The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


The Journal of Immunology, 2008, 180, 2545 -2552
Copyright © 2008 by The American Association of Immunologists, Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Datta, S.
Right arrow Articles by Hamilton, T. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Datta, S.
Right arrow Articles by Hamilton, T. A.

Tristetraprolin Regulates CXCL1 (KC) mRNA Stability1

Shyamasree Datta2,*, Roopa Biswas2,{dagger}, Michael Novotny*, Paul G. Pavicic, Jr.*, Tomasz Herjan*, Palash Mandal* and Thomas A. Hamilton3,*

* Department of Immunology, Lerner Research Institute, Cleveland Clinic Foundation, Cleveland, OH 44195; and {dagger} Graduate School of Nursing, Uniformed Services University, Bethesda, MD 20814


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Disclosures
 References
 
mRNAs encoding proinflammatory chemokines are regulated posttranscriptionally via adenine-uridine-rich sequences (AREs) located in the 3' untranslated region of the message, which are recognized by sequence-specific RNA-binding proteins. One ARE binding protein, tristetraprolin (TTP), has been implicated in regulating the stability of several ARE-containing mRNAs, including those encoding TNF-{alpha} and GM-CSF. In the present report we examined the role of TTP in regulating the decay of the mouse chemokine KC (CXCL1) mRNA. Using tetR-regulated control of transcription in TTP-deficient HEK293 cells, KC mRNA half-life was markedly decreased in the presence of TTP. Deletion and site-specific mutagenesis were used to identify multiple AUUUA sequence determinants responsible for TTP sensitivity. Although a number of studies suggest that the destabilizing activity of TTP is subject to modulation in response to ligands of Toll/IL-1 family receptors, decay mediated by TTP in 293 cells was not sensitive to stimulation with IL-1{alpha}. Using primary macrophages from wild-type and TTP-deficient mice, KC mRNA instability was found to be highly dependent on TTP. Furthermore, LPS-mediated stabilization of KC mRNA is blocked by inhibition of the p38 MAPK in macrophages from wild-type but not TTP-deficient mice. These findings demonstrate that TTP is the predominant regulator of KC mRNA decay in mononuclear phagocytes acting via multiple 3'-untranslated region-localized AREs. Nevertheless, KC mRNA remains highly unstable in cells that do not express TTP, suggesting that additional determinants of instability and stimulus sensitivity may operate in cell populations where TTP is not expressed.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Disclosures
 References
 
Tissue inflammation involves the infiltration of leukocytes at sites of injury or infection that is regulated, in part, via the production of chemoattractant cytokines or chemokines (1, 2, 3). Because this process exhibits significant potential for tissue damage, it requires stringent regulation in both space and time. The control of chemokine expression may operate at multiple mechanistic steps, including transcription, mRNA translation, and ultimately mRNA degradation (4, 5, 6, 7). In this regard, many chemokine mRNAs are known to exhibit short half-lives, and this property is subject to modulation in response to a spectrum of extracellular stimuli, particularly those acting through members of the Toll/IL-1 receptor (TIR)4 family (7, 8, 9).

The features of such mRNAs that confer instability and sensitivity to stimulus-induced stabilization have been the subject of substantial interest. The importance of adenine-uridine-rich elements (AREs) found in 3'-untranslated regions (UTRs) is well recognized (10, 11, 12, 13, 14); there are >1000 human genes that contain 3'-UTR-localized ARE sequences, which exhibit a broad range of decay rates (15, 16, 17). Although AREs are functionally defined on the basis their ability to confer instability to otherwise stable mRNAs, many ARE-containing mRNAs can be stabilized in response to extracellular stimuli such as IL-1 or LPS (8, 9, 16, 18, 19, 20, 21). The regulatory function of AREs is apparently mediated, at least in part, through the action of RNA-binding proteins that recognize the ARE motif (22, 23, 24, 25). There are number of such proteins that have been identified using a variety of experimental strategies. These include AUF-1 (also known as hnRNP D) (26); HuR, a member of the embryonic lethal abnormal visual (elav) family (25); the KH domain containing splicing factor (KSRP) (27, 28); and the zinc finger protein tristetraprolin (TTP) (22, 29). Multiple studies support a role for each of these proteins in regulating the decay of one or more ARE-containing mRNAs in various cell types and tissues both in cell culture and in intact animals.

Although the ability of TTP to promote enhanced degradation of several ARE-containing mRNAs is now recognized, the spectrum of targets that are sensitive is not fully appreciated. Studies in TTP-deficient mice have shown that TTP is involved in regulating the half-life of TNF-{alpha} and GM-CSF mRNAs in vivo (29, 30). A recent study evaluating the decay of mRNAs in fibroblasts by oligonucleotide microarray analysis identified a set of mRNAs exhibiting differential decay in cells derived from wild-type vs TTP-deficient mice (31). Although CXC chemokine mRNAs are known to be highly unstable, their half-lives were only modestly different in wild-type and TTP–/– fibroblasts despite the presence of multiple AU-rich sequences that would predict TTP sensitivity. Furthermore, although multiple studies have suggested that TTP is a target of signaling pathways implicated in the stabilization of ARE-containing mRNAs, the mechanistic basis for TTP-dependent stabilization is multifactorial and remains to be fully appreciated (32, 33, 34, 35). In the present study we have examined the ability of TTP to regulate the decay of the mouse chemokine KC (CXCL1) mRNA using both HEK293 cells (which do not express TTP) and primary macrophages from wild-type and TTP-deficient mice. The results demonstrate that KC is a significant target for the destabilizing activity of TTP that operates through multiple AUUUA-sequence motifs. Although TTP appears to be a primary determinant of chemokine instability in macrophages, other sequences and mechanisms may also operate in cell populations that do not express TTP.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Disclosures
 References
 
Reagents

DMEM, RPMI1640, Dulbecco’s PBS, and antibiotics were obtained from Central Cell Services of the Lerner Research Institute (Cleveland, OH). Neomycin sulfate (G418), formamide, dextran sulfate, MOPS, diethyl-pyrocarbonate, actinomycin D (Act D), TCA, anti-hemagglutinin (HA) Ab, Brewer’s thioglycollate broth, LPS (prepared from Escherichia coli serotype 0111:B4), and protease inhibitor mixture were purchased from Sigma-Aldrich. SB203580 was purchased from Calbiochem. FBS was purchased from BioWhittaker. Doxycycline (Dox) and the vector pTRE2 were obtained from Clontech Laboratories. Random priming kits were purchased from Stratagene. RNase-free DNase was obtained from Promega. Nylon transfer membrane was purchased from Micron Separation. SuperFect transfection reagent was obtained from Qiagen, and TRI Reagent was purchased from Molecular Research Center. Salmon sperm DNA were obtained from Ambion. Recombinant human IL-1{alpha} was purchased from R&D Systems. Protein G agarose beads were obtained from Santa Cruz Biotechnology. Ab against TTP was provided by Dr. Andrew Clark (Kennedy Institute of Rheumatology, London, U.K.). DuPont-New England Nuclear was the source of [{alpha}-32P]UTP and [{alpha}-32P]dCPT. ProtoGel, SequaGel (acrylamide, N,N-methylene bis-acrylamide, urea), and related buffers were obtained from National Diagnostics. Protein assay reagents were purchased from Bio-Rad Laboratories. Guanidine thiocyanate, sarkosyl, and cesium chloride were purchased from Fischer Scientific, and restriction enzymes were obtained from Roche Applied Science.

Mice

Wild-type and TTP–/– mice on a C57BL/6 background were generously provided by Dr. Perry Blackshear (National Institute of Environmental Health Sciences, Research Triangle Park, NC). Heterozygotes were crossed and littermate wild-type or TTP–/– mice were identified by PCR-based genotyping. Mice were housed in microisolator cages with autoclaved food and bedding to minimize exposure to viral and microbial pathogens, and all procedures were approved by the Institutional Animal Care and Use Committee.

Plasmids

Radiolabeled cDNA probes for use in Northern hybridization analysis were prepared from plasmids containing fragments of GAPDH and KC in the Bluescript vector. Plasmids used to drive expression of different versions of KC were prepared in pTRE2 (Clontech). The parent clone was created by insertion of the full KC 5'-UTR and coding region (residues 1–359) into the BamH1-NotI sites of pTRE2, and the 3'-UTR was provided from the rabbit β-globin gene. Additional constructs were created by excising the rabbit β-globin region with XbaI and SAP1, and different versions of the KC 3'-UTR sequence were inserted in the remaining EcoRV site. The full-length KC 3'-UTR (designated FL) contained residues 360–952. The cluster only (CLU) clone contained residues 406–483 and 868–950, the {Delta}1 clone contained residues 467–950, the P1P2 construct contained residues 467–634 and 868–950, and the {Delta}4 construct contained residues 720–950. Mutant versions of CLU and P1P2 were prepared by PCR or oligonucleotide site-directed mutagenesis as described previously (20, 21). The CLUmt was prepared by substituting the sequence TATTCGATCGAGATATCTCC for residues 445–470, while the P1P2 mutant had the AUUUA sequence in each pentamer substituted with AUCGA. A clone containing the full-length KC 3'-UTR in which all AUUUA pentamers were mutated was prepared by site-directed mutagenesis in the context of the wild-type clone using the substitutions indicated above. A plasmid encoding the full-length human TTP cDNA containing a hemagglutinin epitope tag under control of the CMV promoter (pCMV.hTTP.tagHA) was provided by Dr. Perry Blackshear (National Institute of Environmental Health Sciences, Research Triangle Park, NC).

Cell culture and transfection

HEK293 C6 cells stably expressing human IL-1R1 and the tetR-VP-16 fusion protein (293tetoff) were maintained in DMEM supplemented with 10% FBS, penicillin, streptomycin, G418, and puromycin in humidified 5% CO2 as previously described (8). Transfections were done using SuperFect Transfection Reagent (Qiagen) according to the manufacturer’s protocol. Primary thioglycollate-elicited macrophages were prepared and cultured as described previously (36).

Measurements of RNA stability

Three hours after transfection, pools of 293tet-off were subdivided into 60-mm dishes and rested for 24 h before individual treatments. KC mRNA transcription was terminated by the addition of Dox (1 µg/ml), and total RNA was prepared at the indicated times using TRI Reagent following the manufacturer’s instructions. Total RNA preparations were digested with RNase-free DNase to eliminate residual plasmid DNA before analysis of specific mRNA content by Northern blot hybridization as described previously (16, 21). The magnitude of TTP expression was modulated by using different amounts of plasmid for transfection.

RNA binding assays

The ability of TTP to bind to wild-type and mutant versions of KC mRNA in vivo was conducted as described previously (37). Briefly, cells were transiently cotransfected with HA-hTTP and TRE-regulated KC expression vectors as indicated in the text. Twenty hours after transfection, 2 x 106 cells were trypsynized, washed twice, and resuspended in 10 ml of ice-cold PBS. Cells were fixed in 0.1% formaldehyde for 15 min at room temperature, whereupon the cross-linking reaction was stopped with glycine (pH 7.0, 0.25 M). The cells were then washed twice with ice-cold PBS, resuspended in 2 ml of RIPA buffer (50 mM Tris-HCl (pH 7.5), 1% nonidet P-40, 0.5% sodium deoxycholate, 0.05% SDS, 1 mM EDTA, 150 mM NaCl, and proteinase inhibitors), and sonicated. The lysate was centrifuged (15 min, 4°C, 16,000 x g), and 1 ml of each supernatant was immunoprecipitated overnight at 4°C, using protein G-agarose beads preincubated with 20 µg of anti-HA Ab. The beads were washed 5 times with 1 ml RIPA buffer and resuspended in 150 µl of elution buffer (50 mM Tris-Cl (pH 7.0), 5 mM EDTA, 10 mM DTT, 1% SDS). Cross-linking was reversed by incubation at 70°C for 45 min, and RNA was purified from immunoprecipitates with TRI Reagent, treated with RNase-free DNase, and 10% of the total RNA sample was reverse-transcribed with Moloney murine leukemia virus (M-MLV) reverse transcriptase. Two microliters (10%) of the reverse transcriptase product was subjected to PCR amplification for 20 cycles. The primers for KC were forward, 5'-CTGGCCACAGGGGCGCCTATC; reverse, 5'-GGACACCTTTTAGCATCTTT; and for GAPDH were forward, 5'-TCACCATCTTCCAGGAGCGAGAT; reverse, 5'-GTTGGTGGTGCAGGAGGCATTGCT. Twenty microliters of each PCR reaction were separated by agarose gel electrophoresis.

Western blot analysis

Immunoblot analyses were performed on S100 extracts by 10% SDS-PAGE, and the blots were probed with anti-HA and anti-TTP Abs to detect the expression levels of transiently expressed HA-tagged TTP. Development of blots was as described previously (38).


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Disclosures
 References
 
Effects of TTP on KC mRNA decay

To determine whether KC mRNA is sensitive to the action of TTP, we used a HEK293 cell line stably expressing the tetracycline repressor protein (tetR) fused with the transactivation domain of the viral transcription factor VP-16 (293tet-off) (8). This cell line does not express detectable levels of TTP by Western blot (Fig. 1C). When these cells are transiently transfected with a plasmid encoding the full-length KC cDNA under control of a tetracycline-responsive promoter (TRE), the transgene is expressed at high levels (see Fig. 1A). In the presence of Dox, transcription is rapidly terminated and KC mRNA decays with a half-life of ~2.5 h. When the cells are cotransfected with a plasmid encoding TTP, the half-life of KC mRNA is markedly shortened to 1 h (Fig. 1B). The effect of TTP was sequence specific because a chimeric mRNA containing the KC 5'-UTR and coding region and the 3'-UTR from the rabbit β-globin gene was stable and unaltered in TTP-expressing cells. The absence of TTP expression in 293tet-off cells and its expression following transfection are demonstrated by Western blot analysis in Fig. 1C.


Figure 1
View larger version (21K):
[in this window]
[in a new window]

 
FIGURE 1. TTP modulates KC mRNA decay. A, 293tet-off cells were cotransfected with reporter constructs pTRE2/KC(FL) or pTRE2/KC(RβG) and either empty vector or the TTP expression plasmid pCMV.hTTP.tagHA (0.5 µg/2 x 106 cells). Three hours after transfection the cells were divided into three individual Petri dishes and cultured overnight. Dox (1 µg/ml) was added and total RNA was prepared following incubation for the indicated time periods. KC and GAPDH mRNA levels were analyzed by Northern hybridization. B, The autoradiographs from six independent experiments similar to those described in A were quantified using the National Institutes of Health Image software and the ratio of KC to GAPDH mRNA was used to determine remaining mRNA levels. Values represent the means ± SEM plotted in semilog fashion. C, Protein extracts prepared from 293tet-off cells mock transfected (pCMV) or from cells transiently expressing TTP (pCMV.hTTP.tagHA) were analyzed by Western blot using anti-TTP Ab. Similar results were obtained in three separate experiments.

 
Identification of TTP-responsive elements in the KC 3'-UTR

KC mRNA is unstable in TTP-deficient 293tet-off cells, indicating that this mRNA contains sequence motifs that promote rapid decay even in the absence of TTP. Nevertheless, expression of TTP markedly increased the decay of full-length KC mRNA. To identify the regions of the KC 3'UTR that are necessary for sensitivity to TTP, we prepared several deletion mutants of the 3'-UTR and evaluated the half-life of the corresponding mRNAs in 293tet-off cells cotransfected with vector or TTP cDNA. We have recently reported that KC mRNA contains two functionally independent determinants of instability: a 77-nucleotide fragment containing a cluster of two overlapping pairs of AUUUA pentamers (CLU) located just 3' to the translational termination site, and a 487-nucleotide fragment composing the residual 3' portion of the mRNA ({Delta}1) (39). Plasmids containing either of these regions linked with the KC coding region were separately transfected into 293tet-off cells either alone or along with the TTP expression vector, and mRNA decay was assessed by Northern hybridization and quantified by image analysis (Fig. 2). The CLU construct was more stable than the full-length 3'-UTR fragment (t1/2 of >4 h) but showed marked destabilization in the presence of TTP (t1/2 = 1 h). The {Delta}1 fragment behaved comparably to the full-length 3'-UTR construct in terms of both instability and TTP sensitivity (t1/2 – TTP = 2.4 h, t1/2 + TTP = 1.2 h). A subcomponent of the {Delta}1 fragment that contains two isolated AUUUA pentamers (P1P2) behaved comparably to the CLU fragment (t1/2 TTP = >4 h, t1/2 + TTP = 1 h). The {Delta}4 fragment, from which all 7 AUUUA pentamers have been removed, retains very modest instability but is insensitive to TTP (t1/2 = >4 h ± TTP).


Figure 2
View larger version (41K):
[in this window]
[in a new window]

 
FIGURE 2. Identification of TTP-sensitive regions in the KC mRNA 3'-UTR. The 293tet-off cells were transiently cotransfected with the indicated deletion derivatives of pTRE2/KC(FL) along with empty vector (EV) or pCMV.hTTP.tagHA (TTP) (0.5 µg/2 x 106 cells). Three hours after transfection the cells were separated into three Petri dishes and cultured overnight. Dox was added and the incubations were continued for the indicated time periods before the preparation of total RNA and analysis of KC and GAPDH (not shown) mRNAs by Northern hybridization. The individual deletion series plasmids are described in detail in Materials and Methods. Each contains the 5'-UTR, the coding region, and a fragment encoding the polyadenylation signal in addition to the indicated regions of the KC 3'-UTR. A cluster of four linked AUUUA pentamers (CLU) and the isolated AUUUA pentamers (P1, P2, and P3) are indicated. The autoradiographs from three to five independent experiments similar to that described above were quantified using the National Institutes of Health Image software, and the ratio of KC to GAPDH mRNA was used to determine remaining mRNA levels. Values represent the means ± SEM plotted in semilog fashion.

 
These findings suggest that TTP targets the AUUUA pentamers present both as overlapping clusters and as isolated motifs. In the absence of TTP, both the CLU and the P1P2 fragments are quite stable but become highly unstable in the presence of TTP. The target site for TTP recognition and binding of RNA has been reported to depend on three to four uridine residues flanked by adenine (40). We therefore evaluated the importance of the pentamer sequences using site-specific mutagenesis. Although the wild-type sequences from either the CLU or P1P2 fragments conferred strong sensitivity for TTP-mediated decay, confirming the results from Fig. 2, mutations eliminating the pentamer structures in either fragment abrogated the ability of TTP to promote enhanced degradation (Fig. 3A). To determine whether the AUUUA pentamers are responsible for all TTP sensitivity in the KC 3'-UTR, 293tet-off cells were transfected with either the pTRE/KC(FL) or a version in which all seven pentamer structures had been mutated (pTRE2/KC(FLallPmt)) along with either empty vector or TTP cDNA. Although the wild-type construct exhibited TTP sensitivity comparable to that seen in previous experiments, the decay of the mRNA in which all pentamers are mutated was insensitive to the presence of TTP (Fig. 3, B and C). Interestingly, even though mutant KC mRNA lost sensitivity to TTP, it retained significant instability. The mutation of all pentamer sequences in the KC 3'-UTR also markedly diminished the ability of TTP to bind with KC mRNA in vivo. The 293tet-off cells were cotransfected with either wild-type pTRE2/KC(FL) or the all-pentamer mutant (pTRE2/KC(FLallPmt)) and the HA-tagged TTP expression plasmid, and, after overnight culture, the cells were fixed briefly in 0.1% formalin and extracts were used to determine the amount of KC mRNA bound to TTP by immunoprecipitation with anti-HA Ab as described in Materials and Methods. Although wild-type KC mRNA was selectively bound to TTP (as compared with GAPDH mRNA), the binding of TTP to the all-pentamer mutant version was substantially reduced (Fig. 3D).


Figure 3
View larger version (48K):
[in this window]
[in a new window]

 
FIGURE 3. TTP sensitivity of KC mRNA requires AUUUA pentamers. A, 293tet-off cells were cotransfected with pCMV or pCMV.hTTP.tagHA (0.5 µg/2 x 106 cells) and pTRE2/KC derivatives containing wild-type and mutant versions of the CLU and P1P2 regions as described in Materials and Methods. After overnight culture, individual dishes were treated with Dox, incubation was continued for the indicated times, and total RNA was prepared and used to determine levels of KC and GAPDH (not shown) mRNAs by Northern hybridization. B, 293tet-off cells were transfected with wild-type pTRE/KC(FL) or all-pentamer mutant pTRE/KC(FLallPmt) plasmids alone or with pCMV.hTTP.tagHA (0.5 µg/2 x 106 cells) as described above. After overnight culture, individual dishes were treated with Dox, incubation was continued for the indicated times, and total RNA was prepared and used to determine levels of KC and GAPDH (data not shown) mRNAs by Northern hybridization. C, The autoradiographs from B were quantified as described in the legend to Fig. 1. D, 293tet-off cells were cotransfected with either pTRE/KC(FL) or all-pentamer mutant pTRE/KC(FLallPmt) plasmids and pCMV.hTTP.tagHA. After overnight rest, the cells were used to determine the level of each KC mRNA associated with TTP as described in Materials and Methods. The recovered RNA samples were subjected to RT-PCR for 20 cycles. I, input; P, immunoprecipitate pellet. Similar results were obtained in two separate experiments.

 
TTP-mediated KC mRNA decay is insensitive to the stabilizing effects of IL-1

Unstable ARE-containing mRNAs, including KC, have been shown to be stabilized following stimulation through members of the TIR family (19, 41, 42), and TTP has been suggested as a possible target of this signaling pathway (32, 34, 43). In support of this hypothesis is the finding that that TTP has several serine and threonine residues that are phosphorylation sites for the p38-activated downstream kinase MAPKAP2 (43). Moreover, TTP is phosphorylated in response to the TLR4 ligand LPS (44). The phosphorylation of TTP promotes its recognition by, and interaction with, one or more 14-3-3 proteins (43). Mutation of these phosphorylation sites abrogates interaction between TTP and 14-3-3 and may compromise the ability of TTP to enhance ARE-dependent mRNA degradation (32, 34). We therefore wanted to determine whether TTP might be a target for the action of IL-1{alpha} and whether TTP-mediated degradation of KC mRNA could be overcome in cells treated with IL-1{alpha}, a potent stimulus for stabilization of KC mRNA (20, 39). To assess the ability of IL-1{alpha} treatment to stabilize TTP-dependent decay, 293tet-off cells were cotransfected with the P1P2 construct (see Figs. 2 and 3) and the cDNA-encoding TTP and were treated with Dox alone or in combination with IL-1{alpha} before determination of residual KC mRNA levels. Although TTP expression promoted substantive decay of mRNA containing the P1P2 fragment, IL-1{alpha} treatment did not result in any stabilization (Fig. 4, A and B). In some experiments, IL-1{alpha} was added 2 h before Dox to ensure that TTP phosphorylation would be achieved before measuring decay, but these experiments showed identical results (data not shown). HA-tagged TTP is phosphorylated in untreated 293 cells as indicated by the electrophoretic mobility shift following treatment of extracts with alkaline phosphatase (Fig. 4, C and D). Furthermore, the degree of phosphorylation is enhanced following stimulation with IL-1{alpha}.


Figure 4
View larger version (39K):
[in this window]
[in a new window]

 
FIGURE 4. TTP-mediated degradation of KC mRNA is not IL-1 sensitive. A, 293tet-off cells were cotransfected with pTRE2/KC(PIP2) and either pCMV or pCMV.hTTP.tagHA (0.5 µg/2 x 106 cells). After overnight culture, the cells were treated with Dox (1 µg/ml) alone or in combination with IL-1{alpha} (10 ng/ml), and total RNA was obtained at the indicated times and used to determine KC and GAPDH (not shown) mRNAs by Northern hybridization. B, The autoradiographs were quantified as described in the legend to Fig. 1. C, Protein extracts were prepared from 293tet-off cells transiently expressing TTP (pCMV.hTTP.tagHA) treated or not with IL-1{alpha} (10 ng/ml) for 2 h. Extracts were subsequently digested as indicated with calf intestinal alkaline phosphatase (CIP) for 30 min before separation by SDS-PAGE and analysis for TTP protein by Western blot using anti-HA Ab. The bands corresponding to phosphorylated and dephosphorylated forms of TTP are indicated. D, The films from C were quantified by National Institutes of Health Image software separating each band into TTP or phospho-TTP according to mobility as indicated in C. The numerical results are presented in arbitrary units, and similar results were obtained in two separate experiments.

 
Because 293tet-off cells do not express endogenous TTP, we wanted to assess whether KC expression is regulated by TTP in cells where both TTP and KC are normally expressed. Several reports have demonstrated that TTP expression is somewhat restricted in normal tissues and is most abundant in myeloid cell populations following stimulation through TIR ligands (45). To determine whether KC expression is regulated by TTP in primary macrophages, we examined the expression pattern for KC in LPS-stimulated, thioglycollate-elicted peritoneal macrophages from either wild-type or TTP-deficient mice. The time-course for KC mRNA expression was somewhat similar in macrophages from both TTP+/+ and TTP–/– mice, although the magnitude of KC expression was appreciably higher in macrophages from the TTP–/– mice (Fig. 5A). In multiple experiments the average difference at each time point ranged from 2- to 3-fold. This quantitative increase in KC gene expression appears to reflect a reduced rate of KC mRNA decay in TTP–/– as compared with wild-type macrophages (Fig. 5B). In wild-type macrophages, LPS stabilizes KC mRNA transiently and this is evident when comparing the decay at two different time points (t1/2 at 3 h > 4 h, t1/2 at 6 h = 2.5 h). When the decay of KC mRNA was assessed in TTP–/– macrophages, it was highly stable at both times. If the p38 MAP kinase inhibitor SB203580 is added along with Act D at either the 3 or 6 h time point, the mRNA is dramatically destabilized in wild-type macrophages, but there is little or no effect of the inhibitor in the TTP-deficient cell population.


Figure 5
View larger version (71K):
[in this window]
[in a new window]

 
FIGURE 5. KC mRNA is differentially expressed in wild-type and TTP–/– macrophages. A, Thioglycollate elicited peritoneal macrophages from wild type and TTP–/– mice were plated at 5 x 106 cells per 100 mm Petri dish and allowed to adhere overnight. Cultures were stimulated with LPS (100 ng/ml) for the indicated times before preparation of total RNA and analysis of KC and GAPDH mRNA levels by Northern hybridization. The blots were quantified by National Institutes of Health Image software. Measurements are in arbitrary units and are representative of three separate experiments. B, Thioglycollate-elicited macrophages were plated as above, and after overnight culture they were stimulated with LPS for 3 or 6 h followed by the addition of Act D (5 µg/ml) alone or in combination with SB203580 (2 µM) for the indicated times before preparation of total RNA and analysis of KC and GAPDH mRNA levels by Northern hybridization. Results are representative of three separate experiments.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Disclosures
 References
 
The sequence-specific regulation of mRNA decay is now recognized as a potent mechanism for rapidly changing the pattern of gene expression. In the context of inflammatory response, posttranscriptional control is one of multiple regulatory steps that must operate to ensure adequate protective function while preventing unnecessary or inappropriate tissue damage (46). Although it is well accepted that AREs can confer this behavior and are recognized by RNA-binding factors specific for such sites, the diversity of the sequences and the role for specific proteins in regulating individual mRNAs remain to be fully understood. In the present report we have evaluated the role of TTP in regulating the decay of the mouse neutrophil-directed chemokine KC. The results support the following conclusions: (1) TTP is able to enhance the decay of KC mRNA through both clustered and independent AUUUA-containing regions in the 3'-UTR; (2) Although KC mRNA can be stabilized in response to treatment with IL-1{alpha}, instability mediated by constitutively expressed TTP is not subject to this control; and (3) finally, TTP appears to be the primary determinant of KC mRNA instability in mononuclear phagocytes, although in cells that do not express TTP, this mRNA retains substantial instability.

TTP was first linked with degradation of ARE-containing mRNAs in the context of TNF-{alpha} mRNA (29). The ARE of TNF-{alpha} contains multiple overlapping AUUUA pentamers, suggesting that such sequences might be specific targets for TTP recognition and function. This has been supported by studies directed at defining the sequence recognition specificity of TTP, in which the highest affinity recognition sites were demonstrated to contain three to four uridine residues flanked by at least one adenine, with the highest affinity being identified for a nonameric sequence element (UUAUUUAUU) (40, 47, 48). Our deletion analysis of KC 3'-UTR demonstrates that the clustered as well as isolated pentamer-containing sequences exhibit sensitivity to TTP. In 293 cells, mRNAs containing these AUUUA sequence fragments are relatively stable but exhibit dramatic decay promoted by the plasmid-driven expression of TTP. The pentamer structure in each case appears to provide the critical recognition motif because mutation of two central U residues destroys sensitivity (Fig. 3), and a KC mRNA in which all seven pentamer sequences are mutated has lost TTP sensitivity. Because only two of the sensitive motifs (one of the clustered pentamers and the P3 sequence) contain the consensus nonameric sequence, this structure does not appear to be an absolute requirement, and the pentamer structures found in P1 and P2 seem sufficient to promote sensitivity of an RNA sequence to the action of TTP.

The ability of proinflammatory stimuli acting through TIR family receptors to promote enhanced stability of some ARE-containing mRNAs is well documented (8, 9, 19). TTP can be phosphorylated on two separate serine residues (52 and 178) via the action of MAPKAP2, a kinase downstream of p38 MAP kinase and known to be involved in stimulus-mediated stabilization (43). Furthermore, this modification promotes the formation of a complex with 14-3-3 proteins that is now thought to regulate the association of TTP with P bodies, subcellular structures that appear to serve as the location for at least some components of mRNA decay (34, 49). In consideration of this, several reports have presented evidence indicating that TTP might be a target for the action of proinflammatory agents as an intermediate in the signaling pathway for stimulus-induced stabilization of selected ARE-containing mRNAs (32, 43, 44, 50). In macrophages from mice deficient in MAPKAP2, TIR-induced signals are unable to increase the stability of short-lived mRNAs including KC, whereas in cells from mice in which both MAPKAP2 and TTP have been deleted, KC mRNA is highly stable, suggesting that TTP functions downstream of MAPKAP2 (35, 51). This demonstrates that TTP is the primary determinant of instability, but it does not unequivocally demonstrate that it is necessarily the only target for TIR-induced mRNA stabilization. Interestingly, it has also been reported that phosphorylation of 14-3-3 regulates interaction with TTP and ultimately the control of mRNA decay (52). In contrast, a recent report documented that LPS stimulation was unable to modulate the activity of TTP (33). Our findings show that while TTP can promote the rapid decay of KC mRNA, this instability is insensitive to the action of IL-1{alpha} even though IL-1{alpha} treatment can change the phosphorylation state of TTP. The phosphorylation of TTP in response to p38 MAP kinase activity has been shown to regulate not only the interaction with 14-3-3 but also the stability of the protein and its subcellular localization (53). Furthermore, the activation of p38 MAP kinase and MAPKAP2 are necessary for the synthesis of TTP (35). Hence, the control of AU-rich mRNA decay and its modulation by extracellular stimulus appears likely to reflect a complex series of events that include the synthesis of TTP as well as regulation of its function.

A number of specific ARE-containing mRNAs, including other chemokines, have been demonstrated to exhibit sensitivity to TTP (29, 30, 54, 55). A recent study using oligonucleotide microarray analysis examined a broader spectrum of transcripts for TTP sensitivity in embryonic fibroblasts from wild-type and TTP–/– mice and identified a relatively small subset of sensitive mRNAs (31). Interestingly, although CXC chemokine mRNAs such as KC are known to be unstable and to contain AU-rich regions that would predict sensitivity to TTP, they showed only limited TTP sensitivity in this study. The present results argue convincingly that KC mRNA decay is sensitive to TTP and that, in primary mouse macrophages, TTP is the major mediator of KC instability. The difference between our findings and the prior report might reflect the fact that KC mRNA is highly sensitive to stabilization in response to the stimuli that also promote its transcription, and this may mask TTP-dependent instability. Indeed, in macrophages stimulated for 3 h with LPS, there is only modest difference between the decay of KC in wild-type as compared with TTP-deficient cells. The TTP dependency is observed more readily, however, in cells treated for 6 h before analysis or in cells where stabilization is inhibited with SB203580.

It is noteworthy that KC mRNA is highly unstable in cells lines that do not express TTP, and, furthermore, that the mutation of sequences that confer TTP sensitivity (all seven AUUUA containing sites) only partially reduces such instability (39). This suggests that additional ARE-binding proteins participate in regulating the posttranscriptional control of KC and similar mRNAs. Although it is clear that other ARE-binding proteins function in posttranscriptional control processes (56, 57), the degree to which multiple proteins participate in the regulation of a single mRNA is poorly appreciated. Moreover, it also appears likely that distinct mechanisms may operate in cell type-restricted patterns such that specific mRNAs may be regulated by distinct mechanisms in different cell populations or tissues.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflicts of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by U.S. Public Health Service Grants CA39621 and AI50739. Back

2 S.D. and R.B. contributed equally to this work. Back

3 Address correspondence and reprint requests to Dr. Thomas A. Hamilton, Cleveland Clinic Foundation, Lerner Research Institute, 9500 Euclid Avenue, Cleveland, OH 44195. E-mail address: hamiltt{at}ccf.org Back

4 Abbreviations used in this paper: TIR, Toll/IL-1 receptor; Act D, actinomycin D; ARE, adenine-uridine-rich element; CLU, cluster only; Dox, doxycycline; FL, full-length KC 3'-UTR; HA, hemagglutinin; M-MLV, Moloney murine leukemia virus; TTP, tristetraprolin; UTR, untranslated region. Back

Received for publication July 11, 2007. Accepted for publication December 9, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Disclosures
 References
 

  1. Rot, A., U. H. von Andrian. 2004. Chemokines in innate and adaptive host defense: basic chemokinese grammar for immune cells. Annu. Rev. Immunol. 22: 891-928. [Medline]
  2. Moser, B.. 2003. Chemokines: role in immune cell traffic. Eur. Cytokine Network 14: 204-210. [Medline]
  3. Sallusto, F., C. Mackay. 2004. Chemoattractants and their receptors in homeostasis and inflammation. Curr. Opin. Immunol. 16: 724-731. [Medline]
  4. Wilusz, C. J., M. Wormington, S. W. Peltz. 2001. The cap-to-tail guide to mRNA turnover. Nat. Rev. Mol. Cell Biol. 2: 237-246. [Medline]
  5. Guhaniyogi, J., G. Brewer. 2001. Regulation of mRNA stability in mammalian cells. Gene 265: 11-23. [Medline]
  6. Zhang, T., V. Kruys, G. Huez, C. Gueydan. 2002. AU-rich element-mediated translational control: complexity and multiple activities of trans-activating factors. Biochem. Soc. Trans. 30: 952-958. [Medline]
  7. Hamilton, T. A., Y. Ohmori, J. Tebo. 2002. Regulation of chemokine expression by antiinflammatory cytokines. Immunol. Res. 25: 229-245. [Medline]
  8. Datta, S., M. Novotny, X. Li, J. Tebo, T. A. Hamilton. 2004. Toll IL-1 receptors differ in their ability to promote the stabilization of adenosine and uridine-rich elements containing mRNA. J. Immunol. 173: 2755-2761. [Abstract/Free Full Text]
  9. Holtmann, H., R. Winzen, P. Holland, S. Eickemeier, E. Hoffmann, D. Wallach, N. L. Malinin, J. A. Cooper, K. Resch, M. Kracht. 1999. Induction of interleukin-8 synthesis integrates effects on transcription and mRNA degradation from at least three different cytokine- or stress-activated signal transduction pathways. Mol. Cell. Biol. 19: 6742-6753. [Abstract/Free Full Text]
  10. Winzen, R., G. Gowrishankar, F. Bollig, N. Redich, K. Resch, H. Holtmann. 2004. Distinct domains of AU-rich elements exert different functions in mRNA destabilization and stabilization by p38 mitogen-activated protein kinase or HuR. Mol. Cell. Biol. 24: 4835-4847. [Abstract/Free Full Text]
  11. Chen, C.-Y. A., A.-B. Shyu. 1995. AU-rich elements: characterization and importance in mRNA degradation. Trends Biochem. Sci. 20: 465-470. [Medline]
  12. Saklatvala, J., J. Dean, A. Clark. 2003. Control of the expression of inflammatory response genes. Biochem. Soc. Symp. 70: 95-106. [Medline]
  13. Caput, D., B. Beutler, K. Hartog, R. Thayer, S. Brown-Shimer, A. Cerami. 1986. Identification of a common nucleotide sequence in the 3'-untranslated region of mRNA molecules specifying inflammatory mediators. Proc. Natl. Acad. Sci. USA 83: 1670-1674. [Abstract/Free Full Text]
  14. Shaw, G., R. Kamen. 1986. A conserved AU sequence from the 3' untranslated region of GM-CSF mRNA mediates selective mRNA degradation. Cell 46: 659-667. [Medline]
  15. Bakheet, T., B. R. Williams, K. S. Khabar. 2003. ARED 2.0: an update of AU-rich element mRNA database. Nucleic Acids Res. 31: 421-423. [Abstract/Free Full Text]
  16. Tebo, J., S. Der, M. Frevel, K. S. Khabar, B. R. Williams, T. A. Hamilton. 2003. Heterogeneity in control of mRNA stability by AU-rich elements. J. Biol. Chem. 278: 12085-12093. [Abstract/Free Full Text]
  17. Frevel, M. A., T. Bakheet, A. M. Silva, J. G. Hissong, K. S. Khabar, B. R. Williams. 2003. p38 mitogen-activated protein kinase-dependent and -independent signaling of mRNA stability of AU-rich element-containing transcripts. Mol. Cell. Biol. 23: 425-436. [Abstract/Free Full Text]
  18. Stoeckle, M. Y.. 1991. Post-transcriptional regulation of gro{alpha}, β, {gamma}, and IL-8 mRNAs by IL-1β. Nucleic Acids Res. 19: 917-920. [Abstract/Free Full Text]
  19. Dean, J. L., M. Brook, A. R. Clark, J. Saklatvala. 1999. p38 mitogen-activated protein kinase regulates cyclooxygenase-2 mRNA stability and transcription in lipopolysaccharide-treated human monocytes. J. Biol. Chem. 274: 264-269. [Abstract/Free Full Text]
  20. Tebo, J., S. Datta, R. Kishore, M. Kolosov, J. A. Major, Y. Ohmori, T. A. Hamilton. 2000. IL-1-mediated stabilization of mouse KC mRNA depends on sequences in both 5' and 3' untranslated regions. J. Biol. Chem. 275: 12987-12993. [Abstract/Free Full Text]
  21. Biswas, R., S. Datta, J. D. Gupta, M. Novotny, J. Tebo, T. A. Hamilton. 2003. Regulation of chemokine mRNA stability by lipopolysaccharide and IL-10. J. Immunol. 170: 6202-6208. [Abstract/Free Full Text]
  22. Carrick, D. M., W. S. Lai, P. J. Blackshear. 2004. The tandem CCCH zinc finger protein tristetraprolin and its relevance to cytokine mRNA turnover and arthritis. Arthritis Res. Ther. 6: 248-264. [Medline]
  23. Wilson, G. M., G. Brewer. 1999. The search for trans-acting factors controlling messenger RNA decay. Prog. Nucleic Acid. Res. Mol. Biol. 62: 257-291. [Medline]
  24. Dean, J. L., G. Sully, A. R. Clark, J. Saklatvala. 2004. The involvement of AU-rich element-binding proteins in p38 mitogen-activated protein kinase pathway-mediated mRNA stabilisation. Cell. Signal. 16: 1113-1121. [Medline]
  25. Brennan, C., J. Steitz. 2001. HuR and mRNA stability. Cell Mol. Life Sci. 58: 266-277. [Medline]
  26. Zhang, W., B. J. Wagner, K. Ehrenman, A. W. Schaefer, C. T. De Maria, D. Crater, K. De Haven, L. Long, G. Brewer. 1993. Purification, characterization, and cDNA cloning of an AU-rich element RNA-binding protein, AUF1. Mol. Cell. Biol. 13: 7652-7665. [Abstract/Free Full Text]
  27. Chen, C. Y., R. Gherzi, S. E. Ong, E. L. Chan, R. Raijmakers, G. J. Pruijn, G. Stoecklin, C. Moroni, M. Mann, M. Karin. 2001. AU binding proteins recruit the exosome to degrade ARE-containing mRNAs. Cell 107: 451-464. [Medline]
  28. Gherzi, R., K. Y. Lee, P. Briata, D. Wegmuller, C. Moroni, M. Karin, C. Y. Chen. 2004. A KH domain RNA binding protein, KSRP, promotes ARE-directed mRNA turnover by recruiting the degradation machinery. Mol. Cell. 14: 571-583. [Medline]
  29. Carballo, E., W. S. Lai, P. J. Blackshear. 1998. Feedback inhibition of macrophage tumor necrosis factor-{alpha} production by tristetraprolin. Science 281: 1001-1005. [Abstract/Free Full Text]
  30. Carballo, E., W. S. Lai, P. J. Blackshear. 2000. Evidence that tristetraprolin is a physiological regulator of granulocyte-macrophage colony-stimulating factor messenger RNA deadenylation and stability. Blood 95: 1891-1899. [Abstract/Free Full Text]
  31. Lai, W. S., J. S. Parker, S. F. Grissom, D. J. Stumpo, P. J. Blackshear. 2006. Novel mRNA targets for tristetraprolin (TTP) identified by global analysis of stabilized transcripts in TTP-deficient fibroblasts. Mol. Cell. Biol. 26: 9196-9208. [Abstract/Free Full Text]
  32. Stoecklin, G., T. Stubbs, N. Kedersha, S. Wax, W. F. Rigby, T. K. Blackwell, P. Anderson. 2004. MK2-induced tristetraprolin:14-3-3 complexes prevent stress granule association and ARE-mRNA decay. EMBO J. 23: 1313-1324. [Medline]
  33. Rigby, W. F., K. Roy, J. Collins, S. Rigby, J. E. Connolly, D. B. Bloch, S. A. Brooks. 2005. Structure/function analysis of tristetraprolin (TTP): p38 stress-activated protein kinase and lipopolysaccharide stimulation do not alter TTP function. J. Immunol. 174: 7883-7893. [Abstract/Free Full Text]
  34. Franks, T. M., J. Lykke-Andersen. 2007. TTP and BRF proteins nucleate processing body formation to silence mRNAs with AU-rich elements. Genes Dev. 21: 719-735. [Abstract/Free Full Text]
  35. Hitti, E., T. Iakovleva, M. Brook, S. Deppenmeier, A. D. Gruber, D. Radzioch, A. R. Clark, P. J. Blackshear, A. Kotlyarov, M. Gaestel. 2006. Mitogen-activated protein kinase-activated protein kinase 2 regulates tumor necrosis factor mRNA stability and translation mainly by altering tristetraprolin expression, stability, and binding to adenine/uridine-rich element. Mol. Cell. Biol. 26: 2399-2407. [Abstract/Free Full Text]
  36. Mandal, P., T. Hamilton. 2007. Signaling in lipopolysaccharide-induced stabilization of formyl peptide receptor 1 mRNA in mouse peritoneal macrophages. J. Immunol. 178: 2542-2548. [Abstract/Free Full Text]
  37. Niranjanakumari, S., E. Lasda, R. Brazas, M. A. Garcia-Blanco. 2002. Reversible cross-linking combined with immunoprecipitation to study RNA-protein interactions in vivo. Methods 26: 182-190. [Medline]
  38. Ohmori, Y., T. A. Hamilton. 1997. IL-4-induced STAT6 suppresses IFN-{gamma}-stimulated STAT1-dependent transcription in mouse macrophages. J. Immunol. 159: 5474-5482. [Abstract]
  39. Novotny, M., S. Datta, R. Biswas, T. Hamilton. 2005. Functionally independent AU-rich sequence motifs regulate KC (CXCL1) mRNA. J. Biol. Chem. 280: 30166-30174. [Abstract/Free Full Text]
  40. Brewer, B. Y., J. Malicka, P. J. Blackshear, G. M. Wilson. 2004. RNA sequence elements required for high affinity binding by the zinc finger domain of tristetraprolin: conformational changes coupled to the bipartite nature of Au-rich MRNA-destabilizing motifs. J. Biol. Chem. 279: 27870-27877. [Abstract/Free Full Text]
  41. Winzen, R., M. Kracht, B. Ritter, A. Wilhelm, C. Y. Chen, A. B. Shyu, M. Muller, M. Gaestel, K. Resch, H. Holtmann. 1999. The p38 MAP kinase pathway signals for cytokine-induced mRNA stabilization via MAP kinase-activated protein kinase 2 and an AU-rich region-targeted mechanism. EMBO J. 18: 4969-4980. [Medline]
  42. Neininger, A., D. Kontoyiannis, A. Kotlyarov, R. Winzen, R. Eckert, H. D. Volk, H. Holtmann, G. Kollias, M. Gaestel. 2002. MK2 targets AU-rich elements and regulates biosynthesis of tumor necrosis factor and interleukin-6 independently at different post-transcriptional levels. J. Biol. Chem. 277: 3065-3068. [Abstract/Free Full Text]
  43. Chrestensen, C. A., M. J. Schroeder, J. Shabanowitz, D. F. Hunt, J. W. Pelo, M. T. Worthington, T. W. Sturgill. 2004. MAPKAP kinase 2 phosphorylates tristetraprolin on in vivo sites including Ser178, a site required for 14-3-3 binding. J. Biol. Chem. 279: 10176-10184. [Abstract/Free Full Text]
  44. Mahtani, K. R., M. Brook, J. L. Dean, G. Sully, J. Saklatvala, A. R. Clark. 2001. Mitogen-activated protein kinase p38 controls the expression and posttranslational modification of tristetraprolin, a regulator of tumor necrosis factor alpha mRNA stability. Mol. Cell. Biol. 21: 6461-6469. [Abstract/Free Full Text]
  45. Lu, J., R. Schneider. 2004. Tissue distribution of AU-rich mRNA-binding proteins involved in regulation of mRNA decay. J. Biol. Chem. 279: 12974-12979. [Abstract/Free Full Text]
  46. Anderson, P., K. Phillips, G. Stoecklin, N. Kedersha. 2004. Post-transcriptional regulation of proinflammatory proteins. J. Leukocyte Biol. 76: 42-47. [Abstract/Free Full Text]
  47. Blackshear, P. J., W. S. Lai, E. A. Kennington, G. Brewer, G. M. Wilson, X. Guan, P. Zhou. 2003. Characteristics of the interaction of a synthetic human tristetraprolin tandem zinc finger peptide with AU-rich element-containing RNA substrates. J. Biol. Chem. 278: 19947-19955. [Abstract/Free Full Text]
  48. Worthington, M. T., J. W. Pelo, M. A. Sachedina, J. L. Applegate, K. O. Arseneau, T. T. Pizarro. 2002. RNA binding properties of the AU-rich element-binding recombinant Nup475/TIS11/tristetraprolin protein. J. Biol. Chem. 277: 48558-48564. [Abstract/Free Full Text]
  49. Garneau, N. L., J. Wilusz, C. J. Wilusz. 2007. The highways and byways of mRNA decay. Nat. Rev. Mol. Cell Biol. 8: 113-126. [Medline]
  50. Schmidlin, M., M. Lu, S. A. Leuenberger, G. Stoecklin, M. Mallaun, B. Gross, R. Gherzi, D. Hess, B. A. Hemmings, C. Moroni. 2004. The ARE-dependent mRNA-destabilizing activity of BRF1 is regulated by protein kinase B. EMBO J. 23: 4760-4769. [Medline]
  51. Ronkina, N., A. Kotlyarov, O. Dittrich-Breiholz, M. Kracht, E. Hitti, K. Milarski, R. Askew, S. Marusic, L. L. Lin, M. Gaestel, J. B. Telliez. 2007. The mitogen-activated protein kinase (MAPK)-activated protein kinases MK2 and MK3 cooperate in stimulation of tumor necrosis factor biosynthesis and stabilization of p38 MAPK. Mol. Cell. Biol. 27: 170-181. [Abstract/Free Full Text]
  52. Gringhuis, S. I., J. J. Garcia-Vallejo, B. van Het Hof, W. van Dijk. 2005. Convergent actions of I{kappa}B kinase β and protein kinase C{delta} modulate mRNA stability through phosphorylation of 14-3-3β complexed with tristetraprolin. Mol. Cell. Biol. 25: 6454-6463. [Abstract/Free Full Text]
  53. Brook, M., C. R. Tchen, T. Santalucia, J. McIlrath, J. S. Arthur, J. Saklatvala, A. R. Clark. 2006. Posttranslational regulation of tristetraprolin subcellular localization and protein stability by p38 mitogen-activated protein kinase and extracellular signal-regulated kinase pathways. Mol. Cell. Biol. 26: 2408-2418. [Abstract/Free Full Text]
  54. Sauer, I., B. Schaljo, C. Vogl, I. Gattermeier, T. Kolbe, M. Muller, P. J. Blackshear, P. Kovarik. 2006. Interferons limit inflammatory responses by induction of tristetraprolin. Blood 107: 4790-4797. [Abstract/Free Full Text]
  55. Ogilvie, R. L., M. Abelson, H. H. Hau, I. Vlasova, P. J. Blackshear, P. R. Bohjanen. 2005. Tristetraprolin down-regulates IL-2 gene expression through AU-rich element-mediated mRNA decay. J. Immunol. 174: 953-961. [Abstract/Free Full Text]
  56. Sully, G., J. L. Dean, R. Wait, L. Rawlinson, T. Santalucia, J. Saklatvala, A. R. Clark. 2004. Structural and functional dissection of a conserved destabilizing element of cyclo-oxygenase-2 mRNA: evidence against the involvement of AUF-1 [AU-rich element/poly(U)-binding/degradation factor-1], AUF-2, tristetraprolin, HuR (Hu antigen R) or FBP1 (far-upstream-sequence-element-binding protein 1). Biochem. J. 377: 629-639. [Medline]
  57. Lu, J. Y., N. Sadri, R. J. Schneider. 2006. Endotoxic shock in AUF1 knockout mice mediated by failure to degrade proinflammatory cytokine mRNAs. Genes Dev. 20: 3174-3184. [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
S. Datta, M. Novotny, P. G. Pavicic Jr., C. Zhao, T. Herjan, J. Hartupee, and T. Hamilton
IL-17 Regulates CXCL1 mRNA Stability via an AUUUA/Tristetraprolin-Independent Sequence
J. Immunol., February 1, 2010; 184(3): 1484 - 1491.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. J. Stumpo, H. E. Broxmeyer, T. Ward, S. Cooper, G. Hangoc, Y. J. Chung, W. C. Shelley, E. K. Richfield, M. K. Ray, M. C. Yoder, et al.
Targeted disruption of Zfp36l2, encoding a CCCH tandem zinc finger RNA-binding protein, results in defective hematopoiesis
Blood, September 17, 2009; 114(12): 2401 - 2410.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
B. Schaljo, F. Kratochvill, N. Gratz, I. Sadzak, I. Sauer, M. Hammer, C. Vogl, B. Strobl, M. Muller, P. J. Blackshear, et al.
Tristetraprolin Is Required for Full Anti-Inflammatory Response of Murine Macrophages to IL-10
J. Immunol., July 15, 2009; 183(2): 1197 - 1206.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
N. S. Balakathiresan, S. Bhattacharyya, U. Gutti, R. P. Long, C. Jozwik, W. Huang, M. Srivastava, H. B. Pollard, and R. Biswas
Tristetraprolin regulates IL-8 mRNA stability in cystic fibrosis lung epithelial cells
Am J Physiol Lung Cell Mol Physiol, June 1, 2009; 296(6): L1012 - L1018.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. L. Ogilvie, J. R. SternJohn, B. Rattenbacher, I. A. Vlasova, D. A. Williams, H. H. Hau, P. J. Blackshear, and P. R. Bohjanen
Tristetraprolin Mediates Interferon-{gamma} mRNA Decay
J. Biol. Chem., April 24, 2009; 284(17): 11216 - 11223.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
K. L. W. Walton, L. Holt, and R. B. Sartor
Lipopolysaccharide activates innate immune responses in murine intestinal myofibroblasts through multiple signaling pathways
Am J Physiol Gastrointest Liver Physiol, March 1, 2009; 296(3): G601 - G611.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Hartupee, C. Liu, M. Novotny, D. Sun, X. Li, and T. A. Hamilton
IL-17 Signaling for mRNA Stabilization Does Not Require TNF Receptor-Associated Factor 6
J. Immunol., February 1, 2009; 182(3): 1660 - 1666.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P.-H. Park, H. Huang, M. R. McMullen, P. Mandal, L. Sun, and L. E. Nagy
Suppression of Lipopolysaccharide-stimulated Tumor Necrosis Factor-{alpha} Production by Adiponectin Is Mediated by Transcriptional and Post-transcriptional Mechanisms
J. Biol. Chem., October 3, 2008; 283(40): 26850 - 26858.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Hartupee, X. Li, and T. Hamilton
Interleukin 1{alpha}-induced NF{kappa}B Activation and Chemokine mRNA Stabilization Diverge at IRAK1
J. Biol. Chem., June 6, 2008; 283(23): 15689 - 15693.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Datta, S.
Right arrow Articles by Hamilton, T. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Datta, S.
Right arrow Articles by Hamilton, T. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS