|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




,
* Department of Microbiology and Immunology, College of Medicine,
Vascular System Research Center, and
Research Institute of Life Sciences, Kangwon National University, Chunchon, Korea; and
Department of Pathology, Asan Medical Center, University of Ulsan College of Medicine, Seoul, Korea
| Abstract |
|---|
|
|
|---|
, TGF-β, and LPS, protein expression of cyclooxygenase (COX)-2 and downstream PGE synthase was up-regulated with coordinate kinetics, whereas COX-1 and PGIS were constitutively expressed. The increase of these enzymes was reflected in actual production of PGE2 and PGI2. Interestingly, IL-4 almost completely abrogated the stimulatory activity of TNF-
, TGF-β, and LPS in PG production. Furthermore, the up-regulation of PGE2 and PGI2 production was markedly down-regulated by indomethacin and a selective COX-2 inhibitor. PGI2 analog and PGE2 inhibited proliferation and AICD of T cells in dose- and time-dependent manners. Finally, coculture experiments revealed that HK cells indeed inhibit proliferation and AICD of T cells. Put together, these results show an unrecognized pathway of FDC and T cell interactions and differential mechanisms for PGE2 and PGI2 production, suggesting an important implication for development and use of anti-inflammatory drugs. | Introduction |
|---|
|
|
|---|
10% of total cells (15). Castan et al. (16) demonstrated that T cells do not undergo active proliferation in the GC. Another perplexing puzzle is how T cells are insensitive to activation-induced cell death (AICD), considering the physiological milieu wherein they are exposed to continued antigenic insults. PGs are lipid mediators derived from endogenous archidonic acids that are released from the cell membrane phospholipids in response to various stimuli, including inflammatory ones. Arachidonic acids are converted to PGs through the sequential enzyme actions of cyclooxygenases (COXs) and terminal PG synthases whose expression is cell specific (17). As well as the well-known activities of the major PGs, PGE2 and PGI2 as inflammatory and vascular mediators, respectively (18, 19), the importance of these molecules, particularly PGE2, in immunity is becoming recognized (20, 21). PGE2 inhibits T cell proliferation (22), protects from TCR-mediated AICD (23), and deviates T cell responses toward Th2 by inhibiting the production of Th1 cytokines (21). Furthermore, PGE2 exhibits numerous roles in the development and activities of B cells, dendritic cells, and macrophages (20). We have recently reported that human FDC and an FDC cell line, HK, strongly express functionally active PGI synthase (PGIS) (24).
Based upon the data presented by us and other research groups, we hypothesized that FDC suppress the proliferation and AICD of T cells in the GC by paracrine secretion of PGE2 and PGI2. To test this possibility, we examined the expression and regulation of the enzymes responsible for the production of these PGs by using human tonsil sections and HK cells. Our results show that FDC and HK cells express COXs and PGE synthase (PGES) in addition to PGIS; these enzymes are differentially regulated by inflammatory stimuli, and PGI2 analog, PGE2; and HK cells inhibit the proliferation and AICD of T cells.
| Materials and Methods |
|---|
|
|
|---|
The mAb against PGIS, clone 3C8, was developed, as previously described (25), and labeled with biotin, according to the manufacturers instructions (Pierce). Other mAbs were against human microsomal PGES (mPGES)-1, COX-1, COX-2 (Cayman Chemical), β-actin (Sigma-Aldrich), and CD3 (clone 64.1; Y. Choi, Ochsner Clinic Foundation, New Orleans, LA). Unconjugated mouse IgG1, propidium iodide (PI), Con A, PGE2, and LPS were obtained from Sigma-Aldrich. Biotin-conjugated mouse IgG1 and streptavidin-FITC were purchased from DakoCytomation. Goat anti-mouse IgG FITC, goat anti-mouse IgG PE, alkaline phosphatase-conjugated goat anti-mouse IgG, and HRP-conjugated goat anti-mouse IgG were obtained from Jackson ImmunoResearch Laboratories. Indomethacin, CAY10404, beraprost, and enzyme immunoassay kits for PGE2, 6-keto-PGF1
, and thromboxane B2 (TXB2) were purchased from Cayman Chemical. Recombinant IL-1β, IL-8, IL-13, TNF-
, TGF-β, and IL-10 were purchased from R&D Systems. IL-2 was obtained from Hoffmann-LaRoche. Recombinant IL-4 and IL-6 were prepared in our laboratory (26).
Confocal scanning fluorescence microscopy
Cryostat sections of human tonsils were fixed in cold acetone for 10 min. The sections were rehydrated in PBS and blocked for 10 min with protein block (DakoCytomation). The slides were double stained first with anti-PGES Ab, followed by PE-labeled goat anti-mouse IgG Ab. Unoccupied Fab sites of goat Abs were blocked with mouse IgG1 Abs. The stained slides were incubated with biotin-conjugated 3C8 or biotin-conjugated mouse IgG1 Abs and then with FITC-conjugated streptavidin. The coverslips were mounted onto slides using fluorescent mounting medium (DakoCytomation). The relative positional distribution of the two fluorochromes was visualized and scanned using a confocal laser microscope (Fluoview FV300; Olympus). HK cells cultured in chamber slides were fixed with cold acetone for 10 min and incubated with 3C8 or anti-PGES Abs for 1 h at room temperature. After wash, the slides were incubated with FITC-conjugated goat anti-mouse Ig and PI for nuclear staining.
Culture of HK cells
HK cells were prepared and maintained, as described by Kim et al. (27). HK cells were maintained in RPMI 1640 (Invitrogen Life Technologies) supplemented with 10% FBS, 2 mM L-glutamine (Invitrogen Life Technologies), and 80 µg/ml gentamicin (Sigma-Aldrich). To examine the regulation of COX, PGES, and PGIS, HK cells were cultured in the presence of IL-1β (10 ng/ml), IL-2 (100 U/ml), IL-4 (100 U/ml), IL-6 (30 ng/ml), IL-8 (10 ng/ml), IL-10 (50 ng/ml), IL-13 (5 ng/ml), TNF-
(50 ng/ml), TGF-β (1 ng/ml), or LPS (1 µg/ml).
RT-PCR
Total RNA was extracted from HK cells using the Easy-blue RNA extraction kit (Intron Biotechnology). Reverse transcription was conducted using the GeneAmp RNA PCR kit (Applied Biosystems) in 20 µl of mixture containing 2 U of RNase inhibitor, 1 mM dNTP, 25 µM oligo(dT), and 2.5 U of reverse transcriptase. After denaturation for 5 min at 65°C, the reaction was conducted at 42°C for 45 min, followed by the inactivation at 99°C for 5 min. DNA amplification was performed using the DFS-TaqDNA polymerase (Bioron) in a 25 µl mixture of 100 ng of cDNA, 0.4 µM each primer, 0.4 mM dNTPs (Promega), 0.625 U of DNA polymerase, and PCR buffer (Bioron). The primer sets used are as follows: COX-1, TTACACTCGTATTCTGCCCT (sense), ATTGTCTCCATAAATGTGGC (antisense); COX-2, TTCAAATGAGATTGTGGAAAAATTGCT (sense), AGATCATCTCTGCCTGAGTATCTT (antisense); mPGES-1, ATGCCTGCCCACAGCCTG (sense), TCACAGGTGGCGGGCCGC (antisense); PGIS, GGAGCAAATGGCTGGAGAGTTAC (sense), ATCCGTCAGGGTTCAGGAATCG (antisense); GAPDH, CCCTCCAAAATCAAGTGGGG (sense), CGCCACAGTTTCCCGGAGGG (antisense). Thirty cycles of amplifications were performed with the annealing temperature of 50°C for COX-1, 55°C for GAPDH, 56°C for COX-2, and 63°C for mPGES-1 and PGIS. The GAPDH control was amplified with 25 cycles. The reaction products were subjected to 1% agarose gel electrophoresis and visualized with Gel documentation system (Ultraviolet Products Bioimaging Systems).
Immunoblotting
Immunoblotting was conducted, as previously described (28). When HRP-conjugated anti-mouse IgG was used as a secondary Ab, the membranes were incubated for 2 min with ECL solution (Amersham) and exposed to x-ray film.
Enzyme immunoassay to measure prostanoids
The produced amounts of PGE2, TXB2, and 6-keto-PGF1
, chemically stable metabolite of prostacyclin, were measured using enzyme immunoassay kits, as described previously (24).
T cell proliferation assay
T cells were isolated from tonsillar mononuclear cells by rosetting with SRBC; the resulting cells contained >98% CD3+ cells as analyzed by a FACSCalibur (BD Biosciences). T cells were cultured under the various conditions, as described in the figure legends. For the proliferation assay, 96-well flat-bottom microtiter plates were coated with 10 µg/ml 64.1 mAb, followed by incubation with T cells for the indicated periods of time. The cellular proliferation was measured by pulsing with 0.5 µCi of [3H]thymidine (PerkinElmer) during the last 12-h culture period. The cultures were harvested onto glass-fiber filters, and [3H]thymidine incorporation was measured by a liquid scintillation counter (Packard Instrument). In coculture experiments, isolated T cells were labeled with a CFSE kit (Invitrogen Life Technologies), according to the manufacturers instructions, and added with or without Con A or COX inhibitors to HK cells prepared 1 day earlier. Con A was used for T cell proliferation because it was not feasible to stimulate T cells with plate-bound anti-CD3 Abs due to the adherent HK cells. CFSE dilution in T cells was measured by counting 20,000 viable cells with a FACSCalibur.
T cell AICD
AICD was induced, as described by Porter and Malek (23). T cells were cultured in a 100-mm dish in the presence of Con A (5 µg/ml) and IL-2 (30 U/ml) for 3 days. Viable cells were purified by Ficoll density-gradient centrifugation and incubated with IL-2 alone for additional 48 h, followed by 12- to 24-h incubation with Con A in the presence or absence of prostanoids with or without HK cells. Viability of T cells was measured by direct cell counting after trypan blue staining or by a flow cytometer after staining with annexin V and PI (Trevigen) (13). Analysis was conducted on a FACSCalibur with the CellQuest software.
Statistical analysis
Statistical analysis and graphic presentation were conducted with GraphPad Prism 4.0 (GraphPad). Results are presented as means of triplicate assays plus SEM. The statistical significance of differences was determined by Students t test; p < 0.05 was considered significant.
| Results |
|---|
|
|
|---|
Because mPGES-1 is responsible for the induction of PGE2 in inflammation (29), we investigated FDC expression of mPGES-1 by immunohistochemical staining of frozen tonsil tissues with anti-mPGES-1 and anti-PGIS. Anti-PGIS mAb 3C8 (30) stained FDC in the GC, but not extrafollicular areas (Fig. 1A). mAb 3C8 was demonstrated to be a better marker for FDC because, unlike other mAbs, it was not cross-reactive with other cells derived from hemopoietic stem cells (28, 30). In contrast to PGIS, PGES staining was not restricted to GCs, but extrafollicular area was also stained. The cells that were stained with anti-PGES Ab in the GC were FDC based upon the colocalization of anti-PGES and anti-PGIS mAbs that was expressed by a yellow coalescence of green (PGIS) and red (PGES) fluorescence. Under the higher magnification of a GC, the coalescence was clearly determined on a single cell level (Fig. 1A, lower panels). To extend the results obtained in situ with human tonsil and to perform intensive experiments, we conducted further investigations using HK cells. HK cells expressed PGES mainly in the cytoplasm and slightly in the nucleus. The expression levels were as intense as those of PGIS (Fig. 1B). The cytoplasmic localization of PGES was reproduced in flow cytometric analyses by a dramatic shift of staining fluorescence after membrane permeabilization of HK cells (data not shown). Isotype-matched control Abs did not stain either tonsil sections or HK cells. This observation was further confirmed by RT-PCR and immunoblotting (Fig. 1, C and D). These assays revealed further the expression of COX-1 and -2, upstream enzymes of PGES and PGIS, in unstimulated HK cells. Taken together, our results clearly argue that FDC are equipped with the enzyme system that produces the major PGs, PGE2 and PGI2, from substrate arachidonic acid.
|
Because FDC reside in both primary and secondary follicles of the peripheral lymphoid tissues, they may participate in the inflammatory immune response by regulating production of various inflammatory molecules, including PGE2 and PGI2. We asked whether HK cells regulate protein expression of COXs, PGES, and PGIS by incubating with a variety of cytokines in chamber slides. The expression levels of COX-1 and PGIS did not change and were constitutive irrespective of cytokine stimuli (Fig. 2A), which is consistent with the previous results (26). However, COX-2 and PGES responded to TNF-
, TGF-β, and LPS, but not to other cytokines tested by significantly increasing their protein expression levels. Time-course experiments showed that COX-2 induction reached to the plateau between 4 and 12 h. In contrast, PGES induction required 18–48 h to reach the maximum (Fig. 2, B–D). The increase of COX-2 and PGES occurred in dose-responsive manners (Fig. 2, E and F). These results suggest that COX-2 and PGES expression is regulated to allow coordinate enzyme reactions.
|
To determine whether the up-regulation of COX-2 and PGES indeed leads to increase of PGE2 and PGI2 production, we measured their concentrations in the culture supernatants of HK cells after stimulation with various cytokines. PGI2 secretion was assessed by measuring 6-keto-PGF1
, chemically stable metabolite of PGI2. Among the stimuli tested, TNF-
, TGF-β, and LPS again significantly increased production of PGE2 and PGI2 by 2- to 3-fold (Fig. 3A). The increase was specific because TXB2 production did not change in response to these cytokines. There are two isoforms of COX, COX-1 and COX-2, which are responsible for PGE2 and PGI2 production upstream of PGES and PGIS. We examined the impact of indomethacin and CAY10404, COX, and COX-2 inhibitor, respectively, on PGE2 and PGI2 production to determine the isoform that contributes to production of these PGs. Indomethacin and CAY10404 suppressed PGE2 and PGI2 production almost completely, both the constitutive and inducible secretion (Fig. 3, B and C). Indomethacin and CAY10404 did not affect the normal growth of HK cells (data not shown). These results indicate that COX-2 is responsible for PGE2 and PGI2 production in HK cells.
|
Because synovial fibroblasts are related to FDC and anti-inflammatory cytokines inhibit TNF-
-induced PGE2 production (31, 32), we examined the effect of IL-4, IL-10, and IL-13 on the production of PGE2 and PGI2 that is stimulated by TNF-
, TGF-β, and LPS. The addition of the optimal concentration of IL-4 resulted in an almost complete abrogation of the stimulatory effect on PGE2 production (Fig. 4A). IL-4 also inhibited PGI2 secretion significantly, although the inhibition was partial (Fig. 4B). The optimal concentration of IL-4 inhibited TNF-
-induced PGI2 production by
50%. Another member of IL-4 family cytokines, IL-13 exhibited a similar inhibitory activity on PGE2 production, although the efficacy of inhibition by IL-13 was lower. Furthermore, IL-13 did not inhibit PGI2 production consistently. In contrast to IL-4 and IL-13, IL-10 did not display any inhibitory effect on PGE2 and PGI2 production. These results argue that IL-4 specifically counteracts the stimulatory activity of TNF-
, TGF-β, and LPS in PGE2 and PGI2 production.
|
Because PGI2 inhibits T cell proliferation (24), we examined the effect of PGE2 on T cell proliferation to compare their effects in the same experimental system. Purified T cells were activated by immobilized anti-CD3 Abs, and their proliferation was assessed by [3H]thymidine incorporation. Due to the very unstable nature of PGI2 (33), we used beraprost, a more stable PGI2 analog. Consistent with our previous results, beraprost inhibited T cell proliferation significantly. The effect of PGE2 was not different from beraprost and inhibited T cell proliferation (Fig. 5A). The inhibition by PGE2 was greater than that by beraprost when compared at the same molar concentrations (Fig. 5B). For example, 30% inhibition was obtained with 10–6 M PGE2 compared with 19% with beraprost. Control PG 6-keto-PGF1
did not display any inhibitory effect on T cell proliferation, indicating the specificity of PGE2 and beraprost.
|
failed to show any modulating effect.
|
To examine whether HK cells indeed inhibit the proliferation and AICD of T cells by producing PGs, we conducted coculture experiments. CFSE-labeled T cells remained unproliferative for 3 days when cultured in the presence or absence of HK cells (Fig. 7A and data not shown). The addition of Con A gave rise to a potent cellular proliferation by generating T cells that underwent cell divisions up to three times. The stimulatory effect of Con A was nullified by the addition of PGE2, confirming the results obtained with [3H]thymidine incorporation assays. Stimulation of T cells with Con A in the presence of HK cells resulted in increased numbers of T cells that underwent cell division. However, the addition of indomethacin or CAY10404 further enhanced T cell proliferation (40.8 vs 52.3 or 51.6%, respectively; Fig. 7B). In the AICD of T cells, the presence of HK cells significantly increased the numbers of viable T cells (60.5 vs 81.5%), which were reversed by the addition of indomethacin or CAY10404 (81.5 vs 64.5 or 72.3%, respectively; Fig. 7C). Collectively, these results suggest that PGs are responsible for the suppressive effect of HK cells on T cell proliferation and AICD.
|
| Discussion |
|---|
|
|
|---|
Our data show that human FDC express PGES and PGIS in addition to COXs. FDC are fully equipped to produce the major PGs, suggesting that FDC in response to stimuli such as bacterial infections (LPS or TNF-
) may enhance expression of COX-2 that provides a sufficient supply of the substrates for PGES and PGIS. PGI2 may be the major PG produced if PGES is not induced in a timely manner. Constitutive PGIS is available at high levels. Our data argue that FDC produce significant amounts of both PGE2 and PGI2 by a coordinate up-regulation of COX-2, followed by PGES. In addition to FDC and HK, a similar sequential induction of COX-2 and PGES was demonstrated in other cell types such as chondrocytes, synoviocytes, and vascular smooth muscle cells (35, 36, 37). These results suggest that PGs are involved in FDC-mediated inhibition of T cell proliferation, as reported previously (38), and specify the molecular identity of the responsible PGs. Furthermore, we show that PGE2 and PGI2 productions are regulated differentially in FDC. PGE2 production is controlled by proximal PGES, whereas PGI2 generation is determined by distal COX-2. In other words, the checkpoint of PGI2 production is substrate availability, whereas PGE2 production depends on enzyme availability as well.
FDC appear to participate in GC reactions by producing PGE2 and PGI2. These PGs displayed overlapping activities on the proliferation and AICD of T cells. However, the fact that expression of PGES is not limited to the GC, but expressed also in the extrafollicular areas, whereas that of PGIS is specific to the GC, argues that T cells may require both PGs for the optimal effect. In support of this speculation, the requirement of both PGE2 and PGI2 for the development of collagen-induced arthritis was demonstrated in knockout animals (39).
IL-4 is the cytokine that is consistently expressed by GC T cells (40, 41). We previously suggested that IL-4 plays an important role in the generation of memory B cells (12). In addition, IL-4 dramatically repressed production of PGE2 and PGI2 by HK cells. IL-4 appears to mediate cross-talk between FDC and T cells by regulating production of PGs. Because Butch et al. (38) demonstrated that CD54 and CD106 are involved in FDC inhibition of T cell proliferation, FDC-T cell interactions appear to involve both direct cell-to-cell contacts and diffusible cytokines. IL-4 abrogated TNF-
-mediated PGE2 induction in synovial fibroblasts, and COX-2 down-regulation was presented as a mechanism (32). In adenocarcinoma cells, IL-4 inhibited COX-2, but not PGES expression (42). We are currently investigating the molecular mechanism of the inhibitory effect of IL-4 on PG production in FDC.
Stimulation of T cells with Con A in the presence of HK cells resulted in increased numbers of T cells that underwent cell division. The unexpected increase of T cell proliferation on HK cells suggests that HK cells provide both negative and positive factors that affect T cell survival or proliferation. Positive factors such as the soluble mediator secreted by fibroblasts (43, 44) appear to dominate over the negative factors, including PGE2 and PGI2. The production of these negative factors by HK cells and their inhibitory activities are clearly demonstrated by the enhanced T cell proliferation when COX inhibitors were present in the cocultures.
Although our data highlight the role of extracellular factors in the regulation of GC T cell activities, it is worthwhile to note that GC T cells are intrinsically different from conventional T cells. CD57+ GC T cells express CTLA-4 (16, 45), suggesting another means of containing T cells by FDC and B cells. Cognate interactions with B cells may lead to negative signals in T cells through CTLA-4. In addition, regulatory T cell function of GC T cells has been recently demonstrated (45).
In conclusion, this study reveals FDC and T cell interactions in molecular terms unrecognized previously. FDC, by regulating production of PGs, may prevent T cell expansion in the nonproliferating area of the GC, and at the same time protect them from the cell death caused by frequent encounters with cognate Ags. Furthermore, this observation implies that there is a potential risk of perturbing physiological functions of FDC by the administration of specific inhibitors of COX or mPGES-1 during infection or vaccination.
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by the Korea Research Foundation grant funded by the Korean government (Ministry of Education and Human Resources Development, Basic Research Promotion Fund) (KRF-2005-041-E00123) and the Vascular System Research Center grant from the Korea Science and Engineering Foundation. ![]()
2 Current address: Department of Chemistry and Biochemistry, Brigham Young University, Provo, UT 84602. ![]()
3 Address correspondence and reprint requests to Dr. Jongseon Choe, Department of Microbiology and Immunology, Kangwon National University College of Medicine, Chunchon, Kangwon 200-701, Republic of Korea. E-mail address: jchoe{at}kangwon.ac.kr ![]()
4 Abbreviations used in this paper: FDC, follicular dendritic cell; AICD, activation-induced cell death; COX, cyclooxygenase; GC, germinal center; mPGES-1, microsomal PGE synthase-1; PGES, PGE synthase; PGIS, PGI synthase; PI, propidium iodide; TXB2, thromboxane B2. ![]()
Received for publication May 17, 2007. Accepted for publication November 18, 2007.
| References |
|---|
|
|
|---|
-deficient mice: a critical requirement for TNF
in the formation of primary B cell follicles, follicular dendritic cell networks and germinal centers, and in the maturation of the humoral immune response. J. Exp. Med. 184: 1397-1411.
(LT
) supports development of splenic follicular structure that is required for IgG responses. J. Exp. Med. 185: 2111-2120.
-induced prostaglandin E2 production by the antiinflammatory cytokines interleukin-4, interleukin-10, and interleukin-13 in osteoarthritic synovial fibroblasts: distinct targeting in the signaling pathways. Arthritis Rheum. 42: 710-718. [Medline]Related articles in The JI:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |