|
|
||||||||


* Department of Gene and Cell Medicine, Icahn Research Institute, Mount Sinai School of Medicine, New York, NY 10029;
Stowers Medical Institute, Harvard Stem Cell Institute and Department of Molecular and Cellular Biology, Harvard University, Cambridge, MA 02138; and
Department of Internal Medicine, Clinic of the University of Regensburg, Regensburg, Germany
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
E integrin subunit that pairs with β7 to generate a functional integrin that binds to E-cadherin (2). In the intestine, CD103+ DCs stand out among other intestinal DCs as the critical DC subset for inducing T regulatory cells (3, 4) and instructing expression of the gut-homing molecules CCR9 and
4β7 on T cells (3). It remains unknown whether CD103+ DCs in the lung function similarly as in the intestine. Recent data indicate that CD103+ lung DCs preferentially present Ag to CD8+ T lymphocytes (5). CD11bhigh lung DCs produce a broad spectrum of chemokines (6) and may be oriented toward perpetuation of airway effector responses and inflammation (7), whereas CD103+ lung DCs produce mainly CCL17 and CCL22 that attract Th2 and regulatory T cells (6). Both CD103+ and CD11bhigh DCs in the airway and lung parenchyma emigrate to the mediastinal (bronchial) lymph nodes, even in the steady state without overt inflammation (8). This ongoing migration out of the pulmonary space is substantial, such that the turnover time of airway DCs is brief, on the order of a few days (9, 10, 11, 12). However, the precursors that serve to replenish pulmonary DCs are fully not delineated. Recent data indicate that monocytes are precursors for pulmonary DCs (13, 14), but the various subpopulations of DCs in the lung were not specifically traced; therefore, many important questions regarding the role of monocytes as precursors for pulmonary DCs remain to be answered.
There are two main monocyte subsets in mice: CCR2highLy-6Chigh (also called Gr-1high) monocytes, which are the more classical monocytes that readily emigrate to sites of ongoing inflammation (15, 16, 17, 18, 19, 20, 21, 22, 23); and CCR2lowLy-6Clow (also called Gr-1low) monocytes (24, 25), which express the highest level of CX3CR1 among circulating adult leukocytes (15). The human counterparts of these subsets are CD14+CD16– and CD14lowCD16+ monocytes, respectively (15, 26). Mouse monocytes that develop in the bone marrow are mainly of the Ly-6Chigh population (27, 28). Ly-6Clow monocytes descend from Ly-6Chigh monocytes (13, 16, 28) through a conversion event that is not yet well characterized, and the biology of these monocytes is generally poorly understood. Ly-6Clow monocytes do not robustly emigrate to many tissues, but they do migrate well to lung even in the absence of inflammation (15). Thus, studies of their fate after emigration into lung may be especially useful in revealing insight into their differentiation and functional properties.
In this study, we conducted experiments to evaluate the role of each monocyte subset in giving rise to CD103+ or CD11bhigh pulmonary DCs. Our data reveal that CD103+ and CD11bhigh DCs in the lung arise from monocytes. However, the two subsets of monocytes become different types of DCs. Ly-6Clow monocytes develop into CD11bhigh DCs, whereas Ly-6Chigh monocytes become CD103+ DCs. Our data thus provide the first evidence that the two subsets of monocytes recruited to the same tissue undergo differential differentiation pathways within the DC lineage. Our data also provide insight into how the frequencies of CD103+ DCs vs CD11bhigh DCs in the lung, two populations with distinct functions in immunity, are regulated and may be manipulated.
| Materials and Methods |
|---|
|
|
|---|
C57BL/6 mice (CD45.2+ or CD45.1+) were purchased from Jackson ImmunoResearch Laboratories or the National Cancer Institute. These mice, or in other experiments not shown C57BL/Ka and C57BL/Ka-actin/eGFP mouse strains (bred and maintained at the Harvard School of Public Health (29)), were used in parabiotic studies wherein two mice are surgically joined. Parabiotic mice were sacrificed by 8 wk after surgery. The Institutional Animal Care and Use Committees at Mount Sinai School of Medicine or Harvard University approved all procedures.
LPS-treated mice
Fully anesthetized WT C57BL/6 mice were intranasally treated with 5 µg of LPS from Escherichia coli strain 026:B6 (catalog no. L-2880; Sigma-Aldrich), 5 µg of LPS from E. coli strain 055:B5 (catalog no. L-8274; Sigma-Aldrich), or no LPS. Intranasal deliveries were in 30-µl volumes of PBS. E. coli strain 055:B5 LPS induced a more robust neutrophil recruitment to the lungs compared with E. coli strain 026:B6 LPS. Blood and lungs were analyzed 1 day after intranasal delivery.
Transplantation of congenic bone marrow chimera
Seven- to 8-wk-old CD45.1+ congenic C57BL/6 mice were lethally irradiated with two doses of 650 rad 18 h apart. After the second irradiation, C57BL/6 CD45.1+ recipient mice received an i.v. injection of 1 x 106 cells of donor bone marrow cells. These bone marrow mixtures were WT CD45.1:WT CD45.2, WT CD45.1:CCR2 knockout (KO) CD45.2 (30), or WT CD45.1: CX3CR1gfp/gfp CD45.2 mice (31). CX3CR1gfp/gfp mice have replaced the fractalkine receptor gene with a GFP reporter, such that mice with two copies of GFP are devoid of an intact fractalkine receptor gene. For a control group, 100% WT CD45.2 bone marrow cells were transferred into lethally irradiated WT CD45.1 mice to confirm lethal irradiation of these recipient mice. Mice were sacrificed 8 wk after bone marrow transfer. All strains of mice were at least 10 generations backcrossed onto the C57BL/6 background.
Labeling monocytes with latex particles
Circulating monocytes were labeled with particulates as previously described (22, 28). In brief, Ly-6Clow monocytes were labeled by i.v. injection of 200 µl of 0.5-µm or 1.0-mm FITC-like plain latex microspheres (Polysciences) diluted to 0.1% (w/v) in PBS without calcium or magnesium. Labeling of Ly-6Chigh monocytes was achieved by first injecting 200 ml of clodronate-loaded liposomes (32) i.v. 18 h before a subsequent injection of latex beads (28). Mice were sacrificed at day 1, 2, 4, or 6 after monocyte labeling. In some cases, data were normalized to account for the fact that only a portion of a given monocyte subset carried latex. Normalization calculations were done as previously described (22). That is, we calculated the frequency of total labeled monocytes of each subset in the circulation. To do this for each animal at each time point available, we multiplied the percentage of blood PBMCs that were Ly-6Chigh or Ly-6Clow monocytes (depending on the subset being traced) by the percentage of latex+ monocytes. This value represents the percentage of latex+ PBMCs and is a reliable normalization factor because total PBMC counts did not vary significantly in response to any of the experimental manipulations. We then took a mean value of the relevant time points available. We divided the percent labeled pulmonary DCs by this fraction to derive a normalized value for how many DCs would be labeled if all monocytes of a given subset carried latex. Some mice received an i.v. injection of latex beads at the same time that 4 µg of pertussis toxin (P7208; Sigma-Aldrich) was injected, and then BAL cells carrying latex were quantified 1 day later.
Flow cytometry and monocyte counts
Blood was collected via tail vein bleeds in heparinized capillary tubes and 20 µl was placed into 400 µl of Turks blood diluting fluid for white blood cell counting (catalog no. 8850-16; Ricca Chemical). Total leukocyte counts were then measured using a hemocytometer. The total number of monocyte subsets per milliliter in the blood was calculated by using the percentage of a given monocyte subset, assessed by flow cytometry using the Abs described below, times the total number of leukocytes per milliliter.
Single-cell suspensions were obtained from BAL and whole lung parenchyma. Mice were sacrificed using CO2. BAL was obtained by flushing the airways four times with 1 ml of 0.5 mM EDTA/HBSS. After BAL collection, the blood was collected via the heart with a 1-ml syringe containing 10 µl of 100 mM EDTA. The blood was resuspended in 7.5 ml of ammonium chloride lysing reagent (BD Biosciences) for 5 min, followed by the addition of 7.5 ml of HBSS containing 0.2% BSA and 2 mM EDTA for 5 min. Then the blood was washed twice in DMEM. Immediately after blood extraction, the lungs were perfused through the heart with a 30-ml syringe containing 0.3 mM EDTA/PBS, which left the lungs free of visible blood. The lungs were then excised, minced, and digested with collagenase D (Roche) for 30 min. Single-cell suspensions were generated by pressing digested whole lung through a 70-µm cell strainer. Lastly, all cells were resuspended in FACS blocking solution and stained for 30 min with conjugated Abs from eBioscience or BD Biosciences. The following purified mAbs were used for staining: PE-conjugated mAbs to I-Ab, CD11b, CD115, or CD45.2; PerCP-conjugated mAbs to Gr-1 (recognizes Ly-6C and Ly-6G) or CD11b; and allophycocyanin-conjugated mAbs to CD11c, Gr-1 (recognizes Ly-6C and Ly-6G), or CD45.1. CCR2 mAb was previously described (33). Appropriate isotype-matched control mAbs were also obtained from BD Biosciences.
Polymerase chain reaction
Monocyte subsets were subjected to high-speed flow cytometric sorting to separate CD115+F4/80+ blood monocytes that were Ly-6Chigh or Ly-6Clow. RNA was isolated with TRIzol reagent according to the manufacturers instructions (Invitrogen Life Technologies). The purified RNA was subsequently reverse transcribed into cDNA using oligo(dT)12–18 primers (Invitrogen Life Technologies). Primers (5' to 3' sequences) for quantitative real-time PCR analysis were GAPDH sense, GTGGGGCGCCCCAGGCACCA and GAPDH antisense, GTCCTTAATGTCACGCACGATTTC. Bcl-2 primers were purchased from R&D Systems and used according to their recommendations.
Statistics
Statistical analysis was conducted using InStat and Prism software (GraphPad). All results are expressed as the mean ± SEM. Statistical tests were performed using the one-tailed Student t test. A value of p < 0.05 was considered statistically significant.
| Results |
|---|
|
|
|---|
In contrast to other organs, CD11c expression in the lung does not distinguish DCs and macrophages. Pulmonary DC and macrophage populations are both CD11c+ but can be distinguished by differing levels of surface MHC class II (MHC II) and autofluorescence. DCs have low autofluorescence, whereas macrophages are highly autofluorescent (34, 35) in both the bronchoalveolar space and lung interstitium (Fig. 1A). Low autofluorescent, MHC II+ DCs can be further distinguished by their expression of CD11b: one pulmonary DC subset is CD11c+CD11bhighCD103– DCs and the other is CD11c+CD11blowCD103+ DCs (1, 34, 35) (Fig. 1A).
|
Tracing the fate of labeled monocyte subsets in the lung and BAL
To study the fate of monocyte subsets in the lung, we first used methods to label monocytes endogenously with 0.5-µm latex beads introduced i.v. Depending on the conditions of labeling, Ly-6Chigh or Ly-6Clow monocytes are selectively labeled, and each population remains in the circulation for several days as they gradually decline in number within the blood (22, 28, 36). Within
1 wk after Ly-6Chigh monocytes are labeled, the fraction remaining in blood converts to Ly-6Clow monocytes (28). These methods do not affect the migration patterns of labeled monocytes and do not induce inflammatory cytokines that can be detected in serum (22). Indeed, results obtained with these methods are in complete agreement with adoptive transfer approaches in different models (22, 23, 36, 37) and have the capacity to sensitively trace endogenous monocytes.
Two cohorts of mice were independently treated to label Ly-6Clow or Ly-6Chigh monocyte subsets, and the migration and differentiation of each subset in lung and BAL were traced. To analyze the contribution of monocytes giving rise to DCs in the lung and BAL, total DCs were first gated (Fig. 2A, left plots) and then latex+ DCs were examined (Fig. 2A). Approximately 80% of the recovered latex+ DCs that originated from Ly-6Clow monocytes were CD11bhigh DCs, whereas the labeled Ly-6Chigh monocytes gave rise to both DC subsets at relatively equal frequency during all time points (Fig. 2, A and B). This outcome matches the staining pattern for CCR2, since the monocyte subset with the highest CCR2 expression was the only population of monocytes that was linked to the CD103+ DCs, which likewise express higher CCR2 than their CD11bhigh counterparts (Fig. 1C).
|
To estimate the extent to which blood monocyte subsets replaced lung or BAL DCs, we normalized to account for the fraction of each subset of monocyte that was labeled. The normalized data estimate the upper limit in the fraction of total DCs that would be labeled if all monocytes of a given subset had carried latex. Because the latex-labeling method may have some so far unrecognized impact on monocyte trafficking, we emphasize that these data are merely an estimate. Nonetheless, the data suggest that, collectively, the two monocyte subsets could account for the generation of the majority of interstitial DCs by day 4 after labeling (Fig. 2D). A major difference between the subsets, however, is that DCs generated from Ly-6Chigh monocytes account for most of the CD103+ DCs (Fig. 2D, compare height of black bars). Ly-6Clow and Ly-6Chigh monocytes appeared to contribute similarly to CD11bhigh DCs (Fig. 2D), closely resembling the outcome after monocyte adoptive transfer of Ly-6Chigh monocytes (14).
By comparison to interstitial lung DCs, BAL DCs were more slowly and less efficiently labeled and, even after normalization, only
20% of total DCs were replaced collectively by the two monocyte subsets within 6 days (Fig. 2D). Labeled DCs in the BAL were first evident at day 2, peaked at day 4, and decreased by day 6. By day 35, no latex+ DCs were found in BAL (data not shown), indicating that the label does not persist in the BAL indefinitely. Just as for interstitial DCs, essentially all latex-labeled CD103+ DCs in BAL arose only from the Ly-6Chigh monocyte subset (Fig. 2D), but both labeled monocytes subsets became CD103–CD11bhigh DCs.
Monocyte subsets and pulmonary DC subsets in parabiotic mice show matched frequency of mixing between parabionts
Considering this evidence along with the finding that adoptively transferred monocytes could, at minimum, differentiate into CD11bhigh DCs (14), we closely examined monocyte subsets in parabiotic mice and specifically compared the degree of mixing between the parabiotic partner genotypes within each blood monocyte subset to the degree of mixing of partner genotypes in pulmonary DC populations. Similar to Liu et al. (38), we observed that Ly-6Chigh monocytes (called inflammatory monocytes by Liu et al. (38)) were not fully mixed between the partners, possibly because the Ly-6Chigh monocytes emigrate from bone marrow and clear from the bloodstream more rapidly than they were able to mix between partners (38) (Fig. 3A). In these same parabiotic partners, however, blood Ly-6Clow monocytes were more evenly mixed between the partners (Fig. 3A), in agreement with Liu et al. (38) who called these cells "stationary monocytes." Blood Ly-6Clow monocytes arise with a few days delay from Ly-6Chigh monocytes (13, 16, 28); therefore, these monocytes likely had circulated to the other partner before or during their conversion from Ly-6Chigh monocytes. Pulmonary CD103+ DCs showed a very similar degree of mixing between partner genotypes as Ly-6Chigh monocytes, whereas CD11bhigh DCs showed the same degree of mixing as observed in Ly-6Clow monocytes (Fig. 3A). These data, therefore, lead to a similar indication as the latex bead tracking approach above, suggesting that Ly-6Clow monocytes preferentially give rise to CD11bhigh DCs and that CD103+ pulmonary DCs primarily derive from Ly-6Chigh monocytes. Next, in individual mice, a correlation with the fraction of Ly-6Clow monocytes and the fraction of CD11bhigh pulmonary DCs was observed in response to LPS challenge. Introduction of LPS into the airway led to a doubling in the number of DCs in the BAL 24 h later (data not shown), a condition in which new DCs are rapidly recruited. LPS treatment intranasally also shifted monocyte toward the Ly-6Clow subset (Fig. 3B). We observed a close correlation between the fraction of Ly-6Clow monocytes and the fraction of CD11bhigh pulmonary DCs in lung and BAL using two types of LPS (Fig. 3B). These data fit well with the possibility that newly recruited monocytes during inflammation may differentiate into pulmonary DC subsets that reflect the frequency of monocyte subsets in the blood. In particular, there was a strong relationship between the percentage of Ly-6Clow monocytes in blood and the percentage of BAL or lung DCs (Fig. 3B) that were CD11bhigh, in agreement with the hypothesis that Ly-6Clow monocytes give rise to CD11bhigh DCs and Ly-6Chigh monocytes to CD103+ DCs.
|
To further test the respective roles of monocyte subsets in serving as precursors of pulmonary DCs, we analyzed how pulmonary DC subsets were affected by perturbations in the major chemokine receptor pathways that characterize the monocyte subsets. Ly-6Chigh monocytes express CCR2 (15, 24) and use it to exit the bone marrow and enter blood (27), such that in CCR2-deficient mice, Ly-6Clow monocytes in the blood are nearly normal (21, 25) but Ly-6Chigh monocytes are markedly reduced (21, 27). Thus, if Ly-6Chigh monocytes were crucial precursors for CD103+ pulmonary DCs, then these DCs should be more readily replaced by WT precursors than CCR2–/– precursors in chimeric mice bearing mixed bone marrow cells from WT and CCR2–/– mice.
Ly-6Clow monocytes express lower levels of CCR2 than Ly-6Chigh monocytes (25) (Fig. 1C), but they express high levels of CX3CR1 (15). We observed that CD11bhigh pulmonary DCs were markedly and selectively reduced in naive CX3CR1-deficient mice (CX3CR1gfp/gfp; Fig. 4A). That is, the total number of pulmonary DCs was not altered in these strains, but the fraction of CD11bhigh DCs was significantly reduced compared with their WT counterparts (Fig. 4A). Thus, in addition to generating mixed bone marrow chimeras to analyze the role of CCR2 in maintaining CD103+ pulmonary DCs in the steady state, we generated bone marrow chimeras wherein WT and CX3CR1-deficient cells were competed to determine whether reduced CD11bhigh pulmonary DCs might be linked, at least in part, to a defect in Ly-6Clow monocytes.
|
Analysis of the blood of mice that received a mixture of WT and CX3CR1-deficient cells revealed a selective deficiency in the number of Ly-6Clow monocytes that derived from CX3CR1-deficient cells, compared with their WT CD45.2+ counterparts (Fig. 4B). Ly-6Clow CX3CR1-deficient monocytes were not elevated in the bone marrow compared with WT monocytes in the same animals, since the fraction of CX3CR1-deficient monocytes (CD45.2+) that were Ly-6Clow was below the fraction of WT (CD45.2– CD45.1+) Ly-6Clow monocytes (Fig. 4C). Thus, CX3CR1 is apparently not required for Ly-6Clow monocytes to exit the bone marrow, as is the case for Ly-6Chigh monocytes in CCR2-deficient mice (27), but instead this chemokine receptor is apparently involved in a more downstream step that involves the conversion of Ly6Chigh monocytes into Ly6Clow monocytes or survival of these monocytes. When we examined expression of the classic antiapoptotic gene bcl-2 in Ly-6Clow monocytes, we observed that bcl-2 mRNA was very low in CX3CR1gfp/gfp compared with WT Ly-6Clow monocytes (Fig. 4D), suggesting the possibility that Ly6Clow CX3CR1-deficient monocytes may be more susceptible to death by apoptosis than their WT counterparts.
To analyze how the lack of chemokine receptors affected repopulation of pulmonary DCs, we reasoned that if both of the genotypes in the mixed bone marrow chimeras were equally efficient in generating CD103+CD11blow and CD11bhigh pulmonary DC subsets, the ratio of the pulmonary DC subsets relative to each other should be close to a value of 1.0 when the two genotypes were compared. The total number of DCs was not significantly different between the various chimeric animals (data not shown). Thus, we determined the relative frequency of CD11bhigh DCs to CD11blow DCs in each animal for both genotypes in the chimera and then made a ratio of those two values (Fig. 4E). We separately analyzed DCs in the BAL and the lung interstitium. Indeed, when data from all mice were compiled, these ratios hovered near 1.0 in the WT mixed chimeras (Fig. 4F). However, CCR2-deficient cells were less able to repopulate CD103+CD11blow DCs relative to CD11bhigh DCs, shifting the ratio toward a value of 2.0 (Fig. 4F), indicative of a requirement for CCR2 in optimal reconstitution of CD103+CD11blow DCs. Conversely, CX3CR1-deficient cells were less able to repopulate CD11bhigh DCs, shifting the ratio significantly below 1.0 (Fig. 4F), illustrating a critical role for CX3CR1 in reconstituting CD11bhigh DCs. Fig. 4F shows data for BAL DCs and very similar results were observed for interstitial DCs. Thus, the failure of CCR2- and CX3CR1-deficient cells to allow normal numbers of Ly-6Chigh and Ly-6Clow monocytes to circulate, respectively, correlates with a failure of CCR2- and CX3CR1-deficient cells to populate CD103+CD11blow and CD11bhigh pulmonary DCs, respectively. These data are in close agreement with the other experimental approaches shown in Figs. 2 and 3, together strongly supporting the conclusion that CCR2+ Ly-6Chigh monocytes replenish CD103+CD11blow pulmonary DCs, whereas CX3CR1+/+ Ly-6Clow monocytes replenish CD11bhigh DCs.
| Discussion |
|---|
|
|
|---|
We took four different experimental approaches in this work. One particularly powerful method for assessing the potential validity of relationships of monocyte subsets with particular populations of DCs or macrophages, providing that they are rapidly turned over by blood precursors, is parabiosis, since monocyte subsets are not shared equally between parabiotic partners (Ref. 38) and Fig. 3). DCs in the lung turnover rapidly, and we found that the extent to which these DCs have mixed between parabiotic partners relates to the extent of mixing that occurred in blood monocytes. That is, the mixing of genotypes between parabionts from Ly-6Chigh monocytes is similar to the mixing observed in CD103+ pulmonary DCs. A different degree of mixing occurred for CD11bhigh DCs and this matched circulating Ly-6Clow monocytes closely. Results from this and all other methods we used converged on the conclusion that Ly-6Clow monocytes appear to be precursors of CD11bhigh DCs and do not contribute to CD103+ DCs. By contrast, all methods indicated that Ly-6Chigh monocytes were selectively able to generate CD103+ DCs. The fact that so many distinct approaches, each with differing underlying principles and each with different pros and cons, converge on similar outcomes strongly suggest that CD11bhigh DCs are mainly repopulated by Ly-6Clow monocytes, whereas CD103+ DCs selectively derive from Ly-6Chigh monocytes.
Indeed, we strongly advocate a multipronged approach to tracing monocytes, because each approach adds power to evaluation of the hypothesis. To illustrate, one might argue that a small number of cells other than, for instance, Ly-6Clow monocytes took up latex beads in the circulation and became pulmonary DCs rather than the Ly-6Clow monocytes. If that were true, then to fit with data from the other approaches the "mystery precursor" would not only have had to acquire latex beads in a similar manner as these monocytes, but they would have to have the same degree of mixing between parabiotic partners as the monocytes, the same profile as Ly-6Clow monocytes in responding to intranasal LPS, and the same responses to the absence of CX3CR1 as Ly-6Clow monocytes when we generated mixed chimeric mice. The probability that all of these characteristics would closely overlap in two unrelated cells is very low. Indeed, this probability would likely be much lower than the probability that the contaminating cells in monocyte adoptive transfer experiments, rather than the monocytes, are the real precursors for DCs observed in tissues after transfer. Only
2% of adoptively transferred cells can be recovered after transfer (15), increasing the chances that robust or proliferative contaminants could account for the source of progeny in adoptive transfer-based fate mapping. Finally, we also see an advantage of coupling parabiotic and chimerism studies with manipulative techniques that involve labeling or adoptive transfer of monocytes, because when all approaches agree, it is difficult to argue that the findings are simply an artifact of manipulation.
Similar to adoptive transfer experiments (14), our latex-labeling approach suggested that CD11bhigh DCs could also be generated from Ly-6Chigh monocytes. However, again, if Ly-6Chigh monocytes directly contributed substantially to CD11bhigh pulmonary DCs, data from parabiotic mice, LPS challenge, and bone marrow chimeras would likely not reveal such a close correlation between the frequency and genotype of circulating Ly-6Clow monocytes and CD11bhigh DCs in the lung, since these relationships would be obscured if both monocyte subsets were able to efficiently replenish CD11bhigh DCs. Thus, the observations that Ly-6Chigh monocytes can replenish CD11bhigh DCs after adoptive transfer (14) or latex-labeling of endogenous monocytes, as done herein, are may be explained by the fact that Ly-6Chigh monocytes can convert to Ly-6Clow monocytes, so that such conversion somewhat masks the critical role of Ly-6Clow monocytes in replenishing CD11bhigh DCs, although this possibility remains to be explored. Another possibility is that Ly-6Chigh monocytes directly differentiate into both types of DCs, but they become CD11bhigh DCs much less efficiently than Ly-6Clow monocytes, such that their contribution to CD11bhigh DCs is apparent only in assays wherein the Ly-6Clow monocytes are absent or reduced (such as the several day period following clodronate liposomes).
CCR2 is critical in monocyte homeostasis, at least in part because this chemokine receptor is needed for Ly-6Chigh monocytes to egress from the bone marrow (27). Consequently, CCR2–/– mice have dramatically reduced blood Ly-6Chigh monocytes (21, 27), but normal Ly-6Clow monocytes (21). Ly-6Clow monocytes are CCR2 negative but express high levels of CX3CR1. A role for CX3CR1 in the homeostasis of Ly-6Clow monocytes has not been previously appreciated. When we quantified Ly-6Clow monocytes in mixed bone marrow chimeras wherein WT and CX3CR1-deficient hemopoietic cells were present in the same host, there was a marked reduction of Ly-6Clow CX3CR1–/– monocytes compared with WT monocytes in the same animal. In contrast to the role for CCR2 in driving emigration of Ly-6Chigh monocytes from the bone marrow, this defect in Ly-6Clow monocytes could not be attributed to failure of Ly-6Clow monocytes to emigrate from the bone marrow. Instead, we found that CX3CR1 was needed to maintain bcl-2 expression in Ly-6Clow monocytes, raising the possibility that CX3CR1 regulates their survival at least in some conditions through expression of survival genes such as bcl-2. A role for CX3CR1 in survival might have been anticipated from previous studies wherein a 1:1 mixture of CX3CR1gfp/+ and CX3CR1gfp/gfp Ly-6Clow monocytes was transferred into WT hosts revealed a 80% relative loss of CX3CR1gfp/gfp monocytes compared with CX3CR1gfp/+ monocytes not only in lung but also in blood (15), suggesting that survival of CX3CR1gfp/gfp in the circulation was reduced. However, those data were instead interpreted to indicate a role for CX3CR1 in monocyte migration. Other studies reported generally fewer F4/80+ blood cells in the absence of CX3CL1, consistent with a need for CX3CL1 and CX3CR1 for survival of some monocytes (43). These findings raise the need to consider a role for CX3CR1 in monocyte survival and not solely as a mediator of trafficking. A role for CX3CR1 in Ly-6Clow monocyte survival could directly lead to the observed decrease in CD11bhigh DCs in the lung, but there may also be direct roles for CX3CR1 in maintaining survival in other locations, including the lung itself.
Because CCR2+ monocytes respond robustly to inflammation, Ly-6Chigh CCR2+ monocytes in the mouse are often called "inflammatory monocytes." This term should be used carefully to avoid the implication that these monocytes may preferentially develop into effectors of inflammation. Instead, our data indicate that in lung they are selectively prone to give rise to CD103+ DCs. Inasmuch as CD103+ DCs can be linked to events in the negative regulation of immune responses (3, 4), these monocytes do not seem to necessarily generate inflammation-promoting differentiation products. CCR2+ monocytes are also linked to the replenishment of skin Langerhans cells in severe injury (36), and Langerhans cells, likewise, appear to function in many instances as negative regulators of immune responses (44). Furthermore, the cells referred to as Gr-1+ myeloid suppressor cells that become highly elevated in tumor-bearing mice possess a phenotype that is closely overlapping with, and possibly identical to, Ly-6Chigh monocytes (45). Thus, there may be multiple instances wherein Ly-6Chigh monocytes give rise to differentiated APCs that work to curtail immune reactivity. Finally, it is known that depletion of Gr-1+ cells in mouse models of asthma destroys the normal underlying mechanisms in negative immune regulation and promotes airway inflammation (46). Whereas this outcome can be at least partly explained by the depletion of plasmacytoid DCs in the lung with anti-Gr-1 Ab, it is also possible that the depletion of Ly-6Chigh (Gr-1+) monocytes contributed to the loss of negative regulation. It is obvious that a more detailed analysis of the functional roles of CD103+ and CD11bhigh DCs is needed, although recent progress has been made (4, 5). Because we reveal that these DC populations in lung are differentially replenished by distinct monocyte subsets that, respectively, use distinct chemokine receptor pathways, approaches to alter the composition of pulmonary DC subpopulations for the possible modulation of pulmonary immune responses and inflammation becomes evident.
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by National Institutes of Health Grants AI49653 (to G.J.R.) and HL086899 and CA112100 (to M.M.), National Institutes of Health Postdoctoral Fellowships to C.J., F.T., and F.G., the German Research Foundation, and the Phillippe Foundation, respectively. ![]()
2 Current address: Medical Clinic III, University Hospital Aachen, 52074 Aachen, Germany. ![]()
3 Address correspondence and reprint requests to Dr. Gwendalyn J. Randolph, Department of Gene and Cell Medicine, 1425 Madison Avenue, Box 1496, New York, NY 10029. E-mail address: Gwendalyn.Randolph{at}mssm.edu ![]()
4 Abbreviations used in this paper: DC, dendritic cell; WT, wild type; BAL, bronchoalveolar lavage; MHC II, MHC class II. ![]()
Received for publication September 27, 2007. Accepted for publication December 13, 2007.
| References |
|---|
|
|
|---|
E-β7 integrin-positive epithelial dendritic cell population expressing langerin and tight junction proteins. J. Immunol. 176: 2161-2172.
ECD103β7, LEEP-CAM, and chemokines. Curr. Opin. Cell Biol. 12: 563-568. [Medline]This article has been cited by other articles:
![]() |
M. V. Lukens, D. Kruijsen, F. E. J. Coenjaerts, J. L. L. Kimpen, and G. M. van Bleek Respiratory Syncytial Virus-Induced Activation and Migration of Respiratory Dendritic Cells and Subsequent Antigen Presentation in the Lung-Draining Lymph Node J. Virol., July 15, 2009; 83(14): 7235 - 7243. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Liu, G. D. Victora, T. A. Schwickert, P. Guermonprez, M. M. Meredith, K. Yao, F.-F. Chu, G. J. Randolph, A. Y. Rudensky, and M. Nussenzweig In Vivo Analysis of Dendritic Cell Development and Homeostasis Science, April 17, 2009; 324(5925): 392 - 397. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Auffray, D. K. Fogg, E. Narni-Mancinelli, B. Senechal, C. Trouillet, N. Saederup, J. Leemput, K. Bigot, L. Campisi, M. Abitbol, et al. CX3CR1+ CD115+ CD135+ common macrophage/DC precursors and the role of CX3CR1 in their response to inflammation J. Exp. Med., March 16, 2009; 206(3): 595 - 606. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Peng, Y. Latchman, and K. B. Elkon Ly6Clow Monocytes Differentiate into Dendritic Cells and Cross-Tolerize T Cells through PDL-1 J. Immunol., March 1, 2009; 182(5): 2777 - 2785. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Landsman, L. Bar-On, A. Zernecke, K.-W. Kim, R. Krauthgamer, E. Shagdarsuren, S. A. Lira, I. L. Weissman, C. Weber, and S. Jung CX3CR1 is required for monocyte homeostasis and atherogenesis by promoting cell survival Blood, January 22, 2009; 113(4): 963 - 972. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Jakubzick, M. Bogunovic, A. J. Bonito, E. L. Kuan, M. Merad, and G. J. Randolph Lymph-migrating, tissue-derived dendritic cells are minor constituents within steady-state lymph nodes J. Exp. Med., November 24, 2008; 205(12): 2839 - 2850. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Hume Macrophages as APC and the Dendritic Cell Myth J. Immunol., November 1, 2008; 181(9): 5829 - 5835. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-L. del Rio, J.-I. Rodriguez-Barbosa, J. Bolter, M. Ballmaier, O. Dittrich-Breiholz, M. Kracht, S. Jung, and R. Forster CX3CR1+c-kit+ Bone Marrow Cells Give Rise to CD103+ and CD103- Dendritic Cells with Distinct Functional Properties J. Immunol., November 1, 2008; 181(9): 6178 - 6188. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Jaensson, H. Uronen-Hansson, O. Pabst, B. Eksteen, J. Tian, J. L. Coombes, P.-L. Berg, T. Davidsson, F. Powrie, B. Johansson-Lindbom, et al. Small intestinal CD103+ dendritic cells display unique functional properties that are conserved between mice and humans J. Exp. Med., September 1, 2008; 205(9): 2139 - 2149. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. McGill, N. Van Rooijen, and K. L. Legge Protective influenza-specific CD8 T cell responses require interactions with dendritic cells in the lungs J. Exp. Med., July 7, 2008; 205(7): 1635 - 1646. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |