|
|
||||||||

* Department of Immunology, Lerner Research Institute, Cleveland Clinic Foundation, Cleveland, OH 44195; and
Graduate School of Nursing, Uniformed Services University, Bethesda, MD 20814
| Abstract |
|---|
|
|
|---|
and GM-CSF. In the present report we examined the role of TTP in regulating the decay of the mouse chemokine KC (CXCL1) mRNA. Using tetR-regulated control of transcription in TTP-deficient HEK293 cells, KC mRNA half-life was markedly decreased in the presence of TTP. Deletion and site-specific mutagenesis were used to identify multiple AUUUA sequence determinants responsible for TTP sensitivity. Although a number of studies suggest that the destabilizing activity of TTP is subject to modulation in response to ligands of Toll/IL-1 family receptors, decay mediated by TTP in 293 cells was not sensitive to stimulation with IL-1
. Using primary macrophages from wild-type and TTP-deficient mice, KC mRNA instability was found to be highly dependent on TTP. Furthermore, LPS-mediated stabilization of KC mRNA is blocked by inhibition of the p38 MAPK in macrophages from wild-type but not TTP-deficient mice. These findings demonstrate that TTP is the predominant regulator of KC mRNA decay in mononuclear phagocytes acting via multiple 3'-untranslated region-localized AREs. Nevertheless, KC mRNA remains highly unstable in cells that do not express TTP, suggesting that additional determinants of instability and stimulus sensitivity may operate in cell populations where TTP is not expressed. | Introduction |
|---|
|
|
|---|
The features of such mRNAs that confer instability and sensitivity to stimulus-induced stabilization have been the subject of substantial interest. The importance of adenine-uridine-rich elements (AREs) found in 3'-untranslated regions (UTRs) is well recognized (10, 11, 12, 13, 14); there are >1000 human genes that contain 3'-UTR-localized ARE sequences, which exhibit a broad range of decay rates (15, 16, 17). Although AREs are functionally defined on the basis their ability to confer instability to otherwise stable mRNAs, many ARE-containing mRNAs can be stabilized in response to extracellular stimuli such as IL-1 or LPS (8, 9, 16, 18, 19, 20, 21). The regulatory function of AREs is apparently mediated, at least in part, through the action of RNA-binding proteins that recognize the ARE motif (22, 23, 24, 25). There are number of such proteins that have been identified using a variety of experimental strategies. These include AUF-1 (also known as hnRNP D) (26); HuR, a member of the embryonic lethal abnormal visual (elav) family (25); the KH domain containing splicing factor (KSRP) (27, 28); and the zinc finger protein tristetraprolin (TTP) (22, 29). Multiple studies support a role for each of these proteins in regulating the decay of one or more ARE-containing mRNAs in various cell types and tissues both in cell culture and in intact animals.
Although the ability of TTP to promote enhanced degradation of several ARE-containing mRNAs is now recognized, the spectrum of targets that are sensitive is not fully appreciated. Studies in TTP-deficient mice have shown that TTP is involved in regulating the half-life of TNF-
and GM-CSF mRNAs in vivo (29, 30). A recent study evaluating the decay of mRNAs in fibroblasts by oligonucleotide microarray analysis identified a set of mRNAs exhibiting differential decay in cells derived from wild-type vs TTP-deficient mice (31). Although CXC chemokine mRNAs are known to be highly unstable, their half-lives were only modestly different in wild-type and TTP–/– fibroblasts despite the presence of multiple AU-rich sequences that would predict TTP sensitivity. Furthermore, although multiple studies have suggested that TTP is a target of signaling pathways implicated in the stabilization of ARE-containing mRNAs, the mechanistic basis for TTP-dependent stabilization is multifactorial and remains to be fully appreciated (32, 33, 34, 35). In the present study we have examined the ability of TTP to regulate the decay of the mouse chemokine KC (CXCL1) mRNA using both HEK293 cells (which do not express TTP) and primary macrophages from wild-type and TTP-deficient mice. The results demonstrate that KC is a significant target for the destabilizing activity of TTP that operates through multiple AUUUA-sequence motifs. Although TTP appears to be a primary determinant of chemokine instability in macrophages, other sequences and mechanisms may also operate in cell populations that do not express TTP.
| Materials and methods |
|---|
|
|
|---|
DMEM, RPMI1640, Dulbeccos PBS, and antibiotics were obtained from Central Cell Services of the Lerner Research Institute (Cleveland, OH). Neomycin sulfate (G418), formamide, dextran sulfate, MOPS, diethyl-pyrocarbonate, actinomycin D (Act D), TCA, anti-hemagglutinin (HA) Ab, Brewers thioglycollate broth, LPS (prepared from Escherichia coli serotype 0111:B4), and protease inhibitor mixture were purchased from Sigma-Aldrich. SB203580 was purchased from Calbiochem. FBS was purchased from BioWhittaker. Doxycycline (Dox) and the vector pTRE2 were obtained from Clontech Laboratories. Random priming kits were purchased from Stratagene. RNase-free DNase was obtained from Promega. Nylon transfer membrane was purchased from Micron Separation. SuperFect transfection reagent was obtained from Qiagen, and TRI Reagent was purchased from Molecular Research Center. Salmon sperm DNA were obtained from Ambion. Recombinant human IL-1
was purchased from R&D Systems. Protein G agarose beads were obtained from Santa Cruz Biotechnology. Ab against TTP was provided by Dr. Andrew Clark (Kennedy Institute of Rheumatology, London, U.K.). DuPont-New England Nuclear was the source of [
-32P]UTP and [
-32P]dCPT. ProtoGel, SequaGel (acrylamide, N,N-methylene bis-acrylamide, urea), and related buffers were obtained from National Diagnostics. Protein assay reagents were purchased from Bio-Rad Laboratories. Guanidine thiocyanate, sarkosyl, and cesium chloride were purchased from Fischer Scientific, and restriction enzymes were obtained from Roche Applied Science.
Mice
Wild-type and TTP–/– mice on a C57BL/6 background were generously provided by Dr. Perry Blackshear (National Institute of Environmental Health Sciences, Research Triangle Park, NC). Heterozygotes were crossed and littermate wild-type or TTP–/– mice were identified by PCR-based genotyping. Mice were housed in microisolator cages with autoclaved food and bedding to minimize exposure to viral and microbial pathogens, and all procedures were approved by the Institutional Animal Care and Use Committee.
Plasmids
Radiolabeled cDNA probes for use in Northern hybridization analysis were prepared from plasmids containing fragments of GAPDH and KC in the Bluescript vector. Plasmids used to drive expression of different versions of KC were prepared in pTRE2 (Clontech). The parent clone was created by insertion of the full KC 5'-UTR and coding region (residues 1–359) into the BamH1-NotI sites of pTRE2, and the 3'-UTR was provided from the rabbit β-globin gene. Additional constructs were created by excising the rabbit β-globin region with XbaI and SAP1, and different versions of the KC 3'-UTR sequence were inserted in the remaining EcoRV site. The full-length KC 3'-UTR (designated FL) contained residues 360–952. The cluster only (CLU) clone contained residues 406–483 and 868–950, the
1 clone contained residues 467–950, the P1P2 construct contained residues 467–634 and 868–950, and the
4 construct contained residues 720–950. Mutant versions of CLU and P1P2 were prepared by PCR or oligonucleotide site-directed mutagenesis as described previously (20, 21). The CLUmt was prepared by substituting the sequence TATTCGATCGAGATATCTCC for residues 445–470, while the P1P2 mutant had the AUUUA sequence in each pentamer substituted with AUCGA. A clone containing the full-length KC 3'-UTR in which all AUUUA pentamers were mutated was prepared by site-directed mutagenesis in the context of the wild-type clone using the substitutions indicated above. A plasmid encoding the full-length human TTP cDNA containing a hemagglutinin epitope tag under control of the CMV promoter (pCMV.hTTP.tagHA) was provided by Dr. Perry Blackshear (National Institute of Environmental Health Sciences, Research Triangle Park, NC).
Cell culture and transfection
HEK293 C6 cells stably expressing human IL-1R1 and the tetR-VP-16 fusion protein (293tetoff) were maintained in DMEM supplemented with 10% FBS, penicillin, streptomycin, G418, and puromycin in humidified 5% CO2 as previously described (8). Transfections were done using SuperFect Transfection Reagent (Qiagen) according to the manufacturers protocol. Primary thioglycollate-elicited macrophages were prepared and cultured as described previously (36).
Measurements of RNA stability
Three hours after transfection, pools of 293tet-off were subdivided into 60-mm dishes and rested for 24 h before individual treatments. KC mRNA transcription was terminated by the addition of Dox (1 µg/ml), and total RNA was prepared at the indicated times using TRI Reagent following the manufacturers instructions. Total RNA preparations were digested with RNase-free DNase to eliminate residual plasmid DNA before analysis of specific mRNA content by Northern blot hybridization as described previously (16, 21). The magnitude of TTP expression was modulated by using different amounts of plasmid for transfection.
RNA binding assays
The ability of TTP to bind to wild-type and mutant versions of KC mRNA in vivo was conducted as described previously (37). Briefly, cells were transiently cotransfected with HA-hTTP and TRE-regulated KC expression vectors as indicated in the text. Twenty hours after transfection, 2 x 106 cells were trypsynized, washed twice, and resuspended in 10 ml of ice-cold PBS. Cells were fixed in 0.1% formaldehyde for 15 min at room temperature, whereupon the cross-linking reaction was stopped with glycine (pH 7.0, 0.25 M). The cells were then washed twice with ice-cold PBS, resuspended in 2 ml of RIPA buffer (50 mM Tris-HCl (pH 7.5), 1% nonidet P-40, 0.5% sodium deoxycholate, 0.05% SDS, 1 mM EDTA, 150 mM NaCl, and proteinase inhibitors), and sonicated. The lysate was centrifuged (15 min, 4°C, 16,000 x g), and 1 ml of each supernatant was immunoprecipitated overnight at 4°C, using protein G-agarose beads preincubated with 20 µg of anti-HA Ab. The beads were washed 5 times with 1 ml RIPA buffer and resuspended in 150 µl of elution buffer (50 mM Tris-Cl (pH 7.0), 5 mM EDTA, 10 mM DTT, 1% SDS). Cross-linking was reversed by incubation at 70°C for 45 min, and RNA was purified from immunoprecipitates with TRI Reagent, treated with RNase-free DNase, and 10% of the total RNA sample was reverse-transcribed with Moloney murine leukemia virus (M-MLV) reverse transcriptase. Two microliters (10%) of the reverse transcriptase product was subjected to PCR amplification for 20 cycles. The primers for KC were forward, 5'-CTGGCCACAGGGGCGCCTATC; reverse, 5'-GGACACCTTTTAGCATCTTT; and for GAPDH were forward, 5'-TCACCATCTTCCAGGAGCGAGAT; reverse, 5'-GTTGGTGGTGCAGGAGGCATTGCT. Twenty microliters of each PCR reaction were separated by agarose gel electrophoresis.
Western blot analysis
Immunoblot analyses were performed on S100 extracts by 10% SDS-PAGE, and the blots were probed with anti-HA and anti-TTP Abs to detect the expression levels of transiently expressed HA-tagged TTP. Development of blots was as described previously (38).
| Results |
|---|
|
|
|---|
To determine whether KC mRNA is sensitive to the action of TTP, we used a HEK293 cell line stably expressing the tetracycline repressor protein (tetR) fused with the transactivation domain of the viral transcription factor VP-16 (293tet-off) (8). This cell line does not express detectable levels of TTP by Western blot (Fig. 1C). When these cells are transiently transfected with a plasmid encoding the full-length KC cDNA under control of a tetracycline-responsive promoter (TRE), the transgene is expressed at high levels (see Fig. 1A). In the presence of Dox, transcription is rapidly terminated and KC mRNA decays with a half-life of
2.5 h. When the cells are cotransfected with a plasmid encoding TTP, the half-life of KC mRNA is markedly shortened to 1 h (Fig. 1B). The effect of TTP was sequence specific because a chimeric mRNA containing the KC 5'-UTR and coding region and the 3'-UTR from the rabbit β-globin gene was stable and unaltered in TTP-expressing cells. The absence of TTP expression in 293tet-off cells and its expression following transfection are demonstrated by Western blot analysis in Fig. 1C.
|
KC mRNA is unstable in TTP-deficient 293tet-off cells, indicating that this mRNA contains sequence motifs that promote rapid decay even in the absence of TTP. Nevertheless, expression of TTP markedly increased the decay of full-length KC mRNA. To identify the regions of the KC 3'UTR that are necessary for sensitivity to TTP, we prepared several deletion mutants of the 3'-UTR and evaluated the half-life of the corresponding mRNAs in 293tet-off cells cotransfected with vector or TTP cDNA. We have recently reported that KC mRNA contains two functionally independent determinants of instability: a 77-nucleotide fragment containing a cluster of two overlapping pairs of AUUUA pentamers (CLU) located just 3' to the translational termination site, and a 487-nucleotide fragment composing the residual 3' portion of the mRNA (
1) (39). Plasmids containing either of these regions linked with the KC coding region were separately transfected into 293tet-off cells either alone or along with the TTP expression vector, and mRNA decay was assessed by Northern hybridization and quantified by image analysis (Fig. 2). The CLU construct was more stable than the full-length 3'-UTR fragment (t1/2 of >4 h) but showed marked destabilization in the presence of TTP (t1/2 = 1 h). The
1 fragment behaved comparably to the full-length 3'-UTR construct in terms of both instability and TTP sensitivity (t1/2 – TTP = 2.4 h, t1/2 + TTP = 1.2 h). A subcomponent of the
1 fragment that contains two isolated AUUUA pentamers (P1P2) behaved comparably to the CLU fragment (t1/2 – TTP = >4 h, t1/2 + TTP = 1 h). The
4 fragment, from which all 7 AUUUA pentamers have been removed, retains very modest instability but is insensitive to TTP (t1/2 = >4 h ± TTP).
|
|
Unstable ARE-containing mRNAs, including KC, have been shown to be stabilized following stimulation through members of the TIR family (19, 41, 42), and TTP has been suggested as a possible target of this signaling pathway (32, 34, 43). In support of this hypothesis is the finding that that TTP has several serine and threonine residues that are phosphorylation sites for the p38-activated downstream kinase MAPKAP2 (43). Moreover, TTP is phosphorylated in response to the TLR4 ligand LPS (44). The phosphorylation of TTP promotes its recognition by, and interaction with, one or more 14-3-3 proteins (43). Mutation of these phosphorylation sites abrogates interaction between TTP and 14-3-3 and may compromise the ability of TTP to enhance ARE-dependent mRNA degradation (32, 34). We therefore wanted to determine whether TTP might be a target for the action of IL-1
and whether TTP-mediated degradation of KC mRNA could be overcome in cells treated with IL-1
, a potent stimulus for stabilization of KC mRNA (20, 39). To assess the ability of IL-1
treatment to stabilize TTP-dependent decay, 293tet-off cells were cotransfected with the P1P2 construct (see Figs. 2 and 3) and the cDNA-encoding TTP and were treated with Dox alone or in combination with IL-1
before determination of residual KC mRNA levels. Although TTP expression promoted substantive decay of mRNA containing the P1P2 fragment, IL-1
treatment did not result in any stabilization (Fig. 4, A and B). In some experiments, IL-1
was added 2 h before Dox to ensure that TTP phosphorylation would be achieved before measuring decay, but these experiments showed identical results (data not shown). HA-tagged TTP is phosphorylated in untreated 293 cells as indicated by the electrophoretic mobility shift following treatment of extracts with alkaline phosphatase (Fig. 4, C and D). Furthermore, the degree of phosphorylation is enhanced following stimulation with IL-1
.
|
|
| Discussion |
|---|
|
|
|---|
, instability mediated by constitutively expressed TTP is not subject to this control; and (3) finally, TTP appears to be the primary determinant of KC mRNA instability in mononuclear phagocytes, although in cells that do not express TTP, this mRNA retains substantial instability.
TTP was first linked with degradation of ARE-containing mRNAs in the context of TNF-
mRNA (29). The ARE of TNF-
contains multiple overlapping AUUUA pentamers, suggesting that such sequences might be specific targets for TTP recognition and function. This has been supported by studies directed at defining the sequence recognition specificity of TTP, in which the highest affinity recognition sites were demonstrated to contain three to four uridine residues flanked by at least one adenine, with the highest affinity being identified for a nonameric sequence element (UUAUUUAUU) (40, 47, 48). Our deletion analysis of KC 3'-UTR demonstrates that the clustered as well as isolated pentamer-containing sequences exhibit sensitivity to TTP. In 293 cells, mRNAs containing these AUUUA sequence fragments are relatively stable but exhibit dramatic decay promoted by the plasmid-driven expression of TTP. The pentamer structure in each case appears to provide the critical recognition motif because mutation of two central U residues destroys sensitivity (Fig. 3), and a KC mRNA in which all seven pentamer sequences are mutated has lost TTP sensitivity. Because only two of the sensitive motifs (one of the clustered pentamers and the P3 sequence) contain the consensus nonameric sequence, this structure does not appear to be an absolute requirement, and the pentamer structures found in P1 and P2 seem sufficient to promote sensitivity of an RNA sequence to the action of TTP.
The ability of proinflammatory stimuli acting through TIR family receptors to promote enhanced stability of some ARE-containing mRNAs is well documented (8, 9, 19). TTP can be phosphorylated on two separate serine residues (52 and 178) via the action of MAPKAP2, a kinase downstream of p38 MAP kinase and known to be involved in stimulus-mediated stabilization (43). Furthermore, this modification promotes the formation of a complex with 14-3-3 proteins that is now thought to regulate the association of TTP with P bodies, subcellular structures that appear to serve as the location for at least some components of mRNA decay (34, 49). In consideration of this, several reports have presented evidence indicating that TTP might be a target for the action of proinflammatory agents as an intermediate in the signaling pathway for stimulus-induced stabilization of selected ARE-containing mRNAs (32, 43, 44, 50). In macrophages from mice deficient in MAPKAP2, TIR-induced signals are unable to increase the stability of short-lived mRNAs including KC, whereas in cells from mice in which both MAPKAP2 and TTP have been deleted, KC mRNA is highly stable, suggesting that TTP functions downstream of MAPKAP2 (35, 51). This demonstrates that TTP is the primary determinant of instability, but it does not unequivocally demonstrate that it is necessarily the only target for TIR-induced mRNA stabilization. Interestingly, it has also been reported that phosphorylation of 14-3-3 regulates interaction with TTP and ultimately the control of mRNA decay (52). In contrast, a recent report documented that LPS stimulation was unable to modulate the activity of TTP (33). Our findings show that while TTP can promote the rapid decay of KC mRNA, this instability is insensitive to the action of IL-1
even though IL-1
treatment can change the phosphorylation state of TTP. The phosphorylation of TTP in response to p38 MAP kinase activity has been shown to regulate not only the interaction with 14-3-3 but also the stability of the protein and its subcellular localization (53). Furthermore, the activation of p38 MAP kinase and MAPKAP2 are necessary for the synthesis of TTP (35). Hence, the control of AU-rich mRNA decay and its modulation by extracellular stimulus appears likely to reflect a complex series of events that include the synthesis of TTP as well as regulation of its function.
A number of specific ARE-containing mRNAs, including other chemokines, have been demonstrated to exhibit sensitivity to TTP (29, 30, 54, 55). A recent study using oligonucleotide microarray analysis examined a broader spectrum of transcripts for TTP sensitivity in embryonic fibroblasts from wild-type and TTP–/– mice and identified a relatively small subset of sensitive mRNAs (31). Interestingly, although CXC chemokine mRNAs such as KC are known to be unstable and to contain AU-rich regions that would predict sensitivity to TTP, they showed only limited TTP sensitivity in this study. The present results argue convincingly that KC mRNA decay is sensitive to TTP and that, in primary mouse macrophages, TTP is the major mediator of KC instability. The difference between our findings and the prior report might reflect the fact that KC mRNA is highly sensitive to stabilization in response to the stimuli that also promote its transcription, and this may mask TTP-dependent instability. Indeed, in macrophages stimulated for 3 h with LPS, there is only modest difference between the decay of KC in wild-type as compared with TTP-deficient cells. The TTP dependency is observed more readily, however, in cells treated for 6 h before analysis or in cells where stabilization is inhibited with SB203580.
It is noteworthy that KC mRNA is highly unstable in cells lines that do not express TTP, and, furthermore, that the mutation of sequences that confer TTP sensitivity (all seven AUUUA containing sites) only partially reduces such instability (39). This suggests that additional ARE-binding proteins participate in regulating the posttranscriptional control of KC and similar mRNAs. Although it is clear that other ARE-binding proteins function in posttranscriptional control processes (56, 57), the degree to which multiple proteins participate in the regulation of a single mRNA is poorly appreciated. Moreover, it also appears likely that distinct mechanisms may operate in cell type-restricted patterns such that specific mRNAs may be regulated by distinct mechanisms in different cell populations or tissues.
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by U.S. Public Health Service Grants CA39621 and AI50739. ![]()
2 S.D. and R.B. contributed equally to this work. ![]()
3 Address correspondence and reprint requests to Dr. Thomas A. Hamilton, Cleveland Clinic Foundation, Lerner Research Institute, 9500 Euclid Avenue, Cleveland, OH 44195. E-mail address: hamiltt{at}ccf.org ![]()
4 Abbreviations used in this paper: TIR, Toll/IL-1 receptor; Act D, actinomycin D; ARE, adenine-uridine-rich element; CLU, cluster only; Dox, doxycycline; FL, full-length KC 3'-UTR; HA, hemagglutinin; M-MLV, Moloney murine leukemia virus; TTP, tristetraprolin; UTR, untranslated region. ![]()
Received for publication July 11, 2007. Accepted for publication December 9, 2007.
| References |
|---|
|
|
|---|
, β,
, and IL-8 mRNAs by IL-1β. Nucleic Acids Res. 19: 917-920.
production by tristetraprolin. Science 281: 1001-1005.
-stimulated STAT1-dependent transcription in mouse macrophages. J. Immunol. 159: 5474-5482. [Abstract]
B kinase β and protein kinase C
modulate mRNA stability through phosphorylation of 14-3-3β complexed with tristetraprolin. Mol. Cell. Biol. 25: 6454-6463. This article has been cited by other articles:
![]() |
D. J. Stumpo, H. E. Broxmeyer, T. Ward, S. Cooper, G. Hangoc, Y. J. Chung, W. C. Shelley, E. K. Richfield, M. K. Ray, M. C. Yoder, et al. Targeted disruption of Zfp36l2, encoding a CCCH tandem zinc finger RNA-binding protein, results in defective hematopoiesis Blood, September 17, 2009; 114(12): 2401 - 2410. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Schaljo, F. Kratochvill, N. Gratz, I. Sadzak, I. Sauer, M. Hammer, C. Vogl, B. Strobl, M. Muller, P. J. Blackshear, et al. Tristetraprolin Is Required for Full Anti-Inflammatory Response of Murine Macrophages to IL-10 J. Immunol., July 15, 2009; 183(2): 1197 - 1206. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. S. Balakathiresan, S. Bhattacharyya, U. Gutti, R. P. Long, C. Jozwik, W. Huang, M. Srivastava, H. B. Pollard, and R. Biswas Tristetraprolin regulates IL-8 mRNA stability in cystic fibrosis lung epithelial cells Am J Physiol Lung Cell Mol Physiol, June 1, 2009; 296(6): L1012 - L1018. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. L. Ogilvie, J. R. SternJohn, B. Rattenbacher, I. A. Vlasova, D. A. Williams, H. H. Hau, P. J. Blackshear, and P. R. Bohjanen Tristetraprolin Mediates Interferon-{gamma} mRNA Decay J. Biol. Chem., April 24, 2009; 284(17): 11216 - 11223. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. W. Walton, L. Holt, and R. B. Sartor Lipopolysaccharide activates innate immune responses in murine intestinal myofibroblasts through multiple signaling pathways Am J Physiol Gastrointest Liver Physiol, March 1, 2009; 296(3): G601 - G611. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Hartupee, C. Liu, M. Novotny, D. Sun, X. Li, and T. A. Hamilton IL-17 Signaling for mRNA Stabilization Does Not Require TNF Receptor-Associated Factor 6 J. Immunol., February 1, 2009; 182(3): 1660 - 1666. [Abstract] [Full Text] [PDF] |
||||
![]() |
P.-H. Park, H. Huang, M. R. McMullen, P. Mandal, L. Sun, and L. E. Nagy Suppression of Lipopolysaccharide-stimulated Tumor Necrosis Factor-{alpha} Production by Adiponectin Is Mediated by Transcriptional and Post-transcriptional Mechanisms J. Biol. Chem., October 3, 2008; 283(40): 26850 - 26858. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Hartupee, X. Li, and T. Hamilton Interleukin 1{alpha}-induced NF{kappa}B Activation and Chemokine mRNA Stabilization Diverge at IRAK1 J. Biol. Chem., June 6, 2008; 283(23): 15689 - 15693. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |