10% glycerol, 1 mM sodium orthovanadate, 2 mM EDTA, 1 mM PMSF, and protease inhibitors). Lysates were centrifuged for 10 min at 14,000 x g at 4°C and supernatants were subjected to SDS-PAGE and transferred electrophoretically to nitrocellulose membranes. Membranes were blocked using 1% BSA in TBS (20 mM Tris (pH 7.5) and 150 mM NaCl) for 1 h at 25°C. The blots were incubated with anti-phospho-Etk (Y40) rabbit polyclonal Abs (US Biological) for 2 h at 25°C followed by incubation with HRP-conjugated goat anti-rabbit IgG polyclonal Abs (1 h at 25°C) and detected by ECL (SuperSignal West Femto Maximum Sensitivity Substrate; Pierce) according to the manufacturer’s instructions. To confirm the presence of equal amounts of Etk, bound Abs were removed from the membrane by incubation in 62.5 mM Tris, (pH 6.7), 100 mM 2-ME, and 2% SDS for 30 min at 50°C and reprobed again with anti-Etk (clone 40) mouse mAbs (BD Transduction Laboratories).

Cell lysates from LPS and protein I/II stimulated FAK+/+ and FAK–/– cells were centrifuged (14,000 x g for 10 min at 4°C) and supernatants (0.5–1 mg/ml protein) were precleared by mixing with protein G-Sepharose 4 Fast Flow (Sigma-Aldrich) in 50 mM Tris-HCl (pH 7.4), 150 mM NaCl, and 1 mM EDTA for 2 h at 4°C. Immunoprecipitation was performed with anti-phosphotyrosine mAbs (pY20)/protein G-Sepharose 4 Fast Flow (Sigma-Aldrich) or anti-Mal rabbit polyclonal Abs (FL-235, Santa-Cruz Biotechnology)/protein A-Sepharose 4 Fast Flow for 18 h at 4°C. Samples were washed with the lysis buffer (12,000 x g for 20 s) and the complexes were eluted with Laemmli buffer (Bio-Rad) for 10 min at 95°C and centrifuged at 12,000 x g for 20 s. Immunoprecipitates were separated by SDS-PAGE and further analyzed by Western blotting using anti-Mal rabbit polyclonal Abs or anti-Etk (clone 40) mouse mAbs or anti-phosphotyrosine mAbs (pY20). Blots were then incubated with HRP-conjugated anti-rabbit and anti-mouse IgG polyclonal Abs (1 h at 25°C) and detected by ECL (Super Signal West Femto Maximum Sensitivity Substrate; Pierce) according to the manufacturer’s instructions.

Coimmunoprecipitation analysis

FLS (4 x 106 cells) were incubated for 10 min with LPS (1 µg/ml) or protein I/II (125 pM). Controls were performed with serum free-medium (protein I/II) or medium with 5% FCS. After centrifugation, cells were suspended in ice cold-PBS containing 1 mM sodium orthovanadate and protease inhibitors and then disrupted by sonication. Cell lysates were centrifuged (14,000 x g for 10 min at 4°C) and supernatants (0.5–1 mg/ml protein) were precleared by mixing with protein G-Sepharose 4 Fast Flow in 50 mM Tris-HCl (pH 7.4), 150 mM NaCl, and 1 mM EDTA for 2 h at 4°C. FAK complexes were immunoprecipitated from supernatants using anti-FAK mouse mAbs/protein G-Sepharose 4 Fast Flow for 18 h at 4°C. Equal amounts of mouse IgG were used as negative controls (Alpha Diagnostic International). Samples were washed with the lysis buffer (12,000 x g for 20 s) and the complexes were eluted with Laemmli buffer (Bio-Rad) for 10 min at 95°C and centrifuged at 12,000 x g for 20 s. Immunoprecipitates were separated by SDS-PAGE and further analyzed by Western blotting using anti-Mal and anti-MyD88 (HFL-296; Santa Cruz Biotechnology) rabbit polyclonal Abs and anti-Etk (clone 40) mouse mAbs.

Statistical methods

Values are represented as the mean ± SEM. The significance of the results was analyzed by ANOVA with pairwise comparison by Scheffe’s method using Stat View software. Values of p < 0.05 were considered significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
LPS and protein I/II induce phosphorylation of Etk in RA FLS

Etk, which belongs to the Tec family of tyrosine kinases, is the most ubiquitously expressed member of this group. Etk is present in various cell types such as epithelial and endothelial cells and fibroblasts but is absent in myeloid cells. In this study, we first verified that Etk is expressed in human FLS isolated from four RA patients. Cell lysates were analyzed directly by Western blotting with specific anti-Etk Abs. As shown in Fig. 1A, Etk was detectable in the FLS of all RA patients.


Figure 1
View larger version (48K):
[in this window]
[in a new window]

 
FIGURE 1. Etk is phosphorylated in protein I/II (125 pM)- and LPS (1 µg/ml)-stimulated FLS. A, Etk expression in FLS isolated from four RA patients was determined by Western blotting with anti-Etk (clone 40) mouse mAbs. The results shown are representative of two experiments. IB, Immunoblotting. B and C, FLS were incubated in either serum-free medium (T) or 5% FCS medium (C) for 15 min or treated with protein I/II (125 pM) (B) or LPS (1 µg/ml) (C) for the indicated times. Cell lysates were analyzed by Western blotting with anti-phospho-Etk (Petk; p40) rabbit polyclonal Abs. For protein loading control, membranes were reprobed with anti-Etk (clone 40) mouse mAbs. The results shown are representative of three separate experiments.

 
Etk is involved in integrin signaling and promotes cell migration. To determine whether the stimulation of FLS with protein I/II had any effect on Etk activation, we analyzed the tyrosine phosphorylation of Etk in response to protein I/II. Cell lysates were analyzed by blotting with specific anti-phospho-Etk Abs (Y40). Stimulation of FLS with protein I/II (125 pM) for various times (5, 10, 15, and 30 min) resulted in an increased amount of phosphorylated Etk which was detectable within 5 min and remained elevated for at least 15 min (Fig. 1B). We also analyzed the phosphorylation state of Etk in response to LPS (1 µg/ml). Similar results were obtained as shown in Fig. 1C.

LPS and protein I/II-induced IL-6 release is dependent on Etk

We then tested the role of Etk in IL-6 release from FLS activated with LPS or protein I/II. Doubled-strand siRNA have emerged as powerful tools to examine the function of specific gene products. We used a combination of four siRNA duplexes targeting Etk. FLS were transfected with Etk siRNA duplexes at a concentration of 100 nM. GFP was used to evaluate transfection efficiency. As shown in Fig. 2A, transfection of Etk siRNA impaired endogenous Etk protein expression as compared with Etk expression in cells transfected with a nontargeting siRNA (control). To exclude the possibility that nonspecific effects of Etk siRNA could contribute to the results, we examined the expression of β-actin in the same lysates of FLS transfected with Etk siRNA. Transfection with control or Etk siRNA did not change the expression of β-actin. These data showed the specificity of the siRNA silencing of endogenous Etk.


Figure 2
View larger version (17K):
[in this window]
[in a new window]

 
FIGURE 2. siRNA-mediated inhibition of Etk impaired IL-6 release by LPS- and protein I/II-activated FLS. A, Effect of Etk siRNA on FLS endogenous Etk expression. The expression of Etk was analyzed by Western blotting 48 h posttransfection of the siRNA duplexes added in combination (final concentration: 100 nM). As control, FLS were transfected with nontargeting siRNA (Cont). IB, Immunoblotting. B and C, Etk expression was normalized to β-actin levels of total cell extracts. Forty-eight hours posttransfection FLS were incubated in either serum-free medium (T) or 5% FCS medium (C) or treated with protein I/II (125 pM) (B) or LPS (1 µg/ml) (C) for another 20 h at 37°C. Cell supernatants were harvested and IL-6 levels were determined using ELISA. Data represent mean values ± SD for triplicate determinations from three identical experiments **, p < 0.02; ***, p< 0.03. D, Macrophages from wild-type mice or mice deficient for Btk were stimulated with protein I/II (PI/II)(125 pM) or LPS (1 µg/ml) for 20 h. IL-6 levels were quantified by ELISA. Data are expressed as mean values ± SD and are representative of two experiments with n = 2 mice per genotype. **, p < 0.02.

 
To determine whether Etk is necessary for IL-6 release by stimulated FLS, FLS were transfected with targeting and nontargeting Etk siRNA for 48 h and cells were then stimulated with LPS (1 µg/ml) or protein I/II (125 pM) for 20 h at 37°C. Supernatants were tested for the level of IL-6 using ELISA. As illustrated in Fig. 2B, treatment with targeting Etk siRNA significantly reduced IL-6 release by protein I/II-stimulated FLS as compared with IL-6 release by FLS transfected with nontargeting Etk siRNA (9 ± 0.1 vs 21 ± 0.7 ng/ml; p < 0.02). Similar results were obtained with LPS: 1 ± 0.07 vs 13 ± 1 ng/ml; p < 0.03) (Fig. 2C). The effect of transfection on cell viability was also determined by the MTT test with no significant difference observed for cells transfected with targeting and nontargeting siRNA. Taken together, these data demonstrate that Etk is involved in {alpha}5β1 integrin and TLR4 signaling leading to IL-6 release by activated FLS.

We also evaluated the response of Btk–/– macrophages stimulated with either LPS or protein I/II. As shown in Fig. 2D, IL-6 release was significantly reduced in Btk–/– macrophages as compared with IL-6 release by wild-type macrophages. These results indicate that in LPS or protein I/II-stimulated macrophages, IL-6 release is also in part Btk dependent.

Etk associates with FAK, MyD88, and Mal

In our first analysis of the cross-talk between FAK and MyD88, we had observed that MyD88 is not essential for FAK activation because this kinase is phosphorylated in MyD88–/– macrophages activated with either LPS or protein I/II. These results indicated that FAK occurs upstream of MyD88 recruitment. FAK is also an activator of Etk. Thus, it is conceivable that FAK might lead to the recruitment of MyD88 via Etk because this kinase is implicated in both signaling pathways. To test this hypothesis, coimmunoprecipitation experiments were conducted in FLS activated for 10 min with LPS or protein I/II. Cell lysates were immunoprecipitated with anti-FAK Abs and analyzed by blotting using anti-MyD88, anti-Etk, and anti-Mal Abs. As shown in Fig. 3A, Etk was detected by Western blot analysis via anti-Etk immunoblotting in FAK immune complexes from LPS-activated FLS. Moreover, MyD88 and Mal were also detected in FAK immune complexes by anti-MyD88 and anti-Mal immunoblotting. A light constitutive association of Etk, MyD88, and Mal with FAK was observed in unstimulated cells. Likewise, similar results were obtained when FLS were stimulated with protein I/II for 10 min (Fig. 3B).


Figure 3
View larger version (43K):
[in this window]
[in a new window]

 
FIGURE 3. Etk, Mal, and MyD88 associate with FAK in LPS and protein I/II-activated FLS. FLS were stimulated either with LPS (1 µg/ml) (A) or protein I/II (125 pM) (B) for 10 min at 37°C. Coimmunoprecipitation was performed with anti-FAK mouse mAbs or mouse IgG controls and immunoprecipitates were analyzed by Western blotting using anti-Etk mouse mAbs and anti-Mal and anti-MyD88 rabbit polyclonal Abs. Coimmunoprecipitates isolated from FLS treated with serum-free medium (T) or 5% FCS medium (C) were used as negative controls (left sides of A and B). The results shown are representative of three separate experiments. IB, Immunoblotting; IP, immunoprecipitation.

 
We therefore postulated that Etk formed a complex with FAK, MyD88, and Mal in LPS and protein I/II-activated FLS.

Mal is implicated in IL-6 release from LPS and protein I/II stimulated FLS

It was recently demonstrated that Mal is recruited to the plasma membrane by its PIP2 binding domain and then functions to recruit MyD88 to activated TLR4 to initiate signal transduction. To further define the role of Mal in the cross-talk between FAK and MyD88 in FLS, we analyzed the requirement for Mal in IL-6 release from activated FLS. As previously described for Etk, FLS were transfected with targeting and nontargeting Mal siRNA duplexes for 48 h and cells were then stimulated with LPS (1 µg/ml) or protein I/II (125 pM) for 20 h at 37°C. Supernatants were tested for levels of IL-6 using ELISA. As illustrated in Fig. 4, impaired expression of Mal (Fig. 4A) significantly reduced IL-6 release by protein I/II- (Fig. 4B) and LPS-stimulated FLS (Fig. 4C) (11 ± 0.05 vs 1 9 ± 0.02 ng/ml (p < 0.02) and 6 ± 0.04 vs 13 ± 0.03 ng/ml (p < 0.001), respectively). These data indicate that IL-6 release in response to LPS or protein I/II is dependent on Mal.


Figure 4
View larger version (11K):
[in this window]
[in a new window]

 
FIGURE 4. siRNA-mediated inhibition of Mal impaired IL-6 release by LPS and protein I/II activated-FLS. A, The expression of Mal was analyzed by Western blotting 48 h posttransfection of siRNA duplexes added in combination (final concentration: 100 nM). As control, FLS were transfected with nontargeting siRNAs (cont). IB, Immunoblotting. B and C, Etk expression was normalized to β-actin levels of total cell extracts. FLS transfected with Mal siRNA or control nontargeting siRNA were incubated 48 h posttransfection in either serum-free medium (T) or 5% FCS medium (C) or treated with protein I/II (PI/II; 125 pM) (B) or LPS (1 µg/ml) (C). After 20 h of stimulation the supernatants were harvested and analyzed for IL-6 production using ELISA. Data represent mean values ± SD for triplicate determinations from three identical experiments. **, p < 0.02; ***, p < 0.001.

 
LPS and protein I/II induced phosphorylation of Etk and Mal in RA FLS via a FAK-dependent pathway

Previous results have shown that activation of Etk by extracellular matrix proteins is regulated by FAK through an interaction between the PH domain of Etk and the FERM domain of FAK. Y40 is a phosphorylation site for FAK and its phosphorylation is required for Etk activation. We next asked whether FAK could be implicated in Etk phosphorylation in response to LPS (1 µg/ml) and protein I/II (125 pM). To test this hypothesis, we used FAK+/+ and FAK–/– primary mouse embryo fibroblasts. FAK+/+ and FAK –/– cells were incubated with LPS or protein I/II for various times and immunoblotting experiments were performed. As shown in Fig. 5, stimulation of FAK +/+ cells with either LPS (Fig. 5A) or protein I/II (Fig. 5B) increased Etk phosphorylation; however, both stimuli failed to stimulate tyrosine phosphorylation of Etk in FAK –/– cells. Taken together, these results indicate that Etk phosphorylation is modulated by FAK in protein I/II- and LPS-stimulated cells and suggest that Etk could serve as a common signal transducer in response to integrin {alpha}5β1 and TLR4 ligands.


Figure 5
View larger version (49K):
[in this window]
[in a new window]

 
FIGURE 5. FAK is necessary for protein I/II and LPS-induced-Etk phosphorylation. FAK–/– and FAK+/+ primary mouse embryo fibroblasts were incubated in either serum-free medium (T) or 5% FCS medium (C) or treated with LPS (1 µg/ml) (A) or protein I/II (125 pM) (B) for the indicated times. Immunoprecipitation (Ip) was performed with anti-phosphotyrosine (anti-pY) mAbs (pY20), followed by immunoblotting (IB) with anti-Etk (clone 40) mouse mAbs. Lysates were also used for total protein blotting using anti-Etk (clone 40) mouse mAbs to confirm the presence of equal levels of Etk protein between samples. The results shown are representative of three separate experiments.

 
Recent evidence also indicated that in THP1 monocytic cells, Mal is phosphorylated during TLR2 and TLR4 signal transduction. To establish whether or not the phosphorylation of Mal is dependent on FAK, we analyzed tyrosine phosphorylation of Mal. Cells were incubated with LPS or protein I/II for various times and immunoblotting experiments were performed. Stimulation of FAK +/+ cells with either LPS or protein I/II increased Mal phosphorylation (Fig. 6), whereas both stimuli failed to stimulate tyrosine phosphorylation of Mal in FAK–/– cells. Taken together, these results indicate that Mal phosphorylation is modulated by FAK in protein I/II- and LPS-stimulated FLS. These results provided further support that Etk and Mal are main components of the cross-talk between FAK and MyD88 and that FAK plays an essential role in their recruitment and activation.


Figure 6
View larger version (63K):
[in this window]
[in a new window]

 
FIGURE 6. Mal is phosphorylated via a FAK-dependent pathway. FAK+/+ and FAK–/– primary mouse embryo fibroblasts were incubated in either serum-free medium (T) or 5% FCS medium (C) or stimulated with protein I/II (125 pM) (C) or LPS (1 µg/ml) (A and B) for the indicated times. Immunoprecipitation (IP) was performed with anti-phosphotyrosine (anti-pY) mAbs (pY20) followed by immunoblotting with anti-Mal rabbit polyclonal Abs or anti-Mal rabbit polyclonal Abs followed by immunoblotting with anti-phosphotyrosine mAbs (pY20) (A). Lysates or immunoprecipitates were also used for total protein blotting using anti-Mal rabbit polyclonal Abs to confirm the presence of equal levels of Mal protein between samples. The results shown are representative of three separate experiments.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
In the present study we first demonstrated that Etk plays an important role in protein I/II-integrin-induced cytokine release. Several lines of evidence are presented to support this notion. First, we found that activation of FLS with protein I/II resulted in increased phosphorylation of Etk on Y40, which is required for Etk activation. Secondly, in FLS transfected with siRNA targeting Etk there is a failure to respond to protein I/II treatment as determined by their reduced IL-6 production after stimulation. Activation of Etk by integrins in response to extracellular matrix proteins has been documented in epithelial and endothelial cells where Etk is known to promote cell migration (14). But this is the first study to demonstrate that Etk is implicated in signaling pathways leading to proinflammatory cytokine release in response to integrin {alpha}5β1 stimulation, suggesting that integrin function is regulated by Etk at multiple steps.

Moreover, we also showed that Etk is involved in TLR4 signaling in FLS stimulated with LPS because Etk is phosphorylated in response to LPS and, furthermore, IL-6 response to LPS is severely impaired in FLS transfected with targeting Etk siRNA. Our findings extend to Etk the observation that Btk, another member of the Tec tyrosine kinase family, is involved in TLR signaling. In XLA monocytes that lack functional Btk there is a failure to respond to LPS as determined by their reduced TNF-{alpha} production after stimulation (20). Activation of Btk was also found to be required for the TLR2-induced expression of TNF-{alpha} and IL-1β in primary human monocytes/macrophages (21, 22). Btk is implicated in TLR-induced IL-10 production (23). But the findings of Horwood et al. (22) revealed an unexpected level of complexity insofar as they showed that in primary human macrophages Btk is not required for TLR2- and TLR4-induced IL-6 and IL-8 release from X-linked agammaglobulinemia PBMC stimulated with LPS. These data are, however not in agreement with two of our observations: 1) that Btk–/– macrophages stimulated with either LPS or protein I/II showed an impaired release of IL-6 as compared with wild-type cells; and 2) that in FLS Etk is necessary for IL-6 production in response to LPS and protein I/II. The reason for this discrepancy is not clear at present. IL-6 and TNF-{alpha} synthesis is highly dependent on NF-{kappa}B, and Btk is known to phosphorylate the NF-{kappa}B p65 unit that is critical for the activation of NF-{kappa}B. But these cytokines are differentially regulated and the most likely explanation is that selective regulation pathways may be used by various cells. In fact, FLS stimulated by TLR ligands never produce TNF-{alpha} and IL-1β.

It remained, however, undetermined whether Etk was implicated in the cross-talk between FAK and MyD88. To this end, we performed coimmunoprecipitation with anti-FAK Abs. Etk was found to form a complex with FAK and MyD88 in lysates from FLS activated with either LPS or protein I/II. These results support the conclusion that Etk contributes to the cross-talk between MyD88 and FAK. We also identified Mal in the complex. Mal is a Toll/IL-1R (TIR)-containing adaptor implicated in MyD88-dependent signaling (24, 25). We further defined the role of Mal by using siRNA targeting Mal. As a result, IL-6 release from LPS- and protein I/II-activated FLS was impaired. Consequently, our results supported a role for Mal in the cross-talk leading to IL-6 release in response to TLR4 and integrin {alpha}5β1 stimulation. These data are in agreement with previous results (26) demonstrating that Mal is implicated in LPS-induced cytokine production in synovial fibroblasts but not in macrophages. Recently the exact mechanism of Mal engagement by TLR4 was demonstrated (4): Mal contains a PIP2-binding domain that mediates its recruitment to the membrane and facilitates the delivery of MyD88 to activated TLR4. However, the role of Mal as a sorting adaptor that is required for the efficient recruitment of MyD88 to a subset of TLR is quite difficult to imagine in the protein I/II/integrin {alpha}5β1 pathway. Indeed, we demonstrated previously using macrophages isolated from TLR4–/–, TLR2–/–, and TLR6–/– mice that protein I/II-induced IL-6 release is completely independent of these TLRs (6). One might speculate that Mal contributes to the recruitment of MyD88, which was demonstrated to be essential in IL-6 release in response to protein I/II, and that the recruitment of MyD88 is sufficient to activate downstream signaling pathways. But how Mal is recruited to the membrane in our model remained unclear.

We also demonstrated that Etk phosphorylation is dependent on FAK because Etk phosphorylation is inhibited in FAK–/– fibroblasts stimulated with either LPS or protein I/II. These results are not entirely unexpected, as it was demonstrated previously that the activation of Etk by the extracellular matrix is regulated by FAK through the interaction between the PH domain of Etk and the FERM domain of FAK (14). Our results strongly argue that FAK is an upstream kinase that is required for Etk activation even when integrins are activated by other ligands such as protein I/II. These findings correlate well with our previous data showing that FAK is probably an upstream activator of this pathway because FAK remained phosphorylated in MyD88–/– macrophages (6). The relatively equivalent activation of Etk and FAK suggest that the activation of Etk might be a one-step process; nevertheless, it cannot be excluded that additional components might be required to activate Etk kinases. Src kinase could be one of these components. Indeed, activation of the Btk family kinases via direct phosphorylation by Src family kinases was demonstrated (27, 28); the association of Etk with FAK opens the close conformation of Etk, which becomes accessible to FAK-associated Src kinases. This is probably not the case in our model as in previous experiments; having addressed the involvement of Src kinases in protein I/II signaling we have found that protein I/II did not activate Src (L. A. Neff, unpublished data). Accordingly, recent data (29) demonstrated that TNF-{alpha} activates FAK but that FAK-associated signaling promoting IL-6 expression and release does not require Src.

Insights in the potential molecular mechanisms implicated in FAK/Etk/Mal signaling connections came from results showing that Mal is phosphorylated in FAK+/+ cells in response to LPS and protein I/II and that this phosphorylation is completely abolished in FAK–/– cells. These results support the conclusion that FAK expression is necessary for efficient phosphorylation of Mal after stimulation with LPS and protein I/II. The role of FAK seems specific to this pathway because we demonstrated the involvement of FAK in the TLR2-dependent secretion of IL-6 (6), whereas FAK does not play any role in the TLR3-dependent secretion of IL-6 in which neither Mal nor MyD88 are involved (data not shown). Phosphorylation of Mal is critical in TLR signaling as was recently shown by Gray et al. who demonstrated that following activation of TLR2 and TLR4 in the monocytic THP-1 cell line, Mal is tyrosine phosphorylated and that this phosphorylation is required for Mal to signal through transactivation of NF-{kappa}B subunit p65 (11). As it has also been demonstrated that in combination with signaling, phosphorylation of Mal allows its degradation by SOCS-1 (suppressor of cytokine signaling 1), ending TLR signaling (30), we can therefore postulate that FAK may contribute to Mal behavior and play an important role in TLR signaling pathway regulation.

In conclusion, our data provide support that in FLS, Etk and Mal are implicated in the cross-talk between FAK and MyD88 and that their being brought into play is clearly dependent of FAK. Overall, these data indicate that the stimulation of innate immunity leading to cytokine synthesis is regulated by a complex network that can be shared by pattern recognition receptors belonging to different families. The understanding of these complex interactions is important for therapeutic applications.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
We have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by grants from Bristol Myers Squibb, Roche, and Pfizer (to J.S.). Back

2 J.S. and D.W. contributed equally to this work. Back

3 Address correspondence and reprint requests to Dr. Dominique Wachsmann, EA3432, Unité de Formation et de Recherche Sciences Pharmaceutiques, 74 Route du Rhin, 67401 Illkirch, France. E-mail address: dominique.wachsmann{at}pharma.u-strasbg.fr Back

4 Abbreviations used in this paper: PIP2, phosphatidyl inositol 4,5-biphosphate; Btk, Bruton’s tyrosine kinase; FAK, focal adhesion kinase; FLS, fibroblast-like synoviocyte; PH, pleckstrin homology; RA, rheumatoid arthritis; siRNA, small interfering RNA. Back

Received for publication September 7, 2007. Accepted for publication December 17, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Takeda, K., S. Akira. 2005. Toll-like receptors in innate immunity. Int. Immunol. 17: 1-14. [Abstract/Free Full Text]
  2. Gay, N. J., M. Gangloff. 2007. Structure and function of Toll receptors and their ligands. Annu. Rev. Biochem. 76: 23.1-23.25.
  3. Lee, M. S., Y. J. Kim. 2007. Signaling pathways downstream of pattern-recognition receptors and their cross-talk. Annu. Rev. Biochem. 76: 13.1-13.34.
  4. Kagan, J. C., R. Medzhitov. 2006. Phosphoinositide-mediated adaptor recruitment controls toll-like receptor signaling. Cell 125: 943-955. [Medline]
  5. Fitzgerald, K. A., Z. J. Chen. 2006. Sorting out Toll signals. Cell 125: 943-955. [Medline]
  6. Zeisel, M. B., V. A. Druet, J. Sibilia, J. P. Klein, V. Quesniaux, D. Wachsmann. 2005. Cross talk between MyD88 and focal adhesion kinase pathways. J. Immunol. 174: 7393-7397. [Abstract/Free Full Text]
  7. Parsons, J. T.. 2003. Focal adhesion kinase: the first ten years. J. Cell Sci. 116: 1409-1416. [Abstract/Free Full Text]
  8. Jefferies, C. A., S. Doyle, C. Brunner, A. Dunne, E. Brint, C. Wietek, E. Walch, T. Wirth, L. A. O’Neill. 2003. Bruton’s tyrosine kinase is a Toll/interleukin-1 receptor domain-binding protein that participates in nuclear factor {kappa}B activation by Toll-like receptor 4. J. Biol. Chem. 278: 26258-26264. [Abstract/Free Full Text]
  9. Jefferies, C. A., L. A. O’Neill. 2004. Bruton’s tyrosine kinase (Btk)-the critical tyrosine kinase in LPS signalling?. Immunol. Lett. 92: 15-22. [Medline]
  10. Mukhopadhyay, S., M. Mohanty, A. Mangla, A. George, V. Bal, S. Rath, B. Ravindran. 2002. Macrophage effector functions controlled by Bruton’s tyrosine kinase are more crucial than the cytokine balance of T cell responses for microfilarial clearance. J. Immunol. 168: 2914-2921. [Abstract/Free Full Text]
  11. Gray, P., A. Dunne, C. Briskos, C. A. Jefferies, S. L. Doyle, L. A. O’Neill. 2006. MyD88 adapter-like (Mal) is phosphorylated by Bruton’s tyrosine kinase during TLR2 and TLR4 signal transduction. J. Biol. Chem. 281: 10489-10495. [Abstract/Free Full Text]
  12. Qiu, Y., H. J. Kung. 2000. Signaling network of the Btk family kinases. Oncogene 19: 5651-5661. [Medline]
  13. Takesono, A., L. D. Finkelstein, P. L. Schwartzberg. 2002. Beyond calcium: new signalling pathways for Tec family kinases. J. Cell Sci. 115: 3039-3048. [Abstract/Free Full Text]
  14. Chen, R., O. Kim, M. Li, X. Xiong, J. L. Guan, H. J. Chen, Y. Shimizu, Y. Qiu. 2001. Regulation of the PH-domain-containing tyrosine kinase Etk by focal adhesion kinase through the FERM domain. Nat. Cell. Biol. 3: 439-444. [Medline]
  15. Chatenay-Rivauday, C., I. Yamodo, M. A. Sciotti, J. A. Ogier, J. P. Klein. 1998. The A and the extended V N-terminal regions of streptococcal protein I/IIf mediate the production of tumour necrosis factor {alpha} in the monocyte cell line THP-1. Mol. Microbiol. 29: 39-48. [Medline]
  16. Neff, L., M. Zeisel, J. Sibilia, M. Scholler-Guinard, J. P. Klein, D. Wachsmann. 2001. NF-{kappa}B and the MAP kinases/AP-1 pathways are both involved in interleukin-6 and interleukin-8 expression in fibroblast-like synoviocytes stimulated by protein I/II, a modulin from oral streptococci. Cell. Microbiol. 3: 703-712. [Medline]
  17. Neff, L., M. Zeisel, V. Druet, K. Takeda, J. P. Klein, J. Sibilia, D. Wachsmann. 2003. ERK 1/2- and JNKs-dependent synthesis of interleukins 6 and 8 by fibroblast-like synoviocytes stimulated with protein I/II, a modulin from oral streptococci, requires focal adhesion kinase. J. Biol. Chem. 278: 27721-22728. [Abstract/Free Full Text]
  18. Muller, M., H. P. Eugster, M. Le Hir, A. Shakhov, F. Di Padova, C. Maurer, V. F. Quesniaux, B. Ryffel. 1996. Correction or transfer of immunodeficiency due to TNF: LT{alpha} deletion by bone marrow transplantation. Mol. Med. 2: 247-255. [Medline]
  19. Mosmann, T.. 1983. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J. Immunol. Methods 65: 55-63. [Medline]
  20. Horwood, N. J., T. Mahon, J. P. McDaid, J. Campbell, H. Nano, F. M. Brennan, D. Webster, B. M. Foxwell. 2003. Bruton’s tyrosine kinase is required for lipopolysaccharide-induced tumor necrosis factor {alpha} production. J. Exp. Med. 197: 1603-1611. [Abstract/Free Full Text]
  21. Liljeroos, M., R. Vuolteenaho, S. Morath, T. Hartung, M. Hallman, M. Ojaniemi. 2007. Bruton’s tyrosine kinase together with PI 3-kinase are part of Toll-like receptor 2 multiprotein complex and mediate LTA induced Toll-like receptor 2 responses in macrophages. Cell. Signal. 19: 625-633. [Medline]
  22. Horwood, N. J., T. H. Page, J. P. McDaid, C. D. Palmer, J. Campbell, T. Mahon, F. M. Brennan, D. Webster, B. M. Foxwell. 2006. Bruton’s tyrosine kinase is required for TLR2 and TLR4-induced TNF, but not IL-6, production. J. Immunol. 176: 3635-3641. [Abstract/Free Full Text]
  23. Schmidt, N. W., V. T. Thieu, B. A. Mann, A. N. Ahyi, M. H. Kaplan. 2006. Bruton’s tyrosine kinase is required for TLR-induced IL-10 production. J. Immunol. 177: 7203-7210. [Abstract/Free Full Text]
  24. Yamamoto, M., S. Sato, H. Hemmi, H. Sanjo, S. Uematsu, T. Kaishu, K. Hoshino, O. Takeuchi, M. Kobayashi, T. Fujita, et al 2002. Essential role for TIRAP in activation of the signaling cascade shared by TLR2 and TLR4. Nature 420: 324-329. [Medline]
  25. Sheedy, F. J., L. A. O’Neill. 2007. The troll in toll: Mal and Tram as bridges for TLR2 and TLR4 signaling. J. Leukocyte Biol. 82: 196-203. [Abstract/Free Full Text]
  26. Andreakos, E., S. M. Sacre, C. Smith, A. Lundberg, S. Kiriakidis, T. Stonehouse, C. Monaco, M. Feldmann, B. M. Foxwell. 2004. Distinct pathways of LPS-induced NF-{kappa}B activation and cytokine production in human myeloid and nonmyeloid cells defined by selective utilization of MyD88 and Mal/TIRAP. Blood 103: 2229-2237. [Abstract/Free Full Text]
  27. Tsai, Y. T., Y. H. Su, S. S. Fung, T. N. Huang, Y. Qiu, Y. S. Jou, H. M. Shih, H. J. Kung, R. H. Chen. 2000. Etk, a Btk family tyrosine kinase, mediates cellular transformation by linking Src to STAT3 activation. Mol. Cell. Biol. 20: 2043-2054. [Abstract/Free Full Text]
  28. Rawlings, D. J., A. M. Scharenberg, H. Park, M. I. Wahl, S. Lin, R. M. Kato, A. C. Fluckiger, O. N. Witte, J. P. Kinet. 1996. Activation of Btk by a phosphorylation mechanism initiated by Src family kinases. Science 271: 822-825. [Abstract]
  29. Schlaepfer, D. D., S. Hou, S. T. Lim, A. Tomar, H. Yu, D. A. Hanson, S. A. Uryu, J. Molina, S. K. Mitra. 2007. Tumor necrosis factor-{alpha} stimulates FAK activity required for mitogen-activated kinase-associated interleukin 6 expression. J. Biol. Chem. 282: 17450-17459. [Abstract/Free Full Text]
  30. Manswell, A., R. Smith, S. L. Doyle, P. Gray, J. E. Fenner, P. J. Crack, S. E. Nicholson, D. J. Hilton, L. A. O’Neill, P. J. Hertzog. 2006. Suppressor of cytokine signaling 1 negatively regulates Toll-like receptor signaling by mediating Mal degradation. Nat. Immunol. 7: 148-155. [Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
G. Alsaleh, G. Suffert, N. Semaan, T. Juncker, L. Frenzel, J.-E. Gottenberg, J. Sibilia, S. Pfeffer, and D. Wachsmann
Bruton's Tyrosine Kinase Is Involved in miR-346-Related Regulation of IL-18 Release by Lipopolysaccharide-Activated Rheumatoid Fibroblast-Like Synoviocytes
J. Immunol., April 15, 2009; 182(8): 5088 - 5097.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Semaan, N.
Right arrow Articles by Sibilia, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Semaan, N.
Right arrow Articles by Sibilia, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS