The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


The Journal of Immunology, 2008, 180, 1390 -1397
Copyright © 2008 by The American Association of Immunologists, Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, I. Y.
Right arrow Articles by Choe, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, I. Y.
Right arrow Articles by Choe, J.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*INDOMETHACIN

Human Follicular Dendritic Cells Interact with T Cells via Expression and Regulation of Cyclooxygenases and Prostaglandin E and I Synthases1

In Yong Lee2,*,{dagger}, Whajung Cho*,{dagger}, Jini Kim*,{dagger}, Chan-Sik Park§ and Jongseon Choe3,*,{dagger},{ddagger}

* Department of Microbiology and Immunology, College of Medicine, {dagger} Vascular System Research Center, and {ddagger} Research Institute of Life Sciences, Kangwon National University, Chunchon, Korea; and § Department of Pathology, Asan Medical Center, University of Ulsan College of Medicine, Seoul, Korea


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
PGE2 inhibits mature T cell proliferation and protects T cells from activation-induced cell death (AICD). We have previously demonstrated that human follicular dendritic cells (FDC) strongly express PGI synthase. In this study, the hypothesis that FDC have regulatory roles on germinal center T cells by controlling production of PGE2 and PGI2 was tested. Confocal microscopic analyses of human tonsil tissues revealed that FDC indeed expressed PGE synthase in addition to PGIS. To confirm these results, we studied the regulation mechanism of PG production in FDC, using an established human FDC-like cell line, HK. Specifically in response to TNF-{alpha}, TGF-β, and LPS, protein expression of cyclooxygenase (COX)-2 and downstream PGE synthase was up-regulated with coordinate kinetics, whereas COX-1 and PGIS were constitutively expressed. The increase of these enzymes was reflected in actual production of PGE2 and PGI2. Interestingly, IL-4 almost completely abrogated the stimulatory activity of TNF-{alpha}, TGF-β, and LPS in PG production. Furthermore, the up-regulation of PGE2 and PGI2 production was markedly down-regulated by indomethacin and a selective COX-2 inhibitor. PGI2 analog and PGE2 inhibited proliferation and AICD of T cells in dose- and time-dependent manners. Finally, coculture experiments revealed that HK cells indeed inhibit proliferation and AICD of T cells. Put together, these results show an unrecognized pathway of FDC and T cell interactions and differential mechanisms for PGE2 and PGI2 production, suggesting an important implication for development and use of anti-inflammatory drugs.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Antigen-presenting cells initiate, support, and control the diverse immunological activities of lymphocytes. Follicular dendritic cells (FDC)4 are stromal cells specialized in presenting unprocessed Ags to B cells. FDC are known to derive from the nonhemopoietic cells (1), provide a microenvironmental niche for B and T cells in the primary and secondary follicles of lymphoid organs (2), and are indispensable for a fully robust humoral immune response. Several investigative groups, by using transgenic and knockout animals, have clearly demonstrated that FDC are required for normal development and maintenance of germinal center (GC) reactions (3, 4, 5). The GC, microanatomic site for the generation of memory B cells and plasma cells with high-affinity Abs, consists of the dark and light zones, surrounded by the follicular mantle zone (6). The dark zone contains actively dividing centroblasts that differentiate into centrocytes in the light zone (7). The light zone is rich in FDC in addition to the major component centrocytes (8, 9, 10, 11). Although accumulated evidence maintains that FDC play central roles in GC B cell differentiation into memory and plasma cells (2, 12, 13, 14), the regulatory role of FDC in T cells is poorly understood. T cells are a minor cellular component in the light zone, constituting ~10% of total cells (15). Castan et al. (16) demonstrated that T cells do not undergo active proliferation in the GC. Another perplexing puzzle is how T cells are insensitive to activation-induced cell death (AICD), considering the physiological milieu wherein they are exposed to continued antigenic insults.

PGs are lipid mediators derived from endogenous archidonic acids that are released from the cell membrane phospholipids in response to various stimuli, including inflammatory ones. Arachidonic acids are converted to PGs through the sequential enzyme actions of cyclooxygenases (COXs) and terminal PG synthases whose expression is cell specific (17). As well as the well-known activities of the major PGs, PGE2 and PGI2 as inflammatory and vascular mediators, respectively (18, 19), the importance of these molecules, particularly PGE2, in immunity is becoming recognized (20, 21). PGE2 inhibits T cell proliferation (22), protects from TCR-mediated AICD (23), and deviates T cell responses toward Th2 by inhibiting the production of Th1 cytokines (21). Furthermore, PGE2 exhibits numerous roles in the development and activities of B cells, dendritic cells, and macrophages (20). We have recently reported that human FDC and an FDC cell line, HK, strongly express functionally active PGI synthase (PGIS) (24).

Based upon the data presented by us and other research groups, we hypothesized that FDC suppress the proliferation and AICD of T cells in the GC by paracrine secretion of PGE2 and PGI2. To test this possibility, we examined the expression and regulation of the enzymes responsible for the production of these PGs by using human tonsil sections and HK cells. Our results show that FDC and HK cells express COXs and PGE synthase (PGES) in addition to PGIS; these enzymes are differentially regulated by inflammatory stimuli, and PGI2 analog, PGE2; and HK cells inhibit the proliferation and AICD of T cells.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Abs and other reagents

The mAb against PGIS, clone 3C8, was developed, as previously described (25), and labeled with biotin, according to the manufacturer’s instructions (Pierce). Other mAbs were against human microsomal PGES (mPGES)-1, COX-1, COX-2 (Cayman Chemical), β-actin (Sigma-Aldrich), and CD3 (clone 64.1; Y. Choi, Ochsner Clinic Foundation, New Orleans, LA). Unconjugated mouse IgG1, propidium iodide (PI), Con A, PGE2, and LPS were obtained from Sigma-Aldrich. Biotin-conjugated mouse IgG1 and streptavidin-FITC were purchased from DakoCytomation. Goat anti-mouse IgG FITC, goat anti-mouse IgG PE, alkaline phosphatase-conjugated goat anti-mouse IgG, and HRP-conjugated goat anti-mouse IgG were obtained from Jackson ImmunoResearch Laboratories. Indomethacin, CAY10404, beraprost, and enzyme immunoassay kits for PGE2, 6-keto-PGF1{alpha}, and thromboxane B2 (TXB2) were purchased from Cayman Chemical. Recombinant IL-1β, IL-8, IL-13, TNF-{alpha}, TGF-β, and IL-10 were purchased from R&D Systems. IL-2 was obtained from Hoffmann-LaRoche. Recombinant IL-4 and IL-6 were prepared in our laboratory (26).

Confocal scanning fluorescence microscopy

Cryostat sections of human tonsils were fixed in cold acetone for 10 min. The sections were rehydrated in PBS and blocked for 10 min with protein block (DakoCytomation). The slides were double stained first with anti-PGES Ab, followed by PE-labeled goat anti-mouse IgG Ab. Unoccupied Fab sites of goat Abs were blocked with mouse IgG1 Abs. The stained slides were incubated with biotin-conjugated 3C8 or biotin-conjugated mouse IgG1 Abs and then with FITC-conjugated streptavidin. The coverslips were mounted onto slides using fluorescent mounting medium (DakoCytomation). The relative positional distribution of the two fluorochromes was visualized and scanned using a confocal laser microscope (Fluoview FV300; Olympus). HK cells cultured in chamber slides were fixed with cold acetone for 10 min and incubated with 3C8 or anti-PGES Abs for 1 h at room temperature. After wash, the slides were incubated with FITC-conjugated goat anti-mouse Ig and PI for nuclear staining.

Culture of HK cells

HK cells were prepared and maintained, as described by Kim et al. (27). HK cells were maintained in RPMI 1640 (Invitrogen Life Technologies) supplemented with 10% FBS, 2 mM L-glutamine (Invitrogen Life Technologies), and 80 µg/ml gentamicin (Sigma-Aldrich). To examine the regulation of COX, PGES, and PGIS, HK cells were cultured in the presence of IL-1β (10 ng/ml), IL-2 (100 U/ml), IL-4 (100 U/ml), IL-6 (30 ng/ml), IL-8 (10 ng/ml), IL-10 (50 ng/ml), IL-13 (5 ng/ml), TNF-{alpha} (50 ng/ml), TGF-β (1 ng/ml), or LPS (1 µg/ml).

RT-PCR

Total RNA was extracted from HK cells using the Easy-blue RNA extraction kit (Intron Biotechnology). Reverse transcription was conducted using the GeneAmp RNA PCR kit (Applied Biosystems) in 20 µl of mixture containing 2 U of RNase inhibitor, 1 mM dNTP, 25 µM oligo(dT), and 2.5 U of reverse transcriptase. After denaturation for 5 min at 65°C, the reaction was conducted at 42°C for 45 min, followed by the inactivation at 99°C for 5 min. DNA amplification was performed using the DFS-TaqDNA polymerase (Bioron) in a 25 µl mixture of 100 ng of cDNA, 0.4 µM each primer, 0.4 mM dNTPs (Promega), 0.625 U of DNA polymerase, and PCR buffer (Bioron). The primer sets used are as follows: COX-1, TTACACTCGTATTCTGCCCT (sense), ATTGTCTCCATAAATGTGGC (antisense); COX-2, TTCAAATGAGATTGTGGAAAAATTGCT (sense), AGATCATCTCTGCCTGAGTATCTT (antisense); mPGES-1, ATGCCTGCCCACAGCCTG (sense), TCACAGGTGGCGGGCCGC (antisense); PGIS, GGAGCAAATGGCTGGAGAGTTAC (sense), ATCCGTCAGGGTTCAGGAATCG (antisense); GAPDH, CCCTCCAAAATCAAGTGGGG (sense), CGCCACAGTTTCCCGGAGGG (antisense). Thirty cycles of amplifications were performed with the annealing temperature of 50°C for COX-1, 55°C for GAPDH, 56°C for COX-2, and 63°C for mPGES-1 and PGIS. The GAPDH control was amplified with 25 cycles. The reaction products were subjected to 1% agarose gel electrophoresis and visualized with Gel documentation system (Ultraviolet Products Bioimaging Systems).

Immunoblotting

Immunoblotting was conducted, as previously described (28). When HRP-conjugated anti-mouse IgG was used as a secondary Ab, the membranes were incubated for 2 min with ECL solution (Amersham) and exposed to x-ray film.

Enzyme immunoassay to measure prostanoids

The produced amounts of PGE2, TXB2, and 6-keto-PGF1{alpha}, chemically stable metabolite of prostacyclin, were measured using enzyme immunoassay kits, as described previously (24).

T cell proliferation assay

T cells were isolated from tonsillar mononuclear cells by rosetting with SRBC; the resulting cells contained >98% CD3+ cells as analyzed by a FACSCalibur (BD Biosciences). T cells were cultured under the various conditions, as described in the figure legends. For the proliferation assay, 96-well flat-bottom microtiter plates were coated with 10 µg/ml 64.1 mAb, followed by incubation with T cells for the indicated periods of time. The cellular proliferation was measured by pulsing with 0.5 µCi of [3H]thymidine (PerkinElmer) during the last 12-h culture period. The cultures were harvested onto glass-fiber filters, and [3H]thymidine incorporation was measured by a liquid scintillation counter (Packard Instrument). In coculture experiments, isolated T cells were labeled with a CFSE kit (Invitrogen Life Technologies), according to the manufacturer’s instructions, and added with or without Con A or COX inhibitors to HK cells prepared 1 day earlier. Con A was used for T cell proliferation because it was not feasible to stimulate T cells with plate-bound anti-CD3 Abs due to the adherent HK cells. CFSE dilution in T cells was measured by counting 20,000 viable cells with a FACSCalibur.

T cell AICD

AICD was induced, as described by Porter and Malek (23). T cells were cultured in a 100-mm dish in the presence of Con A (5 µg/ml) and IL-2 (30 U/ml) for 3 days. Viable cells were purified by Ficoll density-gradient centrifugation and incubated with IL-2 alone for additional 48 h, followed by 12- to 24-h incubation with Con A in the presence or absence of prostanoids with or without HK cells. Viability of T cells was measured by direct cell counting after trypan blue staining or by a flow cytometer after staining with annexin V and PI (Trevigen) (13). Analysis was conducted on a FACSCalibur with the CellQuest software.

Statistical analysis

Statistical analysis and graphic presentation were conducted with GraphPad Prism 4.0 (GraphPad). Results are presented as means of triplicate assays plus SEM. The statistical significance of differences was determined by Student’s t test; p < 0.05 was considered significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Human FDC express PGES in addition to PGIS

Because mPGES-1 is responsible for the induction of PGE2 in inflammation (29), we investigated FDC expression of mPGES-1 by immunohistochemical staining of frozen tonsil tissues with anti-mPGES-1 and anti-PGIS. Anti-PGIS mAb 3C8 (30) stained FDC in the GC, but not extrafollicular areas (Fig. 1A). mAb 3C8 was demonstrated to be a better marker for FDC because, unlike other mAbs, it was not cross-reactive with other cells derived from hemopoietic stem cells (28, 30). In contrast to PGIS, PGES staining was not restricted to GCs, but extrafollicular area was also stained. The cells that were stained with anti-PGES Ab in the GC were FDC based upon the colocalization of anti-PGES and anti-PGIS mAbs that was expressed by a yellow coalescence of green (PGIS) and red (PGES) fluorescence. Under the higher magnification of a GC, the coalescence was clearly determined on a single cell level (Fig. 1A, lower panels). To extend the results obtained in situ with human tonsil and to perform intensive experiments, we conducted further investigations using HK cells. HK cells expressed PGES mainly in the cytoplasm and slightly in the nucleus. The expression levels were as intense as those of PGIS (Fig. 1B). The cytoplasmic localization of PGES was reproduced in flow cytometric analyses by a dramatic shift of staining fluorescence after membrane permeabilization of HK cells (data not shown). Isotype-matched control Abs did not stain either tonsil sections or HK cells. This observation was further confirmed by RT-PCR and immunoblotting (Fig. 1, C and D). These assays revealed further the expression of COX-1 and -2, upstream enzymes of PGES and PGIS, in unstimulated HK cells. Taken together, our results clearly argue that FDC are equipped with the enzyme system that produces the major PGs, PGE2 and PGI2, from substrate arachidonic acid.


Figure 1
View larger version (54K):
[in this window]
[in a new window]

 
FIGURE 1. Human FDC express COX, PGES, and PGIS. A, Frozen tonsil sections were double stained with anti-PGIS and anti-PGES Abs for analysis with a confocal microscope. Lower panels, Magnified pictures of a part of GC area. The scale bar, 100 µm. B, HK cells were cultured in chamber slides and stained with either anti-PGIS or anti-PGES Abs. The slides were observed with a confocal microscope after nuclear staining with PI. Scale bars, 50 µm. C, Expression of COX-1, COX-2, PGES, and PGIS in HK cells was examined by RT-PCR. GAPDH represents a positive control of the assay. D, Expression of COXs, PGES, and PGIS in unstimulated HK cells was confirmed by a chromogenic immunoblotting. β-Actin served as a loading control. The arrows indicate the specific location of each protein on the immunoblot. Representative of at least two similar experiments is shown.

 
HK cells regulate the expression of COX-2 and PGES with different kinetics

Because FDC reside in both primary and secondary follicles of the peripheral lymphoid tissues, they may participate in the inflammatory immune response by regulating production of various inflammatory molecules, including PGE2 and PGI2. We asked whether HK cells regulate protein expression of COXs, PGES, and PGIS by incubating with a variety of cytokines in chamber slides. The expression levels of COX-1 and PGIS did not change and were constitutive irrespective of cytokine stimuli (Fig. 2A), which is consistent with the previous results (26). However, COX-2 and PGES responded to TNF-{alpha}, TGF-β, and LPS, but not to other cytokines tested by significantly increasing their protein expression levels. Time-course experiments showed that COX-2 induction reached to the plateau between 4 and 12 h. In contrast, PGES induction required 18–48 h to reach the maximum (Fig. 2, B–D). The increase of COX-2 and PGES occurred in dose-responsive manners (Fig. 2, E and F). These results suggest that COX-2 and PGES expression is regulated to allow coordinate enzyme reactions.


Figure 2
View larger version (36K):
[in this window]
[in a new window]

 
FIGURE 2. COX-2 and PGES are inducible in HK cells with different kinetics, whereas COX-1 and PGIS levels are constitutive. A, HK cells (1 x 105 cells) were stabilized in culture in 60-mm dishes for 16 h and then stimulated for 8 h (COX-1 and COX-2) or 24 h (PGIS and PGES) with indicated cytokines, as described in Materials and Methods. The HK cell lysates were prepared for a chemiluminescence immunoblotting analysis. Time-course experiments were conducted by stimulating HK cells with TNF-{alpha} (50 ng/ml) (B), TGF-β (1 ng/ml) (C), or LPS (1 µg/ml) (D) up to 48 h. Dose-response experiments were conducted by culturing HK cells in the presence of different concentrations of TNF-{alpha}, TGF-β, or LPS for 8 h for the immunoblotting analysis of COX-1 and COX-2 (E) or 24 h for PGIS and PGES (F). Lysates of the stimulated cells were subjected to SDS-PAGE under the reducing condition. Equal protein loading was controlled by mAb against β-actin. These results were reproducible in at least three independent experiments.

 
The regulation of COX-2 and PGES correlates with production of PGE2 and PGI2

To determine whether the up-regulation of COX-2 and PGES indeed leads to increase of PGE2 and PGI2 production, we measured their concentrations in the culture supernatants of HK cells after stimulation with various cytokines. PGI2 secretion was assessed by measuring 6-keto-PGF1{alpha}, chemically stable metabolite of PGI2. Among the stimuli tested, TNF-{alpha}, TGF-β, and LPS again significantly increased production of PGE2 and PGI2 by 2- to 3-fold (Fig. 3A). The increase was specific because TXB2 production did not change in response to these cytokines. There are two isoforms of COX, COX-1 and COX-2, which are responsible for PGE2 and PGI2 production upstream of PGES and PGIS. We examined the impact of indomethacin and CAY10404, COX, and COX-2 inhibitor, respectively, on PGE2 and PGI2 production to determine the isoform that contributes to production of these PGs. Indomethacin and CAY10404 suppressed PGE2 and PGI2 production almost completely, both the constitutive and inducible secretion (Fig. 3, B and C). Indomethacin and CAY10404 did not affect the normal growth of HK cells (data not shown). These results indicate that COX-2 is responsible for PGE2 and PGI2 production in HK cells.


Figure 3
View larger version (19K):
[in this window]
[in a new window]

 
FIGURE 3. The regulation of COX-2 and PGES correlates with PGE2 and PGI2 production. A, HK cells (2 x 104 cells/well) were stabilized for 16 h before a further incubation with indicated cytokines for 48 h. The secretion of PGE2, PGI2, and TXB2 was measured by specific enzyme immunoassays. HK cells were incubated with 10 µM indomethacin or CAY10404 for 30 min, followed by a further incubation with TNF-{alpha} (50 ng/ml), TGF-β (1 ng/ml), or LPS (1 µg/ml) in the presence of indomethacin or CAY10404. The concentrations of PGE2 (B) and PGI2 (C) were measured, as described in Materials and Methods. An asterisk(s) indicates significantly different effect compared with control (*, p < 0.05; **, p < 0.01; ***, p < 0.001). Representative of three reproducible experiments is shown.

 
IL-4 and IL-13 inhibit the induced production of PGE2 and PGI2

Because synovial fibroblasts are related to FDC and anti-inflammatory cytokines inhibit TNF-{alpha}-induced PGE2 production (31, 32), we examined the effect of IL-4, IL-10, and IL-13 on the production of PGE2 and PGI2 that is stimulated by TNF-{alpha}, TGF-β, and LPS. The addition of the optimal concentration of IL-4 resulted in an almost complete abrogation of the stimulatory effect on PGE2 production (Fig. 4A). IL-4 also inhibited PGI2 secretion significantly, although the inhibition was partial (Fig. 4B). The optimal concentration of IL-4 inhibited TNF-{alpha}-induced PGI2 production by ~50%. Another member of IL-4 family cytokines, IL-13 exhibited a similar inhibitory activity on PGE2 production, although the efficacy of inhibition by IL-13 was lower. Furthermore, IL-13 did not inhibit PGI2 production consistently. In contrast to IL-4 and IL-13, IL-10 did not display any inhibitory effect on PGE2 and PGI2 production. These results argue that IL-4 specifically counteracts the stimulatory activity of TNF-{alpha}, TGF-β, and LPS in PGE2 and PGI2 production.


Figure 4
View larger version (17K):
[in this window]
[in a new window]

 
FIGURE 4. IL-4 inhibits production of PGE2 and PGI2 that is stimulated by TNF-{alpha}, TGF-β, or LPS. HK cells (2 x 104 cells/well) were cultured in the presence of IL-4 (100 U/ml), IL-10 (50 ng/ml), or IL-13 (5 ng/ml) for 24 h and incubated further with additional presence of TNF-{alpha} (50 ng/ml), TGF-β (1 ng/ml), or LPS (1 µg/ml) for 48 h. The concentrations of PGE2 (A) and PGI2 (B) in the culture supernatants were measured by enzyme immunoassays. An asterisk(s) indicates significantly different effect of the indicated comparison (*, p < 0.05; **, p < 0.01; ***, p < 0.001). Representative of three reproducible experiments is shown.

 
PGE2 and PGI2 analog repress proliferation and AICD of T cells

Because PGI2 inhibits T cell proliferation (24), we examined the effect of PGE2 on T cell proliferation to compare their effects in the same experimental system. Purified T cells were activated by immobilized anti-CD3 Abs, and their proliferation was assessed by [3H]thymidine incorporation. Due to the very unstable nature of PGI2 (33), we used beraprost, a more stable PGI2 analog. Consistent with our previous results, beraprost inhibited T cell proliferation significantly. The effect of PGE2 was not different from beraprost and inhibited T cell proliferation (Fig. 5A). The inhibition by PGE2 was greater than that by beraprost when compared at the same molar concentrations (Fig. 5B). For example, 30% inhibition was obtained with 10–6 M PGE2 compared with 19% with beraprost. Control PG 6-keto-PGF1{alpha} did not display any inhibitory effect on T cell proliferation, indicating the specificity of PGE2 and beraprost.


Figure 5
View larger version (17K):
[in this window]
[in a new window]

 
FIGURE 5. PGE2 and beraprost inhibit T cell proliferation. Tonsillar T cells (1 x 105 cells/well) were stimulated with immobilized anti-CD3 Abs in the presence or absence of 10 µM concentration of PGE2, beraprost, or 6-keto-PGF1{alpha} up to 84 h (A). Dose-response experiments (B) were obtained by culturing T cells for 72 h. An asterisk(s) indicates significantly different effect compared with 6-keto-PGF1{alpha} control (*, p < 0.05; **, p < 0.01; ***, p < 0.001). Representative of three reproducible experiments is shown.

 
Because T cells are thought to receive continued stimulation from cognate Ags in the light zone in which FDC dendrites are most well developed, we next asked whether PGE2 and PGI2 have any modulating effect on AICD of T cells. AICD was induced by culturing T cells with Con A and IL-2, followed by resting and then restimulating with Con A. The level of AICD was assessed by directly counting the number of viable cells. Both PGE2 and beraprost partially repressed the AICD in a dose-dependent manner (Fig. 6A). The partial inhibition was reproducible when the AICD was assessed by flow cytometric analysis after staining with annexin V and PI (Fig. 6B). The increase of annexin VPI viable cells occurred with concomitant decrease of annexin V+PI+ apoptotic cells. However, control PG 6-keto-PGF1{alpha} failed to show any modulating effect.


Figure 6
View larger version (25K):
[in this window]
[in a new window]

 
FIGURE 6. PGE2 and beraprost partially suppress the AICD of T cells. Purified tonsillar T cells (1 x 107 cells) were cultured in a 100-mm dish in the presence of Con A (5 µg/ml) and IL-2 (30 U/ml) for 3 days. Viable cells were purified by Ficoll density-gradient centrifugation and incubated with IL-2 alone for additional 48 h, followed by a 12 (A)- or 24 (B)-h incubation with Con A after washing in the presence or absence of indicated PGs (10–7 ~ 10–5 M). Viability of T cells was measured by direct cell counting after trypan blue staining (A) or by a flow cytometer after staining with annexin V and PI (B). {square}, Indicate annexin VPI live cells; {blacksquare}, indicate annexin V+PI+ apoptotic cells. An asterisk(s) indicates significantly different effect compared with AICD induction control (*, p < 0.05; **, p < 0.01; ***, p < 0.001). Representative of three reproducible experiments is shown.

 
HK cells recapitulate the inhibitory activities

To examine whether HK cells indeed inhibit the proliferation and AICD of T cells by producing PGs, we conducted coculture experiments. CFSE-labeled T cells remained unproliferative for 3 days when cultured in the presence or absence of HK cells (Fig. 7A and data not shown). The addition of Con A gave rise to a potent cellular proliferation by generating T cells that underwent cell divisions up to three times. The stimulatory effect of Con A was nullified by the addition of PGE2, confirming the results obtained with [3H]thymidine incorporation assays. Stimulation of T cells with Con A in the presence of HK cells resulted in increased numbers of T cells that underwent cell division. However, the addition of indomethacin or CAY10404 further enhanced T cell proliferation (40.8 vs 52.3 or 51.6%, respectively; Fig. 7B). In the AICD of T cells, the presence of HK cells significantly increased the numbers of viable T cells (60.5 vs 81.5%), which were reversed by the addition of indomethacin or CAY10404 (81.5 vs 64.5 or 72.3%, respectively; Fig. 7C). Collectively, these results suggest that PGs are responsible for the suppressive effect of HK cells on T cell proliferation and AICD.


Figure 7
View larger version (30K):
[in this window]
[in a new window]

 
FIGURE 7. HK cells inhibit the proliferation and AICD of T cells. A, CFSE-labeled tonsillar T cells (1 x 105 cells/well) were cultured in a 96-well plate with or without Con A (5 µg/ml), PGE2 (10 µM), indomethacin (10 µM), or CAY10404 (10 µM) in the presence or absence of HK cells (1 x 104 cells/well) that were prepared 1 day earlier. T cell proliferation was assessed after 72 h by analyzing the dilution of CFSE in the same number of viable cells (20,000 cells each condition) with a FACSCalibur. B, The percentages of T cells that underwent cell division as indicated by markers in A are presented. C, AICD of T cells was induced and measured, as described in Fig. 6. To induce accumulation of PGs in the supernatants, HK cells were prepared 48 h before the addition of T cells for the last 24-h coculture. An asterisk(s) indicates significantly different effect for each comparison (*, p < 0.05; **, p < 0.01; ***, p < 0.001). Representative of at least two reproducible experiments is shown.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The GC is the anatomic site for generating humoral immune responses to T cell-dependent Ags. Recent investigations using in vivo imaging techniques revealed its dynamic features of cellular interactions (11, 34), confirming the conventional view of the GC functions, but also challenging classical models for GC reactions that are mostly based on experimental results obtained with frozen snapshots of immunohistochemistry. For example, the physical boundaries of the secondary follicles were considered as obstacles that restrict free migration of lymphocytes between different anatomic compartments. However, the cellular tracks of centroblasts, centrocytes, and follicular mantle B cells are overlapping (11). These data underscore the important role of resident stromal cells in regulating the physiology of differentiating lymphocytes in the vicinity.

Our data show that human FDC express PGES and PGIS in addition to COXs. FDC are fully equipped to produce the major PGs, suggesting that FDC in response to stimuli such as bacterial infections (LPS or TNF-{alpha}) may enhance expression of COX-2 that provides a sufficient supply of the substrates for PGES and PGIS. PGI2 may be the major PG produced if PGES is not induced in a timely manner. Constitutive PGIS is available at high levels. Our data argue that FDC produce significant amounts of both PGE2 and PGI2 by a coordinate up-regulation of COX-2, followed by PGES. In addition to FDC and HK, a similar sequential induction of COX-2 and PGES was demonstrated in other cell types such as chondrocytes, synoviocytes, and vascular smooth muscle cells (35, 36, 37). These results suggest that PGs are involved in FDC-mediated inhibition of T cell proliferation, as reported previously (38), and specify the molecular identity of the responsible PGs. Furthermore, we show that PGE2 and PGI2 productions are regulated differentially in FDC. PGE2 production is controlled by proximal PGES, whereas PGI2 generation is determined by distal COX-2. In other words, the checkpoint of PGI2 production is substrate availability, whereas PGE2 production depends on enzyme availability as well.

FDC appear to participate in GC reactions by producing PGE2 and PGI2. These PGs displayed overlapping activities on the proliferation and AICD of T cells. However, the fact that expression of PGES is not limited to the GC, but expressed also in the extrafollicular areas, whereas that of PGIS is specific to the GC, argues that T cells may require both PGs for the optimal effect. In support of this speculation, the requirement of both PGE2 and PGI2 for the development of collagen-induced arthritis was demonstrated in knockout animals (39).

IL-4 is the cytokine that is consistently expressed by GC T cells (40, 41). We previously suggested that IL-4 plays an important role in the generation of memory B cells (12). In addition, IL-4 dramatically repressed production of PGE2 and PGI2 by HK cells. IL-4 appears to mediate cross-talk between FDC and T cells by regulating production of PGs. Because Butch et al. (38) demonstrated that CD54 and CD106 are involved in FDC inhibition of T cell proliferation, FDC-T cell interactions appear to involve both direct cell-to-cell contacts and diffusible cytokines. IL-4 abrogated TNF-{alpha}-mediated PGE2 induction in synovial fibroblasts, and COX-2 down-regulation was presented as a mechanism (32). In adenocarcinoma cells, IL-4 inhibited COX-2, but not PGES expression (42). We are currently investigating the molecular mechanism of the inhibitory effect of IL-4 on PG production in FDC.

Stimulation of T cells with Con A in the presence of HK cells resulted in increased numbers of T cells that underwent cell division. The unexpected increase of T cell proliferation on HK cells suggests that HK cells provide both negative and positive factors that affect T cell survival or proliferation. Positive factors such as the soluble mediator secreted by fibroblasts (43, 44) appear to dominate over the negative factors, including PGE2 and PGI2. The production of these negative factors by HK cells and their inhibitory activities are clearly demonstrated by the enhanced T cell proliferation when COX inhibitors were present in the cocultures.

Although our data highlight the role of extracellular factors in the regulation of GC T cell activities, it is worthwhile to note that GC T cells are intrinsically different from conventional T cells. CD57+ GC T cells express CTLA-4 (16, 45), suggesting another means of containing T cells by FDC and B cells. Cognate interactions with B cells may lead to negative signals in T cells through CTLA-4. In addition, regulatory T cell function of GC T cells has been recently demonstrated (45).

In conclusion, this study reveals FDC and T cell interactions in molecular terms unrecognized previously. FDC, by regulating production of PGs, may prevent T cell expansion in the nonproliferating area of the GC, and at the same time protect them from the cell death caused by frequent encounters with cognate Ags. Furthermore, this observation implies that there is a potential risk of perturbing physiological functions of FDC by the administration of specific inhibitors of COX or mPGES-1 during infection or vaccination.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by the Korea Research Foundation grant funded by the Korean government (Ministry of Education and Human Resources Development, Basic Research Promotion Fund) (KRF-2005-041-E00123) and the Vascular System Research Center grant from the Korea Science and Engineering Foundation. Back

2 Current address: Department of Chemistry and Biochemistry, Brigham Young University, Provo, UT 84602. Back

3 Address correspondence and reprint requests to Dr. Jongseon Choe, Department of Microbiology and Immunology, Kangwon National University College of Medicine, Chunchon, Kangwon 200-701, Republic of Korea. E-mail address: jchoe{at}kangwon.ac.kr Back

4 Abbreviations used in this paper: FDC, follicular dendritic cell; AICD, activation-induced cell death; COX, cyclooxygenase; GC, germinal center; mPGES-1, microsomal PGE synthase-1; PGES, PGE synthase; PGIS, PGI synthase; PI, propidium iodide; TXB2, thromboxane B2. Back

Received for publication May 17, 2007. Accepted for publication November 18, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Heinen, E., A. Bosseloir. 1994. Follicular dendritic cells: whose children?. Immunol. Today 15: 201-204. [Medline]
  2. MacLennan, I. C. M.. 1994. Germinal centers. Annu. Rev. Immunol. 12: 117-139. [Medline]
  3. Pasparakis, M., L. Alexopoulou, V. Episkopou, G. Kollias. 1996. Immune and inflammatory responses in TNF{alpha}-deficient mice: a critical requirement for TNF{alpha} in the formation of primary B cell follicles, follicular dendritic cell networks and germinal centers, and in the maturation of the humoral immune response. J. Exp. Med. 184: 1397-1411. [Abstract/Free Full Text]
  4. Fu, Y.-X., H. Molina, M. Matsumoto, G. Huang, J. Min, D. D. Chaplin. 1997. Lymphotoxin-{alpha} (LT{alpha}) supports development of splenic follicular structure that is required for IgG responses. J. Exp. Med. 185: 2111-2120. [Abstract/Free Full Text]
  5. Wang, Y., J. Wang, Y. Sun, Q. Wu, Y.-X. Fu. 2001. Complementary effects of TNF and lymphotoxin on the formation of germinal center and follicular dendritic cells. J. Immunol. 166: 330-337. [Abstract/Free Full Text]
  6. Liu, Y. J., G. D. Johnson, J. Gordon, I. C. M. MacLennan. 1992. Germinal centres in T-cell-dependent antibody responses. Immunol. Today 13: 17-21. [Medline]
  7. Feuillard, J., D. Taylor, M. Casamayor-Palleja, G. D. Johnson, I. C. M. MacLennan. 1995. Isolation and characteristics of tonsil centroblasts with reference to Ig class switching. Int. Immunol. 7: 121-130. [Abstract/Free Full Text]
  8. MacLennan, I. C. M., D. Gray. 1986. Antigen-driven selection of virgin and memory B cells. Immunol. Rev. 91: 61-85. [Medline]
  9. Jacob, J., G. Kelsoe. 1992. In situ studies of the primary immune response to (4-hydroxy-3-nitrophenyl) acetyl. II. A common clonal origin for periarteriolar lymphoid sheath-associated foci and germinal centers. J. Exp. Med. 176: 679-687. [Abstract/Free Full Text]
  10. Kelly, K. A., R. P. Bucy, M. H. Nahm. 1995. Germinal center T cells exhibit properties of memory helper T cells. Cell. Immunol. 163: 206-214. [Medline]
  11. Allen, C. D., T. Okada, H. L. Tang, J. C. Cyster. 2007. Imaging of germinal center selection events during affinity maturation. Science 315: 528-531. [Abstract/Free Full Text]
  12. Choe, J., H.-S. Kim, R. J. Armitage, Y. S. Choi. 1997. The functional role of BCR stimulation and IL-4 in the generation of human memory B cells from germinal center B cells. J. Immunol. 159: 3757-3766. [Abstract]
  13. Choe, J., L. Li, X. Zhang, C. D. Gregory, Y. S. Choi. 2000. Distinct role of follicular dendritic cells and T cells in the proliferation, differentiation, and apoptosis of a centroblast cell line, L3055. J. Immunol. 164: 56-63. [Abstract/Free Full Text]
  14. Tew, J. G., J. Wu, M. Fakher, A. K. Szakal, D. Qin. 2001. Follicular dendritic cells: beyond the necessity of T-cell help. Trends Immunol. 22: 361-367. [Medline]
  15. Nieuwenhuis, P., D. Opstelten. 1984. Functional anatomy of germinal centers. Am. J. Anat. 170: 421-435. [Medline]
  16. Castan, J., K. Tenner-Racz, P. Racz, B. Fleischer, B. M. Broker. 1997. Accumulation of CTLA-4 expressing T lymphocytes in the germinal centres of human lymphoid tissues. Immunology 90: 265-271. [Medline]
  17. Ruan, K.-H.. 2004. Advance in understanding the biosynthesis of prostacyclin and thromboxane A2 in the endoplasmic reticulum membrane via the cyclooxygenase pathway. Mini-Rev. Med. Chem. 4: 639-647.
  18. Cheng, Y., M. Wang, Y. Yu, J. Lawson, C. D. Funk, G. A. FitzGerald. 2006. Cyclooxygenases, microsomal prostaglandin E synthase-1, and cardiovascular function. J. Clin. Invest. 116: 1391-1399. [Medline]
  19. Vane, J., R. E. Corin. 2003. Prostacyclin: a vascular mediator. Eur. J. Vasc. Endovasc. Surg. 26: 571-578. [Medline]
  20. Harris, S. G., J. Padilla, L. Koumas, D. Ray, R. P. Phipps. 2002. Prostaglandins as modulators of immunity. Trends Immunol. 23: 144-150. [Medline]
  21. Rocca, B., G. A. FitzGerald. 2002. Cyclooxygenases and prostaglandins: shaping up the immune response. Int. Immunopharmacol. 2: 603-630. [Medline]
  22. Baratelli, F., Y. Lin, L. Zhu, S.-C. Yang, N. Heuze-Vourc’h, G. Zeng, K. Reckamp, M. Dohadwala, S. Sharma, S. M. Dubinett. 2005. Prostaglandin E2 induces FOXP3 gene expression and T regulatory cell function in human CD4+ T cells. J. Immunol. 175: 1483-1490. [Abstract/Free Full Text]
  23. Porter, B. O., T. R. Malek. 1999. Prostaglandin E2 inhibits T cell activation-induced apoptosis and Fas-mediated cellular cytotoxicity by blockade of Fas-ligand induction. Eur. J. Immunol. 29: 2360-2365. [Medline]
  24. Lee, I. Y., E.-M. Ko, S.-H. Kim, D.-I. Jeoung, J. Choe. 2005. Human follicular dendritic cells express prostacyclin synthase: a novel mechanism to control T cell numbers in the germinal center. J. Immunol. 175: 1658-1664. [Abstract/Free Full Text]
  25. Lee, I. Y., J. Lee, W. S. Park, E.-C. Nam, Y. O. Shin, J. Choe. 2001. 3C8, a new monoclonal antibody directed against a follicular dendritic cell line, HK. Immune Network 1: 26-31.
  26. Lee, I. Y., Y.-D. Bae, D.-I. Jeoung, D. Kang, C.-H. Park, S.-H. Kim, J. Choe. 2007. Prostacyclin production is not controlled by prostacyclin synthase but by cyclooxygenase-2 in human follicular dendritic cell line, HK. Mol. Immunol. 44: 3168-3172. [Medline]
  27. Kim, H.-S., X. Zhang, Y. S. Choi. 1994. Activation and proliferation of follicular dendritic cell-like cells by activated T lymphocytes. J. Immunol. 153: 2951-2961. [Abstract]
  28. Lee, I. Y., K. S. Ha, J. Choe. 2003. 3C8 antigen is a novel protein expressed by human follicular dendritic cells. Biochem. Biophys. Res. Commun. 303: 624-630. [Medline]
  29. Jakobsson, P. J., S. Thoren, R. Morgenstern, B. Samuelsson. 1999. Identification of human prostaglandin E synthase: a microsomal, glutathione-dependent, inducible enzyme, constituting a potential novel drug target. Proc. Natl. Acad. Sci. USA 96: 7220-7225. [Abstract/Free Full Text]
  30. Lee, I. Y., J. Choe. 2003. Human follicular dendritic cells and fibroblasts share the 3C8 antigen. Biochem. Biophys. Res. Commun. 304: 701-707. [Medline]
  31. Lindhout, E., M. van Eijk, M. van Pel, J. Lindeman, H. Dinant, C. de Groot. 1999. Fibroblast-like synoviocytes from rheumatoid arthritis patients have intrinsic properties of follicular dendritic cells. J. Immunol. 162: 5949-5956. [Abstract/Free Full Text]
  32. Alaaeddine, N., J. A. Di Battista, J.-P. Pelletier, K. Kiansa, J.-M. Cloutier, J. Martel-Pelletier. 1999. Inhibition of tumor necrosis factor {alpha}-induced prostaglandin E2 production by the antiinflammatory cytokines interleukin-4, interleukin-10, and interleukin-13 in osteoarthritic synovial fibroblasts: distinct targeting in the signaling pathways. Arthritis Rheum. 42: 710-718. [Medline]
  33. Pola, R., E. Gaetani, A. Flex, T. R. Aprahamian, M. Bosch-Marce, D. W. Losordo, R. C. Smith, P. Pola. 2004. Comparative analysis of the in vivo angiogenic properties of stable prostacyclin analogs: a possible role for peroxisome proliferator-activated receptors. J. Mol. Cell. Cardiol. 36: 363-370. [Medline]
  34. Schwickert, T. A., R. L. Lindquist, G. Shakhar, G. Livshits, D. Skokos, M. H. Kosco-Vilbois, M. L. Dustin, M. C. Nussenzweig. 2007. In vivo imaging of germinal centres reveals a dynamic open structure. Nature 446: 83-87. [Medline]
  35. Kojima, F., H. Naraba, S. Miyamoto, M. Beppu, H. Aoki, S. Kawai. 2004. Membrane-associated prostaglandin E synthase-1 is up-regulated by proinflammatory cytokines in chondrocytes from patients with osteoarthritis. Arthritis Res. Ther. 6: R355-R365. [Medline]
  36. Kudo, K., M. Murakami. 2005. Prostaglandin E synthase, a terminal enzyme for prostaglandin E2 biosynthesis. J. Biochem. Mol. Biol. 38: 633-638. [Medline]
  37. Camacho, M., E. Gerboles, J.-R. Escudero, R. Anton, X. Garcia-Moll, L. Vila. 2007. Microsomal PGE synthase-1, which is not coupled to particular COX-isoenzyme, is essential for PGE2 biosynthesis in vascular smooth muscle cells. J. Thromb. Haemost. 5: 1411-1419. [Medline]
  38. Butch, A. W., K. A. Kelly, M. S. Willbanks, X. Yu. 1999. Human follicular dendritic cells inhibit superantigen-induced T-cell proliferation by distinct mechanisms. Blood 94: 216-224. [Abstract/Free Full Text]
  39. Honda, T., E. Segi-Nishida, Y. Miyachi, S. Narumiya. 2006. Prostacyclin-IP signaling and prostaglandin E2-EP2/EP4 signaling both mediate joint inflammation in mouse collagen-induced arthritis. J. Exp. Med. 203: 325-335. [Abstract/Free Full Text]
  40. Butch, A. W., G.-H. Chung, J. W. Hoffman, M. H. Nahm. 1993. Cytokine expression by germinal center cells. J. Immunol. 150: 39-47. [Abstract]
  41. Yamada, K., M. Yamakawa, Y. Imai, M. Tsukamoto. 1997. Expression of cytokine receptors on follicular dendritic cells. Blood 90: 4832-4841. [Abstract/Free Full Text]
  42. Cui, X., S.-C. Yang, S. Sharma, N. Heuze-Vourc’h, S. M. Dubinett. 2006. IL-4 regulates COX-2 and PGE2 production in human non-small cell lung cancer. Biochem. Biophys. Res. Commun. 343: 995-1001. [Medline]
  43. Gombert, W., N. J. Borthwick, D. L. Wallace, H. Hyde, M. Bofill, D. Pilling, P. C. L. Beverley, G. Janossy, M. Salmon, A. N. Akbar. 1996. Fibroblasts prevent apoptosis of IL-2-deprived T cells without inducing proliferation: a selective effect on Bcl-xL expression. Immunology 89: 397-404. [Medline]
  44. Hyde, H., N. J. Borthwick, G. Janossy, M. Salmon, A. N. Akbar. 1997. Up-regulation of intracellular glutathione by fibroblast-derived factor(s): enhanced survival of activated T cells in the presence of low Bcl-2. Blood 89: 2453-2460. [Abstract/Free Full Text]
  45. Marinova, E., S. Han, B. Zheng. 2007. Germinal center helper T cells are dual functional regulatory cells with suppressive activity to conventional CD4+ T cells. J. Immunol. 178: 5010-5017. [Abstract/Free Full Text]

Related articles in The JI:

IN THIS ISSUE

The JI 2008 180: 1291-1292. [Full Text]  




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, I. Y.
Right arrow Articles by Choe, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, I. Y.
Right arrow Articles by Choe, J.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*INDOMETHACIN


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS