|
|
||||||||



* Human Anatomy Section and
Histology Section, Department of Experimental Medicine, University of Genoa, Genova, Italy; and
Division of Renal Medicine, Mount Sinai School of Medicine, New York, NY 10029
| Abstract |
|---|
|
|
|---|
and KKXX consensus sequences, respectively, are responsible for impairing UL18 surface expression. However, the presence of the whole HCMV genome, granted by HCMV infection of human fibroblasts, restored surface expression of either UL18 or chimeric proteins carrying the UL18 cytoplasmic tail, starting from the third day after infection. It is of note that the two motifs responsible for cytoplasmic retention are identical in all 17 HCMV strains examined. We disclosed a control mechanism used by the HCMV to regulate the availability of UL18 on the infected-cell surface to allow interaction with its ligand on T and NK cells. | Introduction |
|---|
|
|
|---|
One part of this array is UL18. UL18 displays a structural homology with HLA class I molecules as well as a significant amino acid identity (11). It associates with β2-microglobulin (12), and the stability of the trimeric complex depends on the presence of a loaded peptide (13). It is a late HCMV Ag in that its transcription occurs from 54 to at least 120 h postinfection (14) and is not essential for HCMV replication (15).
The receptor for UL18 is CD85j/LIR-1/ILT2 (CD85j), a molecule of the Ig superfamily (16). It is a transmembrane molecule with four cytoplasmic ITIMs that mediate transduction of inhibitory signals (17), and it is expressed by lymphoid and myelomonocytic cells (18, 19, 20). In addition to UL18, CD85j recognizes broadly MHC class I molecules (16, 21).
When CD85j is engaged by specific cross-linking Abs or by HLA class I molecules, it delivers negative signals to NK and T lymphocytes (18, 19, 22, 23, 24).
Instead, when CD85j is bound by UL18, its inhibitory activity is a matter of debate. NK cell-mediated lysis was seen to be inhibited (4, 25, 26) or increased (27), depending on the experimental setting. With respect to T lymphocytes, two studies have addressed the effect of CD85j engagement by UL18, and both show that UL18 mediates an activating signal, in one case through its interaction with CD85j (28), and in the other case by still unexplained mechanisms (29). Whatever the mechanism, the UL18–CD85j interaction certainly plays a pivotal role in the immune response to HCMV infection. CD85j displays an affinity for UL18 that is >1000-fold higher than for cellular MHC class I molecules (30, 31), and its expression is up-regulated on HCMV-specific T cells (32, 33) and on T and NK cells of lung-transplanted patients later developing HCMV disease (29, 34). Binding of CD85j to UL18 requires surface expression of the viral protein. However, we and other groups (35) have observed that UL18 accumulates in the cytoplasm and displays no detectable surface immunofluorescence in in vitro cell models, such as HCMV-infected fibroblasts, UL18-transfected tumor cell lines, or UL18-transduced fibroblasts. Only in cases of high multiplicity of infection (MOI) by HCMV or UL18-carrying adenovirus or vaccinia virus has spillover of UL18 from the cytoplasm to the cell surface been observed (28, 35, 36).
Accordingly, we focused our attention on regulatory mechanisms that control trafficking and surface expression of UL18. We searched for domains on UL18 that could be responsible for intracellular retention and verified whether their interplay with virus-encoded genes may regulate UL18 surface expression.
| Materials and Methods |
|---|
|
|
|---|
HeLa, HEK, COS-7, and Sp2/0 cell lines were obtained from the American Type Culture Collection and maintained in RPMI 1640 medium with GlutaMAX (Invitrogen) supplemented with penicillin, streptomycin, and 10% FCS (Invitrogen).
The human foreskin fibroblast (HFF) line Hs-27 (kindly provided by L. Lanfranconi, IFOM-IEO, Milan, Italy) was cultured in DMEM supplemented with 20% FCS and used at the 21st passage.
Transfections were performed using Lipofectamine 2000 (Invitrogen) according to the manufacturers instructions. To obtain stable transfectants, antibiotics were added 24 h post transfection: 500 µg/ml G418 (Invitrogen) for pIRESneo, 1 µg/ml puromycin (Sigma-Aldrich) for pIRESpuro3, and 400 µg/ml G418 for phuPSIg2.0. The Sp2/0-stable transfectant was cloned by limiting dilution, and a CD85jFc-producing clone was selected.
DNA constructs
pIRESneo/UL18. The UL18 gene was cloned in an expression vector amplifying the coding region by PCR using, as a template, the supernatant of fibroblasts infected with the laboratory strain AD169. Primers used were: forward primer UL18CPF GGAATTCACCATGATGACAATGTGGTGTCTGACG and reverse primer UL18CPR CGGGATCCTCATGACGACCGGACCTTGCG. The product was digested with EcoRI and BamHI restriction enzymes and cloned into the pIRESneo vector (BD Biosciences/Clontech).
pIRESneo/HLA-A2. HLA-A*0201 (HLA-A2) cDNA (kindly provided by R. Biassoni, G. Gaslini Institute, Genova, Italy) was amplified by PCR using the forward primer A2CPF GGAATTCACCATGGCCGTCATGGCGCCCCGAAC and the reverse primer A2CPR CGGGATCCTCACACTTTACAAGCTGTGAGAGAC. The product was purified and digested with EcoRI and BamHI restriction enzymes and cloned into the pIRESneo vector.
Swapping domain chimeric proteins. HLA-A2/UL18 chimeric proteins were constructed using a two-step PCR-based strategy.
The chimeric protein with the
1 and
2 domains of UL18 and the
3 domain, stalk, transmembrane region, and cytoplasmic tail of HLA-A2 (HLA-A2/UL18
1
2) was constructed amplifying UL18 with the primers UL18CPF and
2UL18/
3HLA-A2R GGGCGTCCGTGCGGACGGGGGGTTGAAAC, and amplifying HLA-A2 with the primers
2UL18/
3HLA-A2F GTTTCAACCCCCCGTCCGCACGGACGCCC and A2CPR. PCR products were controlled by 1.5% agarose gel electrophoresis and used to perform a second PCR step. One microliter of both products was mixed and amplified using primers UL18CPF and A2CPR. The product thus obtained was cloned using the TOPO TA Cloning Kit (Invitrogen), and positive clones were analyzed by sequencing. A clone with the expected sequence was digested with EcoRI and BamHI restriction enzymes and subcloned into pIRESpuro3 vector (BD Biosciences/Clontech). The following chimeric proteins were constructed similarly: one chimeric protein composed of the HLA-A2 protein carrying the
3 domain of UL18 (HLA-A2/UL18
3) using the primers A2CPF,
2HLA-A2/
3UL18R GATGGGGATGGTGGGCTGGGAAGACGGCTCAGGTGAGGTAACGCTGATGG,
2HLA-A2/
3UL18F TACCTGGAGAACGGGAAGGAGACGCTGCAGCACCCAGTGGTAAAGGGCGGTG, and A2CPR; and one chimeric protein composed of the
1,
2, and
3 domains of HLA-A2 and the stalk, transmembrane region, and cytoplasmic tail of UL18 (HLA-A2/UL18CY) using the primers A2CPF,
2HLA-A2/
3UL18R TACCACTGGGTGGGTCTGCAGCGTCTCCTT,
3HLA-A2/TMUL18F CTCACCCTGAGATGGGACGACAGTTCCTCG, and UL18CPR. The clones were subcloned into pIRESneo or pIRESpuro3 expression vectors.
HLA-A2/UL18
3 C279S.
To obtain this construct a mutation of the C at position 279 to S was introduced with the QuickChange II site-directed mutagenesis kit (Stratagene) according to the manufacturers instructions and using the following primers: forward primer MutC279SF GTTACGTAGCCATCTTTAGCAATCAAAACTACACC and reverse primer MutC279SR GGTGTAGTTTTGATTGCTAAAGATGGCTACGTAAC.
All of the above constructs were tagged at the C terminus with an enhanced GFP (EGFP) by subcloning into pEGFP-N1 vector.
Mutants of the HLA-A2/UL18CY construct were produced by PCR site-directed mutagenesis using as a template the HLA-A2/UL18CY construct. For all mutants the same forward primer A2CPF was used, coupled with a specific reverse primer. The HLA-A2/UL18CY Y362A mutant was obtained using the reverse primer MutY362ACPR TAGGATCCTCATGACGACCGGACCTTGCGAGCGCGCCACGC; the HLA-A2/UL18CY K364A mutant was produced using the reverse primer MutK364ACPR TAGGATCCTCATGACGACCGGACCGCGCGATAGCGCCACGC; and the HLA-A2/UL18CY Y362A/K364A mutant was constructed using the reverse primer MutY362A/K364ACPR TAGGATCCTCATGACGACCGGACCGCGCGAGCGCGCCACGC. Products were cloned with the TOPO TA cloning kit. Clones were sequenced and then digested with EcoRI and BamHI restriction enzymes and cloned into pIRESpuro3 vector.
The UL18 mutant UL18 Y362A/K364A was tagged at the C terminus with an EGFP by subcloning into pEGFP-N1 vector.
CD85jFc. The CD85jFc recombinant protein was obtained by cloning the CD85j coding region from aa 1 to aa 419 into the phuPSIg2.0 vector that contains a genomic Fc portion (hinge, intron, CH2, intron, and CH3) of human IgG1 Ig.
HiFi Platinum Taq (Invitrogen) was used for all PCR. DNA ligation kit 2.1 (Takara Shuzo) was used in all ligation reactions. For all constructs, positive clones were analyzed by sequencing to exclude mutations and to verify the frame maintenance. Big Dye Terminator 1.1 (Applied Biosystems) was used for all sequences that were analyzed using an ABI PRISM310 genetic analyzer (Applied Biosystems).
Lentiviral constructs
All cDNA of tagged, chimeric, and mutant contructs were subcloned, starting from the constructs described above, into the VVEW/BB: UL18/EGFP and HLA-A2/UL18CY were digested and subcloned NheI-NotI; and HLA-A2/UL18C Y362A, HLA-A2/UL18C K364A, HLA-A2/UL18C Y362A, and K364A were digested and subcloned NheI-BamHI.
Lentiviral vectors
To construct the self-inactivating lentivector VVEW/BB, the BiP/blasticidin cassette was inserted downstream of the EF-1 promoter in the VVEW vector (37). The blasticidin gene was obtained by digesting the pEF6/V5-HisA plasmid (Invitrogen) with NcoI and PmlI, while the BiP sequence was excised from the VVPW/BE vector (37) by digestion with NotI and NcoI. A triple ligation was performed to insert these fragments into the backbone VVEW vector that had been digested with XhoI, blunt-ended by Klenow polymerase, and then digested with NotI. Lentivirus production and in vitro transduction were performed as described (38).
HCMV viruses
The HCMV strain AD169 was purchased from American Type Culture Collection. The HCMV strain RV798 (US2-US11 deleted) was kindly provided by T. R. Jones (Wyeth) and A. E. Campbell (Eastern Virginia Medical School, Norfolk, VA) (42). Infections were performed as described (28) at 1 MOI.
Antibodies
The anti-UL18mAb M71 (Amgen) was used at 4 µg/ml for immunofluorescence and at 2.5 µg/ml for Western blot. Supernatants used were 10C7 and BB7.2 (American Type Culture Collection); 10C7 was also used as ascites for immunoprecipitations (kindly provided by P. Bjorkman, Caltech, Pasadena, CA). GM130 (BD Biosciences) and calreticulin (Affinity BioReagents) were used at 1:100 dilution. Anti-β-actin was obtained from Santa Cruz Biotechnology. Secondary fluorochrome-conjugated Abs were purchased from Molecular Probes or from Southern Biotechnology Associates. Secondary HRP-conjugated Abs for biochemical analysis were from Southern Biotechnology Associates or Kirkegaard & Perry Laboratories.
Surface immunofluorescence
Depending on the type of fluorescence measurement, that is, whether by flow cytometry or by fluorescence microscopy, cells were either detached with trypsin from the plasticware bottom and stained as cell suspensions or directly grown on glass coverslips and stained in adherence, respectively. In both cases, exposure to the first Ab, to the secondary fluorochrome-conjugated Abs, and washes were all performed at 4°C. A short fixation with 1% paraformaldehyde (PFA) was performed after the last washing, and surface fluorescence was measured either on single cell suspensions by a FACSCalibur flow cytometer (BD Biosciences) or on coverslips mounted with Prolong antifading mounting medium (Molecular Probes) either on a Leica DM-IRE2 fluorescence microscope or on a Leica SP2-AOBS confocal microscope (Leica Microsystems).
Immunofluorescence-based endocytosis assay
Cells growing on glass coverslips were stained with the primary Ab for 30 min at 4°C, extensively washed with ice-cold PBS, and then incubated at 37°C in prewarmed complete tissue culture medium for 30 min before fixation with 2% PFA. The latter procedure allows internalization of the surface Ag-Ab complex, if the Ag bears internalization sequences (39). After fixation, coverslips were washed with PBS, incubated with 50 mM NH4Cl in PBS for 15 min, washed again, permeabilized with 0.05% Triton X-100 for 5 min, and stained with the secondary fluorochrome-conjugated Ab. Mounted coverslips were imaged on a Leica DM-IRE2 fluorescence microscope or on a Leica SP2-AOBS confocal microscope.
Intracellular immunofluorescence
Cells grown on coverslips were fixed either with 100% ice-cold methanol for 3 min (M71 mAb) or with 3% PFA (8 min at room temperature) followed by permeabilization with 0.01% Triton X-100 (2 min at room temperature) (CD85jFc and all other Abs). After washing, cells were stained with the primary Ab, washed with PBS plus 1% BSA, and incubated for 40 min at room temperature with the fluorochrome-conjugated secondary Ab. For multicolor staining, incubation with other primary and respective secondary Abs followed sequentially. In the case of surface and intracellular immunofluorescence on the same sample, after incubation with primary and secondary Abs on live cells at 4°C for surface staining, cells underwent PFA-Triton X-100 treatment, except for M71 mAb, where surface-stained cells were subjected to a short pulse (30 s) with 1.5% PFA before methanol fixation.
Surface biotinylation, immunoprecipitation, endoglycosidase H (EndoH), and peptide N-glycosidase F (PNGaseF) digestions
Biotinylation of cell surface proteins was performed as described (28). Immunoprecipitations were conducted according to standard procedures (28). Protein A-agarose was used for BB7.2 immunoprecipitation (IP) and protein G-agarose for 10C7 IP and anti-β-actin. Samples were analyzed by SDS electrophoresis in 12% polyacrylamide gels under reducing conditions. Western blots were developed using either anti-H chain HCA2 mAb (provided by H. Ploegh (Harvard University, Boston, MA) and P. Giacomini (Regina Elena Cancer Institute, Rome)) followed by goat anti-mouse HRP-conjugated antiserum (Southern Biotechnology Associates) for BB7.2 IP, HRP-conjugated streptavidin (Santa Cruz Biotechnology) for 10C7 and anti-β-actin IP. For EndoH digestions of BB7.2 immunoprecipitates, 5 µl of 5x EndoH digestion buffer (50 mM sodium acetate (pH 5.2) in water solution) with 10 mU of enzyme was added to the beads. For PNGaseF digestions of BB7.2 immunoprecipitates, 5 µl of 5x PNGaseF buffer (100 mM sodium phosphate, 9% NaCl, 5% Nonidet P-40, pH 7.4) with 1 unit of enzyme was added to the beads. Digested proteins were incubated for 17 h at 37°C before analysis by SDS electrophoresis. Immune complexes were detected with a SuperSignal West Pico chemiluminescent substrate (Pierce Biotechnology).
Genomic DNA extraction and UL18 amplification
Genomic DNA was extracted from HCMV-seropositive donors. Briefly, 3 ml of peripheral venous blood was diluted with an equal volume of PBS, layered over 3 ml of Lymphoprep (Axis-Shield), and spun at 800 rpm for 20 min. Mononuclear cells were washed with PBS. DNA was extracted with the GeneElute mammalian genomic DNA miniprep kit (Sigma-Aldrich) according to the manufacturers instructions. Genomic DNA was amplified using the forward primer UL18–5'F2 CGCCATGATGACAATGTGGTG and the reverse primer UL18–3'R2 GCGTCGCGTGAGAAACATGAC. After 50 cycles of amplification the product was run on a 1% agarose gel. Positive samples were purified and sequenced.
Bioinformatic analysis
The amino acid sequence of the UL18 cytoplasmic tail was analyzed using the PSORTII program (http://www.psort.org/) (40) and the ELM program (http://www.elm.eu.org/) (41).
| Results |
|---|
|
|
|---|
HFFs transduced with UL18-GFP and subjected to immunofluorescence staining by the anti-UL18 mAb M71 display a significant intracellular distribution (Fig. 1A), mainly residing in the ER and the cis-Golgi (Fig. 1B). UL18 accumulation in these compartments was demonstrated previously by biochemical analysis of the protein sensitivity to EndoH (35). Conversely, UL18 was undetectable by immunofluorescence on the cell surface (Fig. 1A). The same results were achieved with other in vitro UL18-expressing cell systems, such as UL18-transfected HeLa cells or HFFs infected at 1 MOI by AD169 or by the AD169-derived deletion mutant RV798 (42), either by using M71 or the recombinant protein CD85jFc for immunofluorescence (not shown).
|
The presence of a small amount of UL18 molecules on the cell membrane is also demonstrated on UL18-transfected HeLa cells by immunoprecipitation of surface-labeled proteins 48 h after transfection (Fig. 1C). The anti-UL18 mAb 10C7 was used because M71 did not work in our hands for immunoprecipitation experiments. In addition to a nonspecific band of 101 kDa observed also in cells transfected with the vector alone, a 69-kDa band corresponding to the low glycosylated form of UL18 is detected (Fig. 1C, left), not derived from cytoplasmic contaminants (Fig. 1C, middle). Western blots of total lysates revealed with M71 (Fig. 1C, right) showed two bands corresponding to the 69-kDa, low glycosylated form and the 116-kDa, high glycosylated form of UL18.
Altogether, the data indicate that UL18 expression is mostly confined in intracellular compartments. Molecules that reach the cell membrane are few in number and/or their residency time is very short.
The cytoplasmic region of UL18 regulates its surface expression
To understand the cytoplasmic retention of UL18, domain-swapping experiments were conducted. The HLA-A*0201 (HLA-A2) molecule was chosen as partner, due to its structural homology with UL18 and because it is physiologically expressed on the cell surface. Three different hybrid molecules were constructed in which either the extracellular domains
1
2 or
3 or the stalk-transmembrane-cytoplasmic region of UL18 was substituted to the respective domains of HLA-A2 (Fig. 2). HeLa cells, which are HLA-A2 negative, as demonstrated by HLA genotyping and by the negative staining with the HLA-A2 allele-specific BB7.2 mAb (Fig. 3B), were transfected with GFP-tagged expression vectors carrying the HLA-A2 cDNA or the hybrid molecules, namely HLA-A2/UL18 stalk-transmembrane-cytoplasmic regions (herein called HLA-A2/UL18CY), HLA-A2/UL18
1
2, or HLA-A2/UL18
3. For determining the Ab specificity for each of the hybrid proteins, the following Abs or recombinant chimeric proteins were tested: the BB7.2 mAb specific for the
2 domain of HLA-A2, the M71 mAb raised against UL18 and specific for its
1
2 domain, and the recombinant protein CD85jFc. According to intracellular immunofluorescence analysis, the most appropriate Abs, in terms of specificity and sensitivity, for each of the hybrids were: BB7.2 mAb for HLA-A2/UL18CY, M71 for HLA-A2/UL18
1
2, and CD85jFc for HLA-A2/UL18
3. Note that HLA-A2/UL18
3 was first undetectable by CD85jFc, despite the presence of β2-microglobulin and the UL18
3 domain, which is known to contain the primary site for UL18 binding to CD85jFc (30). Analysis of the amino acid sequence of the
3 domain of UL18 by means of prediction model programs revealed the presence of one cysteine (at position 279 in the wild-type UL18 molecule) available for disulfide bonds (51), possibly interfering, in the hybrid molecule, with proper epitope recognition by CD85jFc. To verify this hypothesis, we mutated the cysteine to serine in HLA-A2/UL18
3 and observed a significant immunofluorescence with CD85jFc (not shown). Additionally, HeLa transfected with unmutated HLA-A2/UL18
3 and processed for CD85jFc intracellular immunofluorescence after 20 min incubation with 20 mM 2-ME displayed a significant fluorescence signal (not shown). Therefore, experiments on HLA-A2/UL18
3 transfectants were always conducted after 2-ME treatment. When the proper detection reagents were identified for each of the hybrid molecules, surface immunofluorescence and confocal microscopy were performed on transient GFP-tagged transfectants to find out which domain of UL18 was responsible for impairing HLA-A2 surface expression. Results are displayed in Fig. 2. All hybrids retained surface expression, except for HLA-A2/UL18CY that was detected by immunofluorescence intracellularly (not shown) but not on the plasma membrane. No surface BB7.2 fluorescence was observed when HLA-A2/UL18CY transfectants were exposed to 2-ME. These results suggest that the portion of UL18 containing the stalk, the transmembrane region, and the cytoplasmic tail might bear sequences involved in the regulation of UL18 surface expression.
|
|
The amino acid sequence of UL18 from the AD169 strain has been analyzed using the PSORTII and ELM programs that allow prediction of protein localization signals. Two consensus sequences were identified in the cytoplasmic tail of UL18 that may account for its intracellular retention (Fig. 3A). Sequence YRKV from aa 362 to aa 365 is homologous to the consensus sequence YXX
that represents a tyrosine-based motif for rapid internalization and endocytosis. It mediates the internalization of proteins from the cell surface and targeting to intracellular compartments, such as endosomes, TGN, or lysosomes, via clathrin-coated pits associated with the AP-2 and AP-1 adaptor complexes (43, 44). Sequence KVRS from aa 364 to aa 367 is homologous to the KKXX consensus sequence responsible for retrieval of type I transmembrane proteins from postendoplasmic reticulum compartments back to the ER. Retrieval is mediated by proteins of the coatomer protein complex I structure (45) and occurs from as far as Golgi compartments, as indicated by Golgi-specific carbohydrate modifications of the retrieved proteins (46).
Mutation of the two motifs identified on the cytoplasmic tail of UL18 leads to surface expression of the hybrid protein HLA-A2/UL18CY
To evaluate the function of the above-described amino acid motifs, mutations that abrogate one or both motifs within the hybrid molecule HLA-A2/UL18CY were produced. Sequence YRKV was mutated to ARKV by replacing Y with A (Y362A), and sequence KVRS was mutated by replacing K with A (K364A) (Fig. 3A). Stable HeLa transfectants for all constructs were generated and analyzed. In these experiments the constructs were not GFP-tagged.
As shown in Fig. 3B (4°C column), transfection with HLA-A2 yields a strong surface expression of the protein. In contrast, transfection with HLA-A2/UL18CY leads to undetectable surface expression of the hybrid. However, a low amount of protein must have reached the surface membrane, as immunofluorescence-based endocytosis conducted by incubating Ab-fed cells for 30 min at 37°C with fresh medium allows the detection of a fluorescence punctuate pattern (Fig. 3B, 37°C, 30 min column).
The Y362A mutant, which bears a mutated YRKV sequence, is ineffective for clustering and internalization of Ab-bound hybrid protein, because no fluorescent punctuated pattern was observed after 30 min incubation at 37°C. The lack of internalization, however, is not sufficient to yield a detectable surface expression (Fig. 3B, 4°C column). Note that positive expression of the hybrid is demonstrated by immunoprecipitation with BB7.2 mAb (Fig. 3C) and by intracellular immunofluorescence (Fig. 4A). Lack of re-internalization is specific for the Y362A mutant, as it is not observed in the K364A mutant (Fig. 3B, 37°C, 30 min column) that retains the unmutated YRKV sequence. Interestingly, mutation of the KVRS sequence allows recovery of hybrid surface expression. Surface expression is further augmented by the double mutant Y362A/K364A, and internalization after 30 min is difficult to evaluate, possibly also because of the mutation of the YRKV sequence. Recovery of HLA-A2/UL18CY surface expression by K364A and by Y362A/K364A mutations, as observed on stable HeLa transfectants, was confirmed in transiently transfected HeLa cells, in transiently transfected COS cells, and in lentiviral-transduced HFFs (not shown).
|
The hybrid protein co-localizes predominantly with the cis-Golgi and partially with the ER
Confocal microscopy evaluations were conducted to analyze changes in the intracellular distribution patterns of the Y362A and the K364A mutants compared with HLA-A2/UL18CY. After lentiviral transduction to induce expression of the hybrid proteins, HFFs were processed for immunofluorescence detection of the ER (by calreticulin Abs) and the cis-Golgi (by GM130 mAb) to be analyzed for co-localization with BB7.2-stained hybrid proteins. As displayed in Fig. 4A, the unmutated HLA-A2/UL18CY hybrid shows a major co-localization with the cis-Golgi and, to a lesser extent, with the ER. The same pattern is observed on the Y362A mutant, whereas the K364A mutant displays an intracellular distribution entirely confined to the cis-Golgi (Fig. 4A). Most HLA-A2/UL18CY(Y362A/K364A) hybrid molecules are revealed on the cell membrane, and their intracellular expression is hard to detect. Note that despite permeabilization procedures required for BB7.2 intracellular staining, which can affect protein distribution on the plasma membrane, surface immunofluorescence detection of Y362A/K364A is still high. Altogether the data are consistent with the expected role of the two motifs on the cytoplasmic tail of UL18, that is, rapid internalization and endoplasmic reticulum retrieval.
Mutation of the two motifs on the cytoplasmic tail of UL18 abrogates internalization and leads to surface expression of UL18
Based on the above results, a double mutant of UL18 bearing the two Y362A/K364A mutations was constructed. Surface expression of this mutant was investigated on HeLa, COS-7, and HEK tumor cell lines, as well as in HFFs. COS-7 cells transiently transfected with UL18-GFP or with UL18(Y362A/K364A)-GFP and stained for surface immunofluorescence with M71 are shown in Fig. 4B. A significant recovery of surface detectability of UL18 was observed when the two motifs on its cytoplasmic tail were mutated. Identical results were achieved in the other cell systems, both with M71 and CD85jFc detection reagents (not shown).
The HCMV genome is involved in the regulation of HLA-A2/UL18CY and UL18 surface expression in human-transduced fibroblasts
We wondered whether the two motifs found on the cytoplasmic tail of UL18 represent a mechanism used in vivo by the HCMV for regulating the egress of UL18 toward the cell surface and its consequent availability for trans-interactions with the CD85j receptor.
An in vitro cell model comprehensive of either HLA-A2/UL18CY or UL18 genes, together with the whole HCMV genome, was created. To this end, HFFs were first transduced with VVEW/BB lentiviral vectors carrying HLA-A2/UL18CY or UL18-GFP (100% infection efficiency) and subsequently infected with the HCMV. This model of HCMV infection should grant the presence of HCMV genes possibly regulating expression and trafficking of UL18 and/or HLA-A2/UL18CY. Either AD169 or the AD169-derived deletion mutant RV798 was used on UL18-GFP-expressing HFFs. In fact, cell surface expression of UL18 is not affected by US2, US3, US6, and US11 HCMV gene products (47). Conversely, experiments on HLA-A2/UL18CY-HFFs were conducted with the virus RV798 only, because it does not contain US2, US3, US6, and US11 genes that down-regulate HLA-A*0201 surface expression (42, 47). To maximize duration of the experiments, HFFs were infected with low viral titers (1 MOI). Under these conditions, in vitro cellular viability was preserved for at least 7 days, and no endogenous UL18 was detected at any time of infection. Successful infection was monitored by expression of the early DNA-binding viral protein UL44 (not shown).
Analysis of surface HLA-A2/UL18CY or UL18-GFP temporal expression was performed by staining HCMV-infected fibroblasts for surface BB7.2 or M71 immunofluorescence, respectively, and analyzing samples by confocal microscopy. Time-course observations from 0 to 6 days postinfection (dpi) are shown in Fig. 5, A and B. As expected based on previous data, expression of HLA-A2/UL18CY or UL18-GFP on the cell membrane of HCMV uninfected fibroblasts was negative (0 dpi). However, as HCMV infection progressed, surface-stained cells appeared and increased over time. The first fluorescent cells were observed at 3 dpi; at day 4 the percentage of surface-positive cells increased significantly, having increased further during the subsequent days with a much lower rate, until cells died from infection-induced toxicity in culture. Time-course of the percentage of surface HLA-A2/UL18CY- and UL18-GFP-positive cells, as calculated on samples of one representative experiment, is displayed in Fig. 5C. Very similar results were achieved when UL18-GFP-expressing fibroblasts were infected with RV798 (not shown). To exclude that surface immunofluorescence was due to undesired binding of Abs to infection-induced Fc receptors (48), wild-type HFFs or HFFs transduced either with empty lentiviral vectors without transgene insert or with GFP only were HCMV infected and processed for surface immunofluorescence with BB7.2 and M71 mAbs. No fluorescence was detected in any case and at any time (lowest row of Fig. 5, A and B, and not shown).
|
We were not confident in quantitating the "surface UL18/intracellular UL18" ratio by flow cytometric measurements that would provide statistically more significant data, because we observed a strong increase of cellular autofluorescence upon HCMV infection. Flow cytometry, being unable to discriminate the source of fluorescence, would have summed fluorescence from specific Ab binding and autofluorescence; instead, the autofluorescence signal could be reliably subtracted by means of emission wavelength scans on the spectral confocal microscope.
Altogether, the above data suggest that during HCMV infection the activity of the two UL18 cytoplasmic motifs is regulated by a finely tuned interplay between HCMV viral proteins, host proteins, and UL18 itself to provide the virus with a mechanism that controls UL18 surface expression.
The amino acid sequence of the UL18 cytoplasmic tail is highly conserved
Once we had shown that two sequences present in the cytoplasmic tail regulate the surface expression of the UL18 molecule encoded by the AD169 HCMV strain, we asked whether they are conserved in other laboratory and wild-type HCMV strains. To this end, stalk, transmembrane, and cytoplasmic portions of the UL18 gene from genomic DNA of 10 HCMV-positive donors were sequenced. Other sequences (i.e., AD169, Merlin, Toledo, and Towne strains and FIX-BAC, PH-BAC, and TR-BAC isolates) were obtained from GenBank database. ClustalW alignment of the amino acid sequences showed that the 65 carboxyl-terminal amino acids are highly conserved and that the two motifs are identical in all cases (Fig. 6).
|
| Discussion |
|---|
|
|
|---|
However, the effects of UL18 on NK and T cells are still matter of controversy. On one hand, the CD85j–UL18 interaction was proposed as a viral escaping mechanism from NK-cell-mediated lysis (4, 25), and on the other hand as a mechanism that leads to the killing of HCMV-infected cells by NK cells (27) and T lymphocytes in a non-MHC-restricted fashion (28). Nevertheless, in either instance, we expect the CD85j–UL18 interaction to operate in a controlled fashion in a specific time frame. If the interaction triggers an immunosubversive pathway, inhibition of NK cells should become operative at a time coincidental with an increased risk of NK lysis due to the virus-induced HLA class I down-regulation. On the other hand, if the CD85j–UL18 interaction exerts an activation of T lymphocytes, only a regulated pattern of surface expression would prevent the virus from being completely erased from the host and letting it undergo latency following primary infection.
Accordingly, we hypothesized the CD85j–UL18 interaction to be tightly regulated by a control mechanism of UL18 surface expression during HCMV infection. It is known that transcription of this gene occurs from 54 h postinfection onward (14), but not much information is available on its expression on the plasma membrane of infected cells.
We observed in in vitro experiments that fibroblasts or tumor cell lines respectively transduced or transfected with the UL18 gene display most molecules accumulated in the cytoplasm and almost undetectable levels on the plasma membrane. However, when culturing these cells in the presence of the whole HCMV genome, which had been introduced by in vitro HCMV infection at 1 MOI, a time-associated pattern of UL18 egress toward the cell surface could be observed. These data suggest that a network of HCMV gene activity operates on UL18 to control its surface expression and, consequently, the UL18–CD85j interaction.
Molecular dissection studies conducted for identification of the UL18 domains involved in this regulatory mechanism disclosed a relevant role for the cytoplasmic tail of UL18. Two motifs on the cytoplasmic tail of UL18 were identified that are homologous to consensus sequences known to mediate intracytoplasmic retention, namely one tyrosine-based motif for rapid internalization and endocytosis, and one consensus sequence responsible for retrieval of type I transmembrane proteins from Golgi compartments back to the ER. The two motifs were able to completely abolish surface expression of a well-known plasma membrane protein such as HLA-A2, as observed in fibroblasts transduced with a hybrid HLA-A2 protein that bears the cytoplasmic tail of UL18 (HLA-A2/UL18CY). Most HLA-A2/UL18CY molecules were retained in the ER and cis-Golgi. However, surface expression was restored when cells transduced with HLA-A2/UL18CY were infected with the HCMV, displaying a time-regulated pattern of plasma membrane egress very similar to that of UL18 in HCMV-infected UL18-transduced fibroblasts. These data further demonstrate that the HCMV uses the cytoplasmic tail of UL18 for regulating its surface expression. Importantly, the two motifs are completely identical in UL18 genes from AD169, Merlin, Toledo, and Towne strains and FIX-BAC, PH-BAC, and TR-BAC isolates, as well as in the 10 HCMV-positive donors analyzed.
One of the starting points of this study is that UL18 surface expression on in vitro cell systems is mostly hard to detect. However, a few examples in the literature apparently are not in accordance with this observation, as human fibroblasts subjected to HCMV infection (MOI 10) or to infection with UL18-carrying adenovirus (MOI 100) or vaccinia virus (MOI 10) displayed UL18 expression on their plasma membrane (28, 35, 36). We ascribe the spillover of UL18 from the cytoplasm to the cell surface observed in these experiments to the high viral titer used for the infections. However, we cannot exclude a contribution of portions of viral genomes possibly present in the DNA of tumor cell lines or immortalized fibroblasts, in a mechanism like the one we described for HCMV, especially if the viral genes involved in the regulation of the activity of KVRS and YRKV motifs are conserved among the different viruses.
For the HCMV-infection experiments on UL18-transduced fibroblasts (Fig. 5) we had to decrease the MOI down to 1 to exclude the contribution of HCMV-encoded UL18 molecules to the surface expression of UL18. Besides ameliorating cellular viability during the infection, this experimental setting provided a "clean" cell model for studying the effects of the interaction between factors encoded by the HCMV genome and transduced UL18 molecules (Fig. 5B, bottom row). To account for the negative surface expression of endogenous UL18 that is undetectable even at the 4th and 5th day after in vitro HCMV infection, we argue that a minimal amount of UL18 translated molecules might be necessary to allow immunofluorescence detection on the cell membrane. The viral load administered to the fibroblasts by an MOI of 1 might be too low to provide enough UL18 transcripts and translated proteins to be detected on the cell membrane by immunofluorescence and confocal microscopy, even when the "virally encoded" mechanism is maximally effective in our in vitro experimental system. Conversely, the UL18-GFP-fibroblasts, also when displaying very faint GFP (Fig. 5E), might produce an amount of UL18 above threshold, so that the mechanism of regulation of UL18 egress has the possibility to overcome the immunofluorescence detection barrier. Altogether, the data suggest that HCMV-encoded "factors" require a threshold amount of UL18 molecules to allow their surface detection by immunofluorescence and confocal microscopy, but the mechanism of regulation of UL18 surface egress does not simply depend on the amount of cytoplasmic UL18.
In conclusion, we disclose in this study a regulatory mechanism for the control of surface UL18 expression. Following our previous observation that the UL18–CD85j interaction triggers non-MHC-restricted TCR-independent T cell activation and subsequent lysis of UL18-expressing cells (28), we hypothesize that during the latent phase of infection, a lack of UL18 molecules on the infected cells prevents their clearance. Conversely, during the productive phase of infection, when most HCMV genes are active, the virus may allow the release of UL18 surface expression by suppressing the retention function of the YRKV and KVRS motifs. This would make UL18 available for trans-interaction with CD85j on T lymphocytes and mediate the lysis of infected cells, thus preserving the host from death and, consequently, the virus from its elimination.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by grants from Compagnia di San Paolo, Ministero per lIstruzione, lUniversità e la Ricerca Scientifica, and Progetto Finalizzato Ministero della Salute (to E.C.). ![]()
2 M.M. and F.G. contributed equally to this work. ![]()
3 Address correspondence and reprint requests to Dr. Silvia Bruno, Department of Experimental Medicine, Human Anatomy Section, University of Genoa, Via De Toni 14, 16132 Genova, Italy. E-mail address: silvia.bruno{at}unige.it ![]()
4 Abbreviations used in this paper used: HCMV, human cytomegalovirus; EGFP, enhanced GFP; EndoH, endoglycosidase H; ER, endoplasmic reticulum; GAM, goat anti-mouse; HFF, human foreskin fibroblast; MOI, multiplicity of infection; PNGaseF, peptide N-glycosidase F; PFA, paraformaldehyde; IP, immunoprecipitation. ![]()
Received for publication July 24, 2007. Accepted for publication October 30, 2007.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
O. Ashiru, N. J. Bennett, L. H. Boyle, M. Thomas, J. Trowsdale, and M. R. Wills NKG2D Ligand MICA Is Retained in the cis-Golgi Apparatus by Human Cytomegalovirus Protein UL142 J. Virol., December 1, 2009; 83(23): 12345 - 12354. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Petrucelli, M. Rak, L. Grainger, and F. Goodrum Characterization of a Novel Golgi Apparatus-Localized Latency Determinant Encoded by Human Cytomegalovirus J. Virol., June 1, 2009; 83(11): 5615 - 5629. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Occhino, F. Ghiotto, S. Soro, M. Mortarino, S. Bosi, M. Maffei, S. Bruno, M. Nardini, M. Figini, A. Tramontano, et al. Dissecting the Structural Determinants of the Interaction between the Human Cytomegalovirus UL18 Protein and the CD85j Immune Receptor J. Immunol., January 15, 2008; 180(2): 957 - 968. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |