The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

The Journal of Immunology, 2008, 180, 1913 -1920
Copyright © 2008 by The American Association of Immunologists, Inc.
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Haider, A. S.
Right arrow Articles by Krueger, J. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Haider, A. S.
Right arrow Articles by Krueger, J. G.

Identification of Cellular Pathways of "Type 1," Th17 T Cells, and TNF- and Inducible Nitric Oxide Synthase-Producing Dendritic Cells in Autoimmune Inflammation through Pharmacogenomic Study of Cyclosporine A in Psoriasis1

Asifa S. Haider, Michelle A. Lowes, Mayte Suárez-Fariñas, Lisa C. Zaba, Irma Cardinale, Artemis Khatcherian, Inna Novitskaya, Knut M. Wittkowski and James G. Krueger2

Laboratory for Investigative Dermatology, Rockefeller University, New York, NY, 10021


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Therapeutic modulation of psoriasis with targeted immunosuppressive agents defines inflammatory genes associated with disease activity and may be extrapolated to a wide range of autoimmune diseases. Cyclosporine A (CSA) is considered a "gold standard" therapy for moderate-to-severe psoriasis. We conducted a clinical trial with CSA and analyzed the treatment outcome in blood and skin of 11 responding patients. In the skin, as expected, CSA modulated genes from activated T cells and the "type 1" pathway (p40, IFN-{gamma}, and STAT-1-regulated genes). However, CSA also modulated genes from the newly described Th17 pathway (IL-17, IL-22, and downstream genes S100A12, DEFB-2, IL-1β, SEPRINB3, LCN2, and CCL20). CSA also affected dendritic cells, reducing TNF and inducible NO synthase (products of inflammatory TNF- and inducible NO synthase-producing dendritic cells), CD83, and IL-23p19. We detected 220 early response genes (day 14 posttreatment) that were down-regulated by CSA. We classified >95% into proinflammatory or skin resident cells. More myeloid-derived than activated T cell genes were modulated by CSA (54 myeloid genes compared with 11 lymphocyte genes), supporting the hypothesis that myeloid derived genes contribute to pathogenic inflammation in psoriasis. In circulating mononuclear leukocytes, in stark contrast, no inflammatory gene activity was detected. Thus, we have constructed a genomic signature of successful treatment of psoriasis which may serve as a reference to guide development of other new therapies. In addition, these data also identify new gene targets for therapeutic modulation and may be applied to wide range of autoimmune diseases.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Psoriasis is a chronic inflammatory skin disorder mediated by T cells, dendritic cells (DCs),3 and inflammatory cytokines (1, 2). Previously psoriasis had been considered mainly a type 1 autoimmune disease with a strong IFN-{gamma} signature (2, 3, 4). Now it appears that there may be an important contribution from the newly described Th17 T cell population, defined by production of IL-17 (5, 6, 7, 8, 9). Th17 cells are activated by the DC cytokine IL-23, produce IL-17, IL-22, and TNF, and have many other downstream proinflammatory effects. The role of Th17 has been described in murine disease models (10) and the role of Th17 cells in human autoimmune disease is currently under investigation (8, 11, 12, 13). The effects of various therapeutic agents on Th17 cells are presently unknown. This Th17 pathway potentially offers a new therapeutic target for the treatment of autoimmune inflammation.

The immunosuppressive agent cyclosporine A (CSA) has revolutionized the field of organ transplantation since it was introduced for clinical use over 20 years ago (14). CSA inhibits calcineurin (a calcium-dependent serine/threonine phosphatase) and its substrate, the NFAT (15). Successful treatment of psoriasis with CSA led to the hypothesis that psoriasis was a T cell-mediated disease (16), and subsequently to the development of the new T cell-targeted biological therapies. There are several studies that describe cellular CSA effects in psoriasis. CSA may, e.g., inhibit keratinocyte cell cycle progression (17), affect psoriatic lymphocytes and macrophages (18), and decrease production of monocyte production of IL-12 (19).

Currently, there is little information regarding genomic expression alterations with CSA in skin diseases. We are at an exciting crossroad: we now have well-documented genomic expression patterns in psoriasis, and are beginning to appreciate the complex inflammatory circuitry involved, such as epidermal hyperplasia as well as T cell and DC activation (20). However, we still need to determine the relative contributions of these different pathways so that we can develop new hypotheses and treatment targets. It would be particularly useful to evaluate the effects of treatment on the affected skin tissue vs cells from the peripheral circulation. As CSA is considered a "gold standard" systemic therapy for moderate-to-severe psoriasis, the molecular changes induced by CSA may serve as a reference to understand the therapeutic activity of other immunosuppressives.

This study provides a reference list of genomic changes that may need to be achieved to deliver a consistent therapeutic benefit or a "genomic signature" of successful antipsoriatic therapy. In response to CSA treatment, psoriatic skin lesions showed a decrease in T cells and DCs, as expected. We have profiled genes affected by CSA in skin biopsies of psoriasis patients and categorized these to a set of cell types that are relevant to skin (21). In this study, we classified >95% of CSA-regulated genes as associated with proinflammatory cells and skin resident cells such as keratinocytes and fibroblasts. We found a large number of genes affected by CSA were not only associated with T cells and keratinocytes but also with myeloid cells, e.g., monocytes and DCs (21).

The effects of CSA were further detected on genes of the type 1 pathway (e.g., p40, STAT1, IFN-{gamma}, and IL-8; Ref. 3), on the Th17 pathway (e.g., IL-17, IL-22, defensin B2 (DEFB-2), CCL20 (MIP3{alpha}), and lipocalin 2 (LCN2); Ref. 22), and genes produced by a subset of inflammatory DCs, the TNF- and inducible NO synthase (iNOS)-producing DCs (Tip-DCs; e.g., suppression of and iNOS and TNF; Refs. 23 and 24). This knowledge can be further applied to better the understanding of disease pathogenesis of a wide range of autoimmune diseases and lead to new therapeutic targets.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Study design

Eleven patients with moderate-to-severe psoriasis were enrolled in this study, which was approved by The Rockefeller University Hospital Institutional Review Board. Informed consent was obtained from volunteers before their participation and the study was performed with strict adherence to the Declaration of Helsinki principles. Major inclusion criteria were: involvement of psoriasis vulgaris of >10% body surface area, neither systemic treatment for at least 4 wk nor topical treatment for at least 2 wk before entering the study, no significant infections or immune suppression, and no significant renal, hepatic, or other medical disease.

The patients were treated twice daily with 4 mg/kg/day CSA per os Five skin biopsies and two blood samples were taken. The link to the trial is available on the following website: www.clinicaltrials.gov/ct/show/ NCT00050648?order = 1.

Peripheral blood isolation

Peripheral blood draws were taken at days 0 (before CSA treatment) and 14 posttreatment. PBMC were isolated and stored at –80°C as previously described (25).

Skin samples

Lesional (LS) and nonlesional (NL) skin punch biopsies were obtained from index plaques at baseline day 0 and from LS areas at days 0, 14, 42, and 56. A representative psoriasis plaque large enough to allow for four repeated biopsies was selected as a LS area.The location was chosen for ease of biopsy wound care, e.g., abdomen or thigh. The biopsies were stained with hematoxylin (Fisher) and eosin (Shandon) and purified mouse anti-human mAbs to keratin 16 (K16; Sigma-Aldrich), CD3, CD25, and CD83 (BD Biosciences) as described previously (25). Epidermal thickness measures were computed by using National Institutes of Health software (NIH image 6.1), and positive cells were counted manually through computer-assisted image analysis. Total RNA was isolated and gene expression for proinflammatory genes were measured as described below.

Microarray analysis

U95Av2-set GeneChip probe microarrays (Affymetrix) were used containing probe sets representing ~12,000 genes. Fragmentation and array hybridization were conducted according to the manufacturer’s instructions (Affymetrix). Scanning and quality control, GeneChip expression value analysis, hierarchical clustering, and heat maps were performed as previously described (26).

The number of patients in each group was as follow: LS (n = 9), NL (n = 5), and day 14 posttreatment (n = 8). Similarly, mRNA from blood of four patients before and day 14 posttreatment was analyzed. The analysis was performed using Bioconductor packages for R (www.bioconductor.org). Expression values were obtained using the GCRMA algorithm. Genes were first filtered for overall intensity and evidence of variation across sample: genes where all the samples had intensity smaller than 3 (log 2 scale) and SD smaller than 0.15 were excluded from the analysis. A total of 7751 genes passed the filter.

Statistical analysis of microarray data

To assess differential expression of the groups of interest (LS vs NL and day 14 for the skin samples and day 14 vs baseline for blood samples) taking into account that samples came from the same patient, a linear mixed effect model was used considering condition (LS, NL, day 14) as a fixed factor and patient as random effect, which is also know as repeated measures ANOVA model. Model fitting and hypothesis testing were conducted using the limma package form Bioconductor. As proposed by Ref. 27 , limma uses an empirical Bayes method to moderate the SEs of the estimated contrasts which is particularly useful in microarray analysis where the number of replicates per condition is not high, resulting in more stable inference and improved power. For blood samples, this approach is the same as using the moderated paired t test. Contrasts were fitted and the moderated t test was used to assess differential expression. Values of p were adjusted controlling the false discovery rate (FDR) using the Benjamini-Hochberg approach. Finally, genes with a FDR <0.1 were declared differentially expressed.

Unsupervised hierarchical clustering of genes was performed using Euclidean distance and average linkage method, and is shown in a heat map graph (see Fig. 3). Complete lists of genes with description of relevant function of genes are provided in supplemental table I.4 Annotation was obtained using annotation package HGU95a version 2 1.14.0 built from Bioconductor.

Validation of expression changes in mRNA with real-time RT-PCR analysis

The expression of the following genes was tested in skin biopsies (n = 11): p19, p40, IFN-{gamma}, STAT1, IFN-regulatory factor 1 (IRF-1), monokine induced by IFN-{gamma}, CXCL9 (MIG), inducible NO synthase (iNOS), IL-8, myxovirus resistance 1, IFN-inducible protein p78 (Mx-1), keratin 16 (K16), IL-19, IL-1β, IL-17, IL-22, serine (or cysteine) proteinase inhibitor, member 3 (SERPINB3), granzyme B (GZMB), S100 calcium-binding protein A12 (S100A12), chemokine (CC motif) ligand 20 (MIP-3{alpha}), matrix metalloproteinase-12 (MMP12), defensin B2 (DEFB-2, DEFB4), and human acidic ribosomal protein (HARP). The expressions of IL-8, iNOS, IL-1β and MMP12 were also tested in mRNA isolated from blood (n = 10). The hARP gene, a housekeeping gene, was used to normalize each gene.

The primers and probes for these genes for the TaqMan RT-PCR assays were generated with the Primer Express algorithm, version 1.0, using published genetic sequences (National Center for Biotechnology Information (NCBI)-PubMed) for each gene. The primer sequences have been published for IL-23/p19/p40, IFN-{gamma}, STAT1, MIG, iNOS, IL-8, K16, and HARP (25), IP-10, MMP12, SERPINB3, DEFB-2, and GZMB (26). The primers sequence were as follows for: IP-10 forward: TCCACGTGTTGAGATCATTGC, IP-10 reverse: AATTCTTGATGGCCTTCGATTC, IP-10 probe: 6FAM-ACAATGAAAAAGAAGGGTGAGAAGAGATGTCTGAA-TAMARA (GenBank accession number NM_001009191; IRF-1 forward: TCCAGCACTGTCGCCATGT, IRF-1 reverse: GCACAACTTCCACTGGGATGT, IRF-1 probe: 6FAM-CTGTCAGCAGCACTCTCCCCGACTG-TAMARA (GenBank accession number NM_002198; IL-19 forward: CATGCAACTCTATTCCCAGCTACTT, IL-19 reverse: AGGTCAAAGCTGCAGTGAGCCATGATTG, IL-19 probe: 6FAM-GGGTGTCTCAATCTGGCACC-TAMARA (GenBank accession number AF276915); IL-1β forward: GCACGATGCACCTGTACGAT, IL-1β reverse: AGACATCACCAAGCTTTTTTGCT, IL-1β probe: 6FAM-CTGAACTGCACGCTCCGGGACTC-TAMRA (GenBank accession number NM_000576); S100A12 forward: TTGAAGAGCATCTGGAGGGAAT, S100A12 reverse: ACCCTTAGAGAGGGTGTCAAAATG, S100A12 probe: 6FAM- CAATATCTTCCACCAATACTCAGTTCGGAAGGG-TAMARA (GenBank accession number NM_005621); MIP-3{alpha} forward: GCTTTGATGTCAGTGCTGCTACTC, MIP-3{alpha} reverse: GTATCCAAGACAGCAGTCAAAGTTG, MIP-3{alpha} probe: 6FAM-TGCGGCGAATCAGAAGCAGCAA-TAMARA (GenBank accession number NM_004591. The primers and probes for IL-17 (assay ID Hs00174383_m1), MX-1 (assay ID Hs00182073_m1), IL-22 (Hs00220924_m1) were designed by Applied Biosystems. The RT-PCR was performed using EZ PCR Core Reagents (Applied Biosystems) according to the manufacturer’s directions and as previously described (25).

Statistical analysis of histology and real-time RT-PCR data

The repeated measures ANOVA model (28, 29) was used to evaluate the evolution in time of each gene and histological variable. The statistical mixed effect models include time as fixed effect and patient as random effect and was fitted using the mixed procedure available in SAS software.

Multivariate (µ-scores) analysis

To assess relative changes over time, the gene expression and phenotype data from days 0 (LS and NL) and x (14, 42, or 56) were transformed as (LSx – NL0)/(LS0 – NL0). T cell counts were transformed as LSx/LS0. Multivariate µ scores (46) were used to combine the changes of all genes belonging to a given pathway (Th.1, Th.17, Tip-DC, other).

Among the phenotype variables, epidermal thickness (ET) and psoriasis area of severity index (PASI) are related measures. Thus, short-term changes between days 0 and 14 in ET (ET, PASI, and K16) expression were combined into a comprehensive measure in a hierarchical fashion (indicated as parentheses in the formulae given above and in the figures and tables), to increase information content (to be published separately). For long-term changes, an additional level of hierarchy was added to combine the (ET, PASI, K16) profiles for days 14, 42, and 56.

For univariate data (gene expression), µ scores reduce to the well-known µ scores (Mann-Whitney) or, equivalently, to ranks (Wilcoxon). Genes related to disease remission were identified by computing Spearman-type correlation coefficients (using µ scores, instead of ranks) and related p values (based on the Gaussian distribution).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
Response of psoriasis to CSA administration: therapeutic improvement parallels reduction in CD3+, CD25+ T cells, and CD83+ DCs in psoriatic skin lesions

To assess the effect of CSA on disease activity, T cells and DCs in biopsies of NL and an index skin lesion were taken at baseline and after days 14, 42, and 56 of treatment. Both PASI and histologic remission were assessed to judge responses to CSA. Cryostat sections were analyzed for routine histopathology, epidermal thickness measurements, CD3+, CD25+ lymphocytes, CD83+ DCs counts and K16 expression (Fig. 1).


Figure 1
View larger version (67K):
[in this window]
[in a new window]

  		FIGURE 1. Marked reduction in epidermal thickness, PASI, CD3+, CD25+, and CD83+ cells after treatment with cyclosporine: histology and immunohistochemical analysis of skin biopsies before and during treatment with cyclosporine. A, Example of one patient in the epidermis and dermis at baseline NL, baseline LS, days 14, 42, and 56 after treatment with cyclosporine showing routine H & E stain and normalization of epidermal thickness and K16 staining with treatment, and corresponding reduction in CD3+ and CD25+ cells. (Magnification: x10). B, Mean values of PASI, ET (micrometer), total (epidermal and dermal) T cell (CD3+), and total CD25+ T cell and total mature DC (CD83+) number during treatment. Decreases at day 14 (D14), day 42 (D42), and day 56 (D56) are compared with baseline LS: n = 11; *, p < 0.05; **, p < 0.01; ***, p < 0.001.

 
The patients demonstrated good clinical responses to CSA, with 7 of 11 patients achieving an improvement of PASI >92–100% and 4 of 11 patients showed an improvement of PASI >65–83% after 56 days of treatment (p < 0.001). Histological remission was defined as reduced epidermal hyperplasia, restoration of the granular layer, orthokeratosis, and normalization of K16 expression in day 56 LS biopsies. There was progressive epidermal thinning during the treatment period, paralleled by progressive decreases in total CD3+ and CD25+ T cell and CD83+ DC counts (Fig. 1B).

CSA administration down-regulates proinflammatory genes produced by "type 1," Th17 T cells and Tip-DCs in psoriatic skin lesions

To understand the effects of CSA on proinflammatory genes expressed in the skin lesions, we analyzed the gene expression in the skin biopsies collected during the clinical trial. We found that the major effect of CSA was in down-regulating gene expression at day 14 posttreatment. This inhibitory effect lasted during the course of treatment. We found many proinflammatory genes suppressed after treatment with CSA. We separated these genes into four categories that are described in Fig. 2. We detected major effects on genes of the "type 1" pathway (3) (Fig. 2A), the Th17 pathway (22) (Fig. 2B), genes produced by Tip-DCs (23) (Fig. 2C), and additional proinflammatory genes that can be ascribed to common cytokine effects of the above pathways.


Figure 2
View larger version (20K):
[in this window]
[in a new window]

  		FIGURE 2. Cyclosporine down-regulates proinflammatory "type 1," Th17 and genes produced by Tip-DC in psoriasis. Real-time RT-PCR analysis: mean tissue gene expression using real-time RT-PCR in NL and LS skin before and day 14 (D14), day 42 (D42), and day 56 (D56) after treatment with cyclosporine (n = 11). Ratio of gene-to-HARP x 1000. CSA regulation of: A, genes of "type 1" pathway: p40, IFN-{gamma}, STAT1, IFN-regulatory factor 1 (IRF1), CXCL9 (MIG), IP-10, myxovirus resistance 1 (Mx-1), and IL-8. B, Genes of Th17 pathway: p19, IL-17, IL-22, CCL20 (MIP 3{alpha}), defensin B2 (DEFB-2), IL-1β, serine (or cysteine) proteinase inhibitor, member 3 (SERPINB3), and S100 calcium-binding protein A12 (S100A12). C, Genes produced by Tip-DC: iNOS and TNF-{alpha}, and D: additional genes: K16, GZMB, MMP12, and IL-19. SE of mean shown; *, p < 0.05; **, p < 0.01.

 
Genes of the "type 1" pathway down-regulated with CSA include the IL-12 subunit p40, IFN-{gamma}, and the primary response genes STAT1, IRF1, IP-10, and MIG. The secondary response genes of activated "type 1" pathway that were affected by CSA included genes like IL-8 and Mx1 (Fig. 2A).

The genes of Th17 pathway which were down-regulated with CSA (Fig. 2B) include IL-23 subunit p19, IL-17, IL-22, and downstream genes such as MIP-3{alpha}, DEFB-2, IL-1β, SERPINB3, and S100A12 (12, 30, 31). Tip-DCs produce iNOS and TNF and these were both down-regulated with treatment (Fig. 2C). The effects of CSA were further detected on additional genes known to be up-regulated in psoriasis and regulated by IL-17, IFN-{gamma}, and TNF (Fig. 2D). These genes included K16, GZMB, MMP12, and IL-19.

To detect how CSA might be affecting gene expression in general, we tested expression of 12,000 genes using Affymetrix human U95Av2 gene chips at baseline skin (NL and LS skin biopsies and day 14 posttreatment) and blood (baseline and day 14 posttreatment). A heat map of genes with elevated expression in LS skin as compared with NL or day 14 posttreatment is shown (Fig. 3A). We identified 190 known genes that are down-regulated by CSA at day 14 posttreatment by 1.5-fold (p < 0.1 after correction). The list of genes with description of the function is available in supplemental table I. We detected genes such as S100A12, IL-1β, iNOS, GZMB, K16, SERPINB3, CXCL9 (MIG), IL-8, MMP12, and STAT1 with both microarray and real-time RT-PCR (Figs. 2 and 3).


Figure 3
View larger version (45K):
[in this window]
[in a new window]

  		FIGURE 3. Cyclosporine down-regulates genes in skin but not in blood. A, Heat map of mean gene expression from gene array analysis of skin (NL), LS, and day 14 posttreatment) and blood (baseline (D0) and day 14 (D14) posttreatment) from three patients treated with CSA. mRNA was hybridized to individual oligonucleotide arrays containing ~12,000 human genes (Affymetrix HG-U95Av2 chips). Heat maps show unsupervised hierarchical clusters using similarity measure: Pearson correlation of genes in: A, skin compared with blood: i, up-regulated in skin lesions: LS (red area) and as compared with gene expression in NL or genes down-regulated (1.5-fold, p < 0.1, corrected) at day 14 after treatment; ii, in blood: no difference in gene expression at days 0 vs 14; B, gene expression from RNA isolated from blood of 10 patients using real-time RT-PCR in baseline blood (day 0) before and day 14 (day 14 after treatment). Ratio of proinflammatory genes: IL-8, IL-1β, iNOS, and MMP12 was normalized to gene-to-HARP x 1,000 (SE of mean shown; p > 0.05, n = 10).

 
CSA effects genes expressed only in skin biopsies and not in blood at day 14 posttreatment

In contrast to the effects of CSA on gene expression changes in skin at day 14, we did not detect any changes in peripheral blood circulating by day 14 posttreatment. Fig. 3A shows a heat map (on the left) of genes down-regulated after day 14 posttreatment in skin biopsies compared with LS skin. The heat map of gene array of RNA isolated from three patients on the right shows that there is no difference in expression (p > 0.05) of 12,000 genes expressed at baseline (day 0) and day 14 posttreatment. In accordance with the microarray analysis, our real-time RT-PCR analysis of RNA isolated from 10 patients shows lack of effect on proinflammatory genes like IL-8, IL-1β, iNOS, and MMP12 in blood samples at baseline (day 0) and day 14 posttreatment (Fig. 3B). Both analyses reveal no effect of CSA in blood as compared with skin biopsies.

Association of genes regulated by CSA with proinflammatory cells: identification of genes uniquely expressed in activated cells

We have recently created gene lists ("gene maps") that describe lineage characteristics of cells grown in vitro that include monocytes, DCs, T cells, fibroblasts, and keratinocytes (21). The gene maps also include genes that are expressed commonly in myeloid cells (monocytes, macrophages, and DCs) and such expressed in more than one leukocyte (myeloid cells and T cells). There are also genes that are expressed in multiple cells (leukocytes, fibroblasts, and keratinocytes) or are expressed in all cells (housekeeping). We have also listed genes that describe the activation genes after maturation of DCs; T cell genes after activation with anti-CD3/CD28 Ab or keratinocyte activation genes after stimulation with cytokines (TNF and IFN-{gamma}). As we detected several genes known to be regulated in the Th17 pathway, we have pointed these out with references from the known literature (supplemental table I).

To better understand the role of CSA on genes derived from proinflammatory cells known to be present in LS skin biopsies, we intercepted the genes down-regulated by CSA at day 14 with the lineage genes described in Table I. To our surprise, a large subset of these genes is present in myeloid derived cells. There were 54 genes associated with myeloid derived cells (monocytes, macrophages, and DC) compared with 11 genes associated with activated T cells (Table I, Lineage genes). As expected, there were a number of genes associated with keratinocytes and fibroblasts (51). We also classified 15 genes that were unique to T cell activation or cytokine (TNF, IFN-{gamma}, and IL-17) activation (Table I, Unique activation). These included genes such as LCN2, CXCL1, CXCL9, MMP12, and CXCL10 (bold in supplemental table I). We also detected a set of genes with known functions but not associated with a specific cell typed analyzed (not classified: Table I, Summary).


View this table:
[in this window]
[in a new window]

  		Table I. Number of psoriasis genes down-regulated by CSA in skin and associated cell typesa

 
Correlation of disease remission with changes in proinflammatory CSA-regulated genes along the "type 1," Th17, and Tip-DC pathways

To characterize how expression of inflammatory mediators in Th1 (p40, IFN-{gamma}, STAT1, IRF1, MIG, IP-10, IL-8, Mx1), Th17 (p19, IL-17, IL-22, CCL20 (MIP-3{alpha}), DEFB-2 (DEFB4), IL-1β, SERPINB3, S100A12), and Tip-DC (iNOS, TNF{alpha}) pathways as well as additional genes like GZMB, MMP12, and IL-19 relate to psoriasis disease activity, µ scores of changes in mRNA levels between days 0 and 14 were compared with the short-term (day 14) and long-term (days 14, 42, 56) µ scores of phenotype changes (Fig. 4).


Figure 4
View larger version (32K):
[in this window]
[in a new window]

  		FIGURE 4. Correlation of disease remission with changes in proinflammatory CSA-regulated genes along the "type 1," Th17, and Tip-DC pathways. Correlation of gene expressions in pathways: Th1 (p40, IFN, STAT1, IRF1, MIG, IP-10, IL-8, and Mx-1), Th17 (p19, IL-17, IL-22, CCL20, DEFB-2, IL-1β, SERPINB3, S100A12), Tip-DC (TNF, iNOS), and other (additional genes down-regulated by CSA: GZMB, MMP12, IL-19) with short-term (day 14) and the long-term (days 14, 42, 56) histological and clinical measures (ET, PASI, and K16 expression). A, Analysis of pathways. B, Analysis of individual genes; p < 0.1 are indicated. Genes that appear as top six in both analyses are indicated with gray highlights. The formulas for the correlation measures are indicated in parentheses.

 
First, we correlated the overall clinical score (ET, PASI, K16) and gene expressions by the four pathways (Fig. 4A). All four pathways seem to be involved in the short-term changes; Tip-DCs may play a more prominent role for the long-term changes. Finally, the expression of these genes was analyzed individually (Fig. 4B). Expression of IL-17 correlated best at day 14. Consistent with Fig. 4A, iNOS, part of the Tip-DC pathway, correlated best with long-term effects. Five genes appear among the top six in both analyses. They are highlighted in gray: IL-17, SERPINB3, S100A12 (Th17), iNOS (Tip-DC), IL-19 (other). Of the Th1 pathway, MX-1 is number 5 among the short-term effects and IL-8 is number 3 among the long-term effects.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
CSA is a calcineurin antagonist with demonstrated ability to counter T cell activation and CTL differentiation, which are required in a host vs graft response. This led to clinical application to prevent organ rejection in transplant recipients. It also has significant ability to suppress end-organ inflammation in psoriasis and that activity has been taken as evidence that T cell activation is central in this disease. Although the therapy of psoriasis is evolving to treat this disease with more specific biologic antagonists, e.g., alefacept (amevive, anti-CD2) or efalizumab (raptiva, anti-CD11a) targeted to pathogenic T cells, TNF antagonists, or IL-12/IL-23 antagonists (25, 32), the therapeutic activity of most of these biologics is less than that of cyclosporine. Indeed, in this study 11 of 12 treated patients had excellent improvement in disease activity and histologic reversal of K16 expression within lesions.

Compared with the TNF antagonist etanercept (33), cyclosporine appears to produce more rapid and quantitatively larger suppression of a variety of inflammatory gene products, so that it is tempting to relate the stronger/broader suppression of inflammatory gene activation by cyclosporine to its increased therapeutic activity compared with etanercept. However, at this juncture, comparable data for modulation of inflammatory gene sets (using array-based methods) are not available for more targeted biologic agents in psoriasis. Thus, the set of genes modulated in the skin by cyclosporine treatment of psoriasis will provide a "genomic signature" of successful treatment, and serve as a reference "anti-inflammatory" group for eventual comparison with more targeted inhibitors.

A major finding of our study is that in addition to specific leukocytes, CSA impacts on key inflammatory pathways. Within 2 wk of commencing treatment with cyclosporine, there was strong genomic inhibition of two pathways. First, Th1-type T cell activation was suppressed as shown by decreased STAT1, IFN-{gamma}, and several downstream genes regulated by IFN-{gamma} (3). Second, there was suppression of Th17 activation with decreased IL-17, IL-22, and downstream genes including DEFB-2, LCN2, CXCL1, and CCL20 (5, 6, 7, 11, 30, 31, 34). In vitro keratinocyte treatment with IL-17 and IL-22 led to induction of IL-1β, SA10012, and SERPINB3 (data not shown), and these genes were also decreased by CSA. We have also identified genes regulated by CSA that are specific products of IL-17-, TNF-, or IFN-{gamma}-activated cells, or T cells activated by TCR ligation (supplemental table I). Previous studies (35, 36) have identified suppression of "type 1" gene products during successful treatment of psoriasis with therapeutic agents. IL-17 and IL-17-induced gene products are only newly identified in psoriasis (12, 30). These data now show strong suppression of IL-17 (Th17) axis by CSA in psoriasis. This is further supported by the strong and significant correlation of Th17 pathways with disease remission. We believe the analysis of CSA’s effect on suppression of Th1 vs Th17 inflammatory pathways is particularly important within a human inflammatory disease, because differences in activating stimuli for Th17 T cells have been identified in human vs mouse models (10, 12, 13, 37) and these differences could translate to differential effects of immunosuppressive agents on mouse vs human Th17 T cells.

Although the effects of CSA on T cells have long been appreciated, we detected a significant suppression of DC genes during treatment of psoriasis, from several perspectives. We have developed a set of lineage-specific genes of cutaneous cell types (21) and using these cell signatures, we found that the major effects of CSA were on myeloid-derived cells. DC maturation was strongly reduced (38), with reduced CD83 protein expression as well as multiple gene products associated with DC maturation. More specifically, CSA suppressed key inflammatory products of TIP-DCs, a newly recognized population of inflammatory DCs in psoriasis and increased frequency of skin cancers in transplant patients (23, 39). These CD11c+ myeloid-derived DCs produce inflammatory products including IL-20, IL-23, TNF, and NO (as a product of iNOS that is highly up-regulated in these cells) (23, 37, 40). CSA treatment of psoriasis decreased genomic expression of IL-23, TNF, and iNOS. The genes of the Tip-DC pathway correlated best with disease remission when the whole period of treatment was considered.

Products of Tip-DCs, such as IL-20, may be directly activating for epidermal keratinocytes (40). IL-19 and IL-20 gene expression are increased in psoriasis and have been shown to decrease with therapy (40, 41). CSA decreases IL-20-regulated genes such as IL-19, IL-8, CD83, and CXCL1, SPRR1B (40, 41). IL-23 appears to be a key activator of Th17 T cells and cytokine products of these cells (believed to be IL-17A and IL-22) have significant ability to stimulate keratinocyte hyperplasia and induce other inflammatory products in keratinocytes that typify psoriasis lesions (12). Hence, there is a growing body of evidence that IL-20 family cytokines, i.e., IL-19, IL-20, and IL-22, may be key pathogenic cytokines in psoriasis (30).

Our findings describe major effects of CSA on several signaling pathways of ILs, e.g., IL-1β, IL-12, IL-23, IL-20, IL-17, IL-22, CCL20, CXCL9 as well as IFN-{gamma}, and TNF, in myeloid-derived, skin resident and T cells. The role of Th1-induced chemokines like MIG in psoriasis may be to direct trafficking of T cell to psoriatic skin (42) and IFN-{gamma} is a probable inducer of >100 STAT1-regulated genes that are induced in psoriasis. Alternatively, Th17-chemokine like MIP3{alpha} (CCL20) (11) expressed in skin may direct migration of DC precursors to psoriasis lesions (43) and innate defense products induced by IL-17 and IL-22 are key contributors to psoriasis lesions. Thus, the complex mixture of cell types and expressed genes must be considered to be induced by inflammatory products synthesized by Tip-DCs, Th1, and Th17 T cells at a minimum (2, 3, 30, 37).

Interestingly, the gene expression changes in response to CSA at a relatively early time point are localized in skin rather than blood. Thus, it can be assumed that the therapeutic activity of the drug is in skin and further supports the assumption that psoriasis is a disease of immune modulation in the skin rather than circulating lymphocytes (4, 44, 45). To the extent that other inflammatory diseases have common inflammatory pathways expressed, this psoriasis response data may help to explain therapeutic activities in tissues, which are not accessible to biopsy analysis. Within the background of multiple types of leukocytes, complex genomic activation of inflammation in psoriasis lesions, and the interplay of innate acquired immune activation, we have revisited the pharmacologic actions of CSA and identified new pharmacologic actions of this widely used drug. An additional study from our laboratory reports reduced expression of IL-17 and IL-22 mRNA in psoriasis patients treated with cyclosporine as evidence that Th17 T cells are present and active in psoriasis lesions, but that study did not analyze genes that might be regulated by these cytokines in psoriasis lesions.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported in part by National Institutes of Health (NIH)/Clinical and Translational Science Award Grant UL1 RR024143. M.A.L. was supported by NIH Grant K23AR052404. L.C.Z. was supported by NIH Medical Science Training Program Grant GM07739. Back

2 Address correspondence and reprint requests to Dr. James G. Krueger, Laboratory for Investigative Dermatology, Rockefeller University, 1230 York Avenue, New York, NY, 10021-6399. E-mail address: jgk{at}mail.rockefeller.edu Back

3 Abbreviations used in this paper: DC, dendritic cell; CSA, cyclosporine A; iNOS, inducible NO synthase; Tip-DC, TNF- and iNOS-producing-DC; LS, lesional; NL, nonlesional; PASI, psoriasis area and severity index; ET, epidermal thickness. Back

4 The online version of this article contains supplemental material. Back

Received for publication August 13, 2007. Accepted for publication November 14, 2007.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Bowcock, A. M., J. G. Krueger. 2005. Getting under the skin: the immunogenetics of psoriasis. Nat. Rev. Immunol. 5: 699-711. [Medline]
  2. Lowes, M. A., A. M. Bowcock, J. G. Krueger. 2007. Pathogenesis and therapy of psoriasis. Nature 445: 866-873. [Medline]
  3. Lew, W., A. M. Bowcock, J. G. Krueger. 2004. Psoriasis vulgaris: cutaneous lymphoid tissue supports T-cell activation and "type 1" inflammatory gene expression. Trends Immunol. 25: 295-305. [Medline]
  4. Austin, L. M., M. Ozawa, T. Kikuchi, I. B. Walters, J. G. Krueger. 1999. The majority of epidermal T cells in Psoriasis vulgaris lesions can produce type 1 cytokines, interferon-{gamma}, interleukin-2, and tumor necrosis factor-{alpha}, defining TC1 (cytotoxic T lymphocyte) and TH1 effector populations: a type 1 differentiation bias is also measured in circulating blood T cells in psoriatic patients. J. Invest. Dermatol. 113: 752-759. [Medline]
  5. Shen, F., Z. Hu, J. Goswami, S. L. Gaffen. 2006. Identification of common transcriptional regulatory elements in interleukin-17 target genes. J. Biol. Chem. 281: 24138-24148. [Abstract/Free Full Text]
  6. Shen, F., M. J. Ruddy, P. Plamondon, S. L. Gaffen. 2005. Cytokines link osteoblasts and inflammation: microarray analysis of interleukin-17- and TNF-{alpha}-induced genes in bone cells. J. Leukocyte Biol. 77: 388-399. [Abstract/Free Full Text]
  7. Moseley, T. A., D. R. Haudenschild, L. Rose, A. H. Reddi. 2003. Interleukin-17 family and IL-17 receptors. Cytokine Growth Factor Rev. 14: 155-174. [Medline]
  8. Li, J., D. Li, Z. Tan. 2004. The expression of interleukin-17, interferon-{gamma}, and macrophage inflammatory protein-3 {alpha} mRNA in patients with psoriasis vulgaris. J. Huazhong Univ. Sci. Technolog. Med. Sci. 24: 294-296. [Medline]
  9. Liu, X. K., J. L. Clements, S. L. Gaffen. 2005. Signaling through the murine T cell receptor induces IL-17 production in the absence of costimulation, IL-23 or dendritic cells. Mol. Cells 20: 339-347. [Medline]
  10. Weaver, C. T., R. D. Hatton, P. R. Mangan, L. E. Harrington. 2007. IL-17 family cytokines and the expanding diversity of effector T cell lineages. Annu. Rev. Immunol. 25: 821-852. [Medline]
  11. Homey, B., M. C. Dieu-Nosjean, A. Wiesenborn, C. Massacrier, J. J. Pin, E. Oldham, D. Catron, M. E. Buchanan, A. Muller, R. DeWaal Malefyt, et al 2000. Up-regulation of macrophage inflammatory protein-3 {alpha}/CCL20 and CC chemokine receptor 6 in psoriasis. J. Immunol. 164: 6621-6632. [Abstract/Free Full Text]
  12. Zheng, Y., D. M. Danilenko, P. Valdez, I. Kasman, J. Eastham-Anderson, J. Wu, W. Ouyang. 2007. Interleukin-22, a Th17 cytokine, mediates IL-23-induced dermal inflammation and acanthosis. Nature 445: 648-651. [Medline]
  13. Acosta-Rodriguez, E. V., L. Rivino, J. Geginat, D. Jarrossay, M. Gattorno, A. Lanzavecchia, F. Sallusto, G. Napolitani. 2007. Surface phenotype and antigenic specificity of human interleukin 17-producing T helper memory cells. Nat. Immunol. 8: 639-646. [Medline]
  14. Borel, J. F., C. Feurer, H. U. Gubler, H. Stahelin. 1976. Biological effects of cyclosporin A: a new antilymphocytic agent. Agents Actions 6: 468-475. [Medline]
  15. Schreiber, S. L., G. R. Crabtree. 1992. The mechanism of action of cyclosporin A and FK506. Immunol. Today 13: 136-142. [Medline]
  16. Ellis, C. N., D. C. Gorsulowsky, T. A. Hamilton, J. K. Billings, M. D. Brown, J. T. Headington, K. D. Cooper, O. Baadsgaard, E. A. Duell, T. M. Annesley, et al 1986. Cyclosporine improves psoriasis in a double-blind study. J. Am. Med. Assoc. 256: 3110-3116. [Abstract/Free Full Text]
  17. Gottlieb, A. B., J. G. Krueger, L. Khandke, R. M. Grossman, J. Krane, D. M. Carter. 1991. Role of T cell activation in the pathogenesis of psoriasis. Ann. NY Acad. Sci. 636: 377-379. [Medline]
  18. Gupta, A. K., O. Baadsgaard, C. N. Ellis, J. J. Voorhees, K. D. Cooper. 1989. Lymphocytes and macrophages of the epidermis and dermis in lesional psoriatic skin, but not epidermal Langerhans cells, are depleted by treatment with cyclosporin A. Arch. Dermatol. Res. 281: 219-226. [Medline]
  19. Tada, Y., A. Asahina, T. Takekoshi, E. Kishimoto, H. Mitsui, H. Saeki, M. Komine, K. Tamaki. 2006. Interleukin 12 production by monocytes from patients with psoriasis and its inhibition by ciclosporin A. Br. J. Dermatol. 154: 1180-1183. [Medline]
  20. Liu, Y., J. G. Krueger, A. M. Bowcock. 2007. Psoriasis: genetic associations and immune system changes. Genes Immun. 8: 1-12. [Medline]
  21. Haider, A. S., M. A. Lowes, M. Suarez-Farinas, L. C. Zaba, I. Cardinale, M. Blumenberg, and J. G. Krueger. 2007. Cellular genomic maps help dissect pathology in human skin disease. J. Invest. Dermatol. In press.
  22. Nakae, S., Y. Iwakura, H. Suto, S. J. Galli. 2007. Phenotypic differences between Th1 and Th17 cells and negative regulation of Th1 cell differentiation by IL-17. J. Leukocyte Biol. 81: 1258-1268. [Abstract/Free Full Text]
  23. Lowes, M. A., F. Chamian, M. V. Abello, J. Fuentes-Duculan, S. L. Lin, R. Nussbaum, I. Novitskaya, H. Carbonaro, I. Cardinale, T. Kikuchi, et al 2005. Increase in TNF-{alpha} and inducible nitric oxide synthase-expressing dendritic cells in psoriasis and reduction with efalizumab (anti-CD11a). Proc. Natl. Acad. Sci. USA 102: 19057-19062. [Abstract/Free Full Text]
  24. Romanowska, M., N. Al Yacoub, H. Seidel, S. Donandt, H. Gerken, S. Phillip, N. Haritonova, M. Artuc, S. Schweiger, W. Sterry, and J. Foerster. 2007. PPAR{delta} enhances keratinocyte proliferation in psoriasis and induces heparin-binding EGF-like growth factor. J. Invest. Dermatol. In press.
  25. Chamian, F., M. A. Lowes, S. L. Lin, E. Lee, T. Kikuchi, P. Gilleaudeau, M. Sullivan-Whalen, I. Cardinale, A. Khatcherian, I. Novitskaya, et al 2005. Alefacept reduces infiltrating T cells, activated dendritic cells, and inflammatory genes in psoriasis vulgaris. Proc. Natl. Acad. Sci. USA 102: 2075-2080. [Abstract/Free Full Text]
  26. Haider, A. S., S. B. Peters, H. Kaporis, I. Cardinale, J. Fei, J. Ott, M. Blumenberg, A. M. Bowcock, J. G. Krueger, J. A. Carucci. 2006. Genomic analysis defines a cancer-specific gene expression signature for human squamous cell carcinoma and distinguishes malignant hyperproliferation from benign hyperplasia. J. Invest. Dermatol. 126: 869-881. [Medline]
  27. Smyth, G. K.. 2004. Linear models and empirical Bayes methods for assessing differential expression in microarray experiments. Stat. Appl. Genet. Mol. Biol. 3: Article 3[Medline]
  28. Albert, J. M.. 1999. A threshold causal model for clinical trials with departures from intended treatment. Stat. Med. 18: 1615-1626. [Medline]
  29. Cnaan, A., N. M. Laird, P. Slasor. 1997. Using the general linear mixed model to analyse unbalanced repeated measures and longitudinal data. Stat. Med. 16: 2349-2380. [Medline]
  30. Wolk, K., E. Witte, E. Wallace, W. D. Docke, S. Kunz, K. Asadullah, H. D. Volk, W. Sterry, R. Sabat. 2006. IL-22 regulates the expression of genes responsible for antimicrobial defense, cellular differentiation, and mobility in keratinocytes: a potential role in psoriasis. Eur. J. Immunol. 36: 1309-1323. [Medline]
  31. Teunissen, M. B., C. W. Koomen, R. de Waal Malefyt, E. A. Wierenga, J. D. Bos. 1998. Interleukin-17 and interferon-{gamma} synergize in the enhancement of proinflammatory cytokine production by human keratinocytes. J. Invest. Dermatol. 111: 645-649. [Medline]
  32. Gottlieb, A. B., K. D. Cooper, T. S. McCormick, E. Toichi, D. E. Everitt, B. Frederick, Y. Zhu, C. E. Pendley, M. A. Graham, M. A. Mascelli. 2007. A phase 1, double-blind, placebo-controlled study evaluating single subcutaneous administrations of a human interleukin-12/23 monoclonal antibody in subjects with plaque psoriasis. Curr. Med. Res. Opin. 23: 1081-1092. [Medline]
  33. Gottlieb, A. B., F. Chamian, S. Masud, I. Cardinale, M. V. Abello, M. A. Lowes, F. Chen, M. Magliocco, J. G. Krueger. 2005. TNF inhibition rapidly down-regulates multiple proinflammatory pathways in psoriasis plaques. J. Immunol. 175: 2721-2729. [Abstract/Free Full Text]
  34. Liang, S. C., X. Y. Tan, D. P. Luxenberg, R. Karim, K. Dunussi-Joannopoulos, M. Collins, L. A. Fouser. 2006. Interleukin (IL)-22 and IL-17 are coexpressed by Th17 cells and cooperatively enhance expression of antimicrobial peptides. J. Exp. Med. 203: 2271-2279. [Abstract/Free Full Text]
  35. Oestreicher, J. L., I. B. Walters, T. Kikuchi, P. Gilleaudeau, J. Surette, U. Schwertschlag, A. J. Dorner, J. G. Krueger, W. L. Trepicchio. 2001. Molecular classification of psoriasis disease-associated genes through pharmacogenomic expression profiling. Pharmacogenomics J. 1: 272-287. [Medline]
  36. Trepicchio, W. L., M. Ozawa, I. B. Walters, T. Kikuchi, P. Gilleaudeau, J. L. Bliss, U. Schwertschlag, A. J. Dorner, J. G. Krueger. 1999. Interleukin-11 therapy selectively downregulates type I cytokine proinflammatory pathways in psoriasis lesions. J. Clin. Invest. 104: 1527-1537. [Medline]
  37. Lee, E., W. L. Trepicchio, J. L. Oestreicher, D. Pittman, F. Wang, F. Chamian, M. Dhodapkar, J. G. Krueger. 2004. Increased expression of interleukin 23 p19 and p40 in lesional skin of patients with psoriasis vulgaris. J. Exp. Med. 199: 125-130. [Abstract/Free Full Text]
  38. Tajima, K., R. Amakawa, T. Ito, M. Miyaji, M. Takebayashi, S. Fukuhara. 2003. Immunomodulatory effects of cyclosporin A on human peripheral blood dendritic cell subsets. Immunology 108: 321-328. [Medline]
  39. Stary, G., C. Bangert, M. Tauber, R. Strohal, T. Kopp, G. Stingl. 2007. Tumoricidal activity of TLR7/8-activated inflammatory dendritic cells. J. Exp. Med. 204: 1441-1451. [Abstract/Free Full Text]
  40. Wang, F., E. Lee, M. A. Lowes, A. S. Haider, J. Fuentes-Duculan, M. V. Abello, F. Chamian, I. Cardinale, J. G. Krueger. 2006. Prominent production of IL-20 by CD68+/CD11c+ myeloid-derived cells in psoriasis: gene regulation and cellular effects. J. Invest. Dermatol. 126: 1590-1599. [Medline]
  41. Romer, J., E. Hasselager, P. L. Norby, T. Steiniche, J. Thorn Clausen, K. Kragballe. 2003. Epidermal overexpression of interleukin-19 and -20 mRNA in psoriatic skin disappears after short-term treatment with cyclosporine a or calcipotriol. J. Invest. Dermatol. 121: 1306-1311. [Medline]
  42. Flier, J., D. M. Boorsma, P. J. van Beek, C. Nieboer, T. J. Stoof, R. Willemze, C. P. Tensen. 2001. Differential expression of CXCR3 targeting chemokines CXCL10, CXCL9, and CXCL11 in different types of skin inflammation. J. Pathol. 194: 398-405. [Medline]
  43. Schmuth, M., S. Neyer, C. Rainer, A. Grassegger, P. Fritsch, N. Romani, C. Heufler. 2002. Expression of the C-C chemokine MIP-3 {alpha}/CCL20 in human epidermis with impaired permeability barrier function. Exp. Dermatol. 11: 135-142. [Medline]
  44. Baker, B. S., A. F. Swain, H. Valdimarsson, L. Fry. 1984. T-cell subpopulations in the blood and skin of patients with psoriasis. Br. J. Dermatol. 110: 37-44. [Medline]
  45. Petrik, J.. 2001. Microarray technology: the future of blood testing?. Vox Sang. 80: 1-11. [Medline]
  46. Wittkowski, K. M. E. Lee, R. Nussbaum, F. N. Chamian, J. G. Krueger. 2004. Combining several ordinal measures in clinical studies. Stat. Med. 23: 1579-1592. [Medline]



This article has been cited by other articles:


Home page
 J. Leukoc. Biol.Home page
C. Ortega, S. Fernandez-A, J. M. Carrillo, P. Romero, I. J. Molina, J. C. Moreno, and M. Santamaria
IL-17-producing CD8+ T lymphocytes from psoriasis skin plaques are cytotoxic effector cells that secrete Th17-related cytokines
J. Leukoc. Biol., August 1, 2009; 86(2): 435 - 443.
[Abstract] [Full Text] [PDF]

Home page
 NEJMHome page
F. O. Nestle, D. H. Kaplan, and J. Barker
Psoriasis
N. Engl. J. Med., July 30, 2009; 361(5): 496 - 509.
[Full Text] [PDF]

Home page
 J. Immunol.Home page
L. van der Fits, S. Mourits, J. S. A. Voerman, M. Kant, L. Boon, J. D. Laman, F. Cornelissen, A.-M. Mus, E. Florencia, E. P. Prens, et al.
Imiquimod-Induced Psoriasis-Like Skin Inflammation in Mice Is Mediated via the IL-23/IL-17 Axis
J. Immunol., May 1, 2009; 182(9): 5836 - 5845.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
I. Kryczek, A. T. Bruce, J. E. Gudjonsson, A. Johnston, A. Aphale, L. Vatan, W. Szeliga, Y. Wang, Y. Liu, T. H. Welling, et al.
Induction of IL-17+ T Cell Trafficking and Development by IFN-{gamma}: Mechanism and Pathological Relevance in Psoriasis
J. Immunol., October 1, 2008; 181(7): 4733 - 4741.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Haider, A. S.
Right arrow Articles by Krueger, J. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Haider, A. S.
Right arrow Articles by Krueger, J. G.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS