|
|
||||||||




,
* Department of Experimental Medicine, University of Genoa, Genoa;
Department of Biochemical Sciences and
Istituto Pasteur Fondazione Cenci Bolognetti, University "La Sapienza", Rome;
Department of Experimental Oncology, Molecular Therapy Unit, Istituto Nazionale Tumori, Milan; and
¶ Department of Biomolecular Sciences and Biotechnology and Consiglio Nazionale delle Ricerche–Istituto Nazionale per la Fisica della Materia, University of Milan, Milan, Italy
| Abstract |
|---|
|
|
|---|
3 domain with an affinity that is
1000-fold higher than the MHC class I affinity for CD85j. Deeper knowledge of features of the UL18/CD85j complex would help to disclose the function of UL18 when it binds to CD85j. In this study we first demonstrated that the UL18
3 domain is not sufficient per se for binding and that β2-microglobulin is necessary for UL18–CD85j interaction. We then dissected structural determinants of binding UL18 to CD85j. To this end, we constructed a three-dimensional model of the complex. The model was used to design mutants in selected regions of the putative interaction interface, the effects of which were measured on binding. Six regions in both the
2 and
3 domains and specific amino acids within them were identified that are potentially involved in the UL18–CD85j interaction. The higher affinity of UL18 to CD85j, compared with MHC class I, seems to be due not to additional interaction regions but to an overall better fit of the two molecules. | Introduction |
|---|
|
|
|---|
1,
2, and
3) with a sequence identity of 21, 20, and 22% with their class I counterparts (1), respectively. Moreover, its extracellular region associates with β2-microglobulin (β2m) (4) and binds peptides derived from cytoplasmic proteins (5). Similarly to class I molecules, the UL18
2 and
3 domains each contains two cysteines characteristic of the MHC Ag-recognition domain fold and of the Ig-like fold, respectively. In contrast, the Ig-like loop of the
2 domain is 10 amino acids longer than the corresponding MHC class I loop, and the CD loop of the Ig-like
3 domain contains three additional cysteines. As opposed to MHC class I molecules, which have only one to three N-glycosylation sites, the UL18 molecule bears 13 potential glycosylation sites (1), resulting in the expression of highly glycosylated forms (6). The only molecule known so far to bind UL18 is the transmembrane protein CD85j (previously reported as ILT2 or LIR-1) (7).
CD85j is a transmembrane receptor expressed on the surface of subsets of NK and T cells and of all B cells and monocytes (7, 8). It is formed by four Ig-like domains, a transmembrane region, and a cytoplasmic tail that contains four ITIM-like motifs. Cross-linking of the CD85j receptor on the surface of T cells leads to a decrease of the CD3 complex phosphorylation (9), a decrease in activatory cytokines production (10), and to an increase of cytokines that down-regulate the immune response (10). Besides UL18, CD85j binds MHC class I molecules (11) with a broad specificity. The binding properties of CD85j to MHC class I molecules have been thoroughly studied. CD85j binds MHC class I molecules primarily through the interaction of its distal Ig-like domain with class I
3 domain and β2m (11, 12, 13) and with an affinity in the micromolar range. Most of the interactions involve residues of the β2m domain, which might explain the broad specificity of this interaction (13).
Much less information is available about the complex between CD85j and UL18. It is known that, similar to MHC class I, UL18 binds CD85j through its
3 domain (11). Notably, UL18 binds CD85j with an affinity that is in the nanomolar range,
1000-fold higher than the MHC class I affinity for CD85j (11). Recent studies have shown that UL18-soluble molecules derived from clinical isolates all bind CD85j, although with different affinities (14, 15).
UL18 expression on cell surfaces of HCMV-infected cells is described both as an escaping mechanism from NK lysis (16, 17) and as a mechanism that leads to killing infected cells by NK cells (18) or by T lymphocytes through a non-MHC-restricted pathway (19). Furthermore, UL18 has been recently described to have an activatory role on T cells (20). Whatever the mechanism, UL18 certainly plays a pivotal role in the immune response to HCMV infection, and it is therefore important to gain an understanding of the molecular properties of its complex with CD85j and, possibly, of the high affinity of the interaction.
Our study investigates features of the UL18 molecular structure(s) that may account for its high affinity for CD85j. We analyze UL18 binding to CD85j with a mutagenesis approach and propose a model for the structure of its extracellular region.
| Materials and Methods |
|---|
|
|
|---|
HeLa and Jurkat cell lines were maintained in RPMI 1640 medium with GlutaMAX (Invitrogen); HEK293T, FO-1, and Sp2/0 cell lines were maintained in DMEM medium with GlutaMAX. Both media were supplemented with penicillin, streptomycin, and 10% FCS (Invitrogen).
HeLa and FO-1 transient transfections were conducted using Lipofectamine 2000 reagent (Invitrogen) following the manufacturers instructions.
HEK293T transient transfections were performed as follows: HEK293T cells were plated in petri dishes and transfected by CaPO4 coprecipitation method. Briefly,
1.5 x 106 cells were transfected with 10 µg of DNA, incubated for 8 h at 37°C, washed twice with PBS, and then added with fresh OptiMEM medium (Invitrogen) without addition of FCS. Supernatants were collected after 72 h and concentrated 100x with Amicon Ultra centrifugal filter units (Millipore) (30,000 molecular weight cutoff).
The HEK293T cell line was stably transfected with vectors carrying the UL18Fc-wt molecule, the different UL18Fc mutants, and the HLA-A2Fc molecule. Transfections were performed using the Lipofectamine 2000 reagent (Invitrogen) according to the manufacturers instructions. The transfectants were selected in DMEM medium added with 10% FBS and 500 µg/ml Geneticin (Invitrogen). For protein production, each stable cell line was cultured extensively in DMEM medium, washed with PBS, and then incubated in OptiMEM medium (Invitrogen) without FCS for 72 h. One hundred petri dishes were plated for each transfectant to produce a volume of 500 ml of supernatant.
The Jurkat cell line and murine cell line Sp2/0 were transfected with the CD85jFc construct. Transfection was performed with a Multiporator (Eppendorf, Milan, Italy) following the manufacturers instructions. Transfected cells were selected with 500 and 300 µg/ml Geneticin (Invitrogen), respectively.
Constructs and mutants
UL18
3Fc construct.
A soluble molecule formed by the CD33 leader peptide, the UL18
3 domain, and the CH2 and CH3 domains of the human IgG1 Ig was constructed (UL18
3Fc). Using PCR, the leader sequence of the CD33 protein was joined to the
3 domain of UL18 of the AD169 HCMV strain. The product was cloned with the TOPO TA cloning kit (Invitrogen), sequenced, and then subcloned into the spIg2.0 vector that carries the CH2 and CH3 domains of human IgG1.
UL18Fc-wt construct.
A covalently bound molecule composed by a leader sequence, a peptide, β2m, the extracellular domain of UL18 and the hinge, CH2 and CH3 domains of the human IgG1 Ig was constructed as described previously (21). Briefly, with a PCR strategy, the β2m leader sequence was joined to the actin peptide ALPHAILRL. These two sequences were linked to the β2m coding sequence with the intervening spacer (GGGS)3 and then, with another spacer (GGGGS)3, linked to the
1,
2, and
3 domains of the UL18 molecule derived from strain AD169. The described recombinant molecule, obtained by repeated PCR steps, was cloned with the TOPO TA cloning kit and sequenced. The construct coding for the correct amino acid sequence was digested with the restriction enzymes HindIII and NotI and subcloned into the phuPSIg2.0 expression vector, which contains a genomic portion (intron, hinge, intron, CH2, intron, CH3) of the human IgG1 Ig.
HLA-A2Fc construct. HLA-A2 was constructed by subcloning the HLA-A2 construct (kindly provided by T. Greten, Medizinische Hochschule Hannover, Germany) into the phuPSIg2.0 expression vector.
UL18Fc-Di cassette mutants. Cassette mutants were obtained with a two-step PCR strategy. Primers annealing to the UL18 sequence, but carrying a flanking region coding for the HLA-A2 sequence chosen to replace the corresponding UL18 sequence, were used. The product was cloned with the TOPO TA cloning kit and sequenced. A clone with the expected sequence was subcloned into the phuPSIg2.0 expression vector.
UL18Fc-Mi mutants. Single and multiple amino acid substitutions were obtained using the QuickChange II site-directed mutagenesis kit and the QuickChange multi-site-directed mutagenesis kit (Stratagene), respectively, as described by the manufacturer.
CD85jFc constructs. The extracellular portion of the CD85j molecule was amplified by PCR, cloned with the TOPO TA cloning kit, and sequenced. A clone with the expected sequence was subcloned into the phuPSIg2.0 expression vector.
β2m construct. The coding region of the β2m was amplified by PCR, cloned with the TOPO TA cloning kit, and sequenced. A clone with the expected sequence was subcloned into pIREShygro expression vector (Clontech Laboratories, Mountain View, CA).
HiFi Platinum Taq (Invitrogen) was used for all PCR. DNA ligation kit 2.1 (Takara Shuzo) was used in all ligation reactions. For all constructs, positive clones were analyzed by sequencing to exclude mutations and to verify the frame maintenance. Big Dye Terminator v1.1 (Applied Biosystems) was used for all sequences that were analyzed using an ABI PRISM 310 Genetic Analyzer (Applied Biosystems).
Genomic DNA extraction and UL18 amplification
Genomic DNA was extracted from HCMV seropositive donors. Briefly, 3 ml of peripheral venous blood was diluted with an equal volume of PBS, layered over 3 ml of Lymphoprep (Axis-Shield), and spun at 800 rpm for 20 min. Mononuclear cells were washed with PBS. DNA was extracted with the GeneElute Mammalian Genomic DNA miniprep kit (Sigma-Aldrich) according to the manufacturers instructions. Genomic DNA was amplified using the forward primer UL18–5'F2 CGCCATGATGACAATGTGGTG and the reverse primer UL18–3'R2 GCGTCGCGTGAGAAACATGAC. After 50 cycles of amplification with HiFi Platinum Taq the product was run on a 1% agarose gel. Positive samples were purified and sequenced.
Protein affinity purification
Supernatants containing recombinant proteins were incubated with rec-protein A-Sepharose 4B (Zymed Laboratories) overnight at room temperature. Beads were packed in appropriate columns and washed with abundant PBS. Bound proteins were eluted with 0.1 M glycine-HCl (pH 3.5); 10 aliquots were collected and neutralized by addition of 50 µl of 1 M Tris-HCl (pH 8.8). The absorbance at 280 nm was measured and fractions containing the protein (with an A280 > 0.05) were pooled. Pooled fractions were dialyzed against HBSS buffer (10 mM HEPES pH 7.4, 150 mM NaCl, and 3.4 mM EDTA pH 8) to perform subsequent measures with a Biacore 2000 instrument. When necessary, the concentration of purified proteins was normalized by ELISA, as described, comparing the absorbance values of samples with known concentrations of human IgG.
ELISA
The presence of proteins in every supernatant was evaluated by ELISA. A polystyrene Maxisorp ELISA plate (Nunc) was coated overnight at 4°C with 100 µl/well of goat anti-human IgG (Kirkegaard & Perry Laboratories) dissolved at 1 µg/ml in PBS (Invitrogen). The plate was washed three times in PBS containing 0.01% Tween 20 (Sigma-Aldrich) and blocked with 200 µl/well of 10 mg/ml BSA (Sigma-Aldrich) in PBS-Tween. Supernatants from transfected HEK293T (100 µl) were added to each well and incubated for 2 h at room temperature. Serial dilutions of commercial human IgG (Chemicon International) from 0.2 ng/well up to 50 ng/well were used as positive controls. After washing with PBS-Tween, the plate was incubated with HRP-conjugated goat anti-human IgG (Kirkegaard & Perry Laboratories) diluted at 0.5 µg/ml in PBS containing 1% BSA. The substrate for peroxidase, ABTS (Valeant Pharmaceuticals), was added to the plate and the absorbance at 405 nm read on a Titertek Multiskan Plus plate reader (Titertek).
Flow cytometry analysis
Cells were stained at 4°C for 30 min with the primary Ab HP-F1, specific for the CD85j molecule, then washed with cold PBS, and stained with goat anti-mouse PE-conjugated antiserum (Southern Biotechnology Associates). Staining with UL18Fc recombinant proteins was performed as above with a goat anti-human PE-conjugated antiserum (Southern Biotechnology Associates) as secondary reagent. Cells were analyzed with a FACSCalibur (BD Biosciences) using the CellQuest software.
Surface and intracellular immunofluorescence
Cells were grown on glass coverslips and stained in adherence for simultaneous surface and intracellular immunofluorescence. After surface immunofluorescence staining, by treatment with CD85jFc and Alexa 488 (green)-conjugated goat anti-human IgG (Invitrogen) at 4°C, cells were fixed with 3% paraformaldehyde and permeabilized with 0.05% Triton X-100 before being subjected to intracellular immunofluorescence staining at room temperature with CD85jFc followed by Alexa 546 (red)-conjugated goat anti-human IgG (Invitrogen). Fluorescence was imaged on a Leica SP2-AOBS confocal microscope (Leica Microsystems, Heidelberg, Germany).
Binding assays
Binding experiments were performed with a Biacore 2000 equipped with research-grade CM5 sensor chips (Biacore). A standard amine-coupling protocol (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride, normal human serum, and sodium ethanolamine HCl, pH 8.5) was used to immobilize CD85jFc protein. The immobilization was conducted at a concentration of 58 ng/µl using HBSP (10 mM HEPES, 150 mM NaCl, pH 7.4, 0.005% P-20) as the running buffer. Flowcell 1 was used as a reference cell, and
3800 resonance units of CD85jFc was immobilized in flowcell 2. UL18Fc-wt, its mutants, and HLA-A2Fc were injected at a flow rate of 30 µl/min for 3 min. All the sample concentrations were previously normalized by ELISA. Sample dilutions were prepared in HBS buffer, and binding analyses were performed at a concentration of 200 nM.
Structural modeling
The database entry of the UL18 (human herpesvirus 5 strain AD169) sequence is gi 9625703 ref NP_039952.1.
Blast (22), HHPred (23), and M-coffee (24) with default parameters were used for database searches and multiple sequence alignment, respectively. The database used for searching was the nonredundant protein sequence database.
Secondary structure prediction for UL18 was obtained by the PredictProtein server (25); the secondary structure of the template was obtained by the DSSP program (26). Modeler9v1 (27) was used for model building.
Side chains were modeled using the program Scwrl (28) and were successively analyzed using the program Scit (29), which allows the identification of the structural neighbors of each side chain on the basis of interatomic distances. The model of UL18 in complex with the CD85j receptor was built by superimposition of the conserved main chain region of UL18 and the crystal structure of HLA-A2 bound to CD85j (Brookhaven Protein Data Bank (PDB) code: 1p7q; Ref. 13). The structural alignment was performed using the program FATCAT (30) in its rigid body comparison mode.
The model is available at www.caspur.it/PDMDB with identifier PM0074961.
| Results |
|---|
|
|
|---|
UL18 binds CD85j primarily through its
3 domain (11). We first investigated whether the
3 domain of UL18 is sufficient per se for binding to CD85j or whether the presence of β2m is required. To ascertain this, we constructed a soluble molecule formed by the UL18
3 domain and by the CH2 and CH3 domains of the human IgG1 Ig. The expression of the construct inside the endoplasmic reticulum was restored by adding the leader peptide of the CD33 protein at the 5' end of the molecule. Because this molecule only contains the
3 domain of UL18, its folding is not expected to be significantly influenced by β2m. The resulting protein (UL18
3Fc) was transiently expressed in HeLa cells, and its presence in the supernatant was verified by ELISA. The supernatant was concentrated and used to stain a Jurkat-transfected cell line stably expressing CD85j on the surface (Jurkat/CD85j). The UL18
3Fc recombinant protein was able to bind CD85j on the surface of the Jurkat/CD85j cell line (Fig. 1A). Next, to investigate the role of β2m in the UL18–CD85j interaction, we transiently transfected UL18
3Fc both in the wild-type, β2m-deficient cell line FO-1 and in a FO-1 cell line stably transfected with a vector carrying the β2m cDNA. Supernatants from both transfections were tested for UL18
3Fc presence by ELISA, concentrated and used to stain the Jurkat/CD85j cell line. The UL18
3Fc protein did not bind CD85j when produced in FO-1 cells, whereas the UL18
3Fc protein produced in FO-1 cells stably expressing β2m was able to bind the CD85j molecule (Fig. 1B).
|
|
Structural prediction of the UL18 extracellular portion and identification of conserved sequence regions
The overall architecture of the UL18 molecule is similar to that of MHC class I molecules. UL18 is composed of three domains (
1,
2, and
3): the
1 and
2 domains are predicted to be the peptide-loading domains, and the
3 domain has an Ig-like fold. Comparative modeling techniques can be useful in producing a reliable model of a protein structure provided that a homologous protein of known structure (template) can be identified. The quality and reliability of the model, and therefore its appropriate use, depends on the evolutionary distance between the target and template (31, 32) and on the availability of a good alignment between the sequences of the target protein and its structural template. It is well established that, whenever possible, the pairwise alignment should be derived from a multiple sequence alignment of the protein family including as many sequences as possible, (33) and that these sequences should be evenly distributed in terms of their similarities (34).
We performed a Blast search (22) and used the HHpred publicly available server (23) based on hidden Markov models to identify proteins homologous to UL18. The HHpred server has been shown to be among the best in the last critical assessment of techniques for protein structure prediction experiments (35). Among the retrieved proteins we found, as expected, HLA molecules. In particular, the closest protein of known structure is HLA-A2, sharing 26% sequence identity with UL18.
The retrieved sequences, as well as sequences of UL18 that we derived from nine HCMV-positive donors, were all aligned with UL18 from AD169 strain.5 The alignment was obtained by T-coffee and M-coffee (24). The resulting multiple-sequence alignment contains 44 sequences, 3 of which come from nonhuman viruses: the chimpanzee CMV sequence, the red squirrel poxvirus, and the murine CMV viruses, which share 50, 23, and 22% of sequence identity with human CMV UL18 sequence, respectively. The sequence identity of entries in our alignment ranges between 99 and 22%. The sequence logo derived from the multiple-sequence alignment is shown in Fig. 2.
|
2 domain, 2) a shorter link between domains
2 and
3 (four residues shorter), and 3) the presence of three cysteines in the
3 domain in addition to the two cysteines characteristic of the Ig-like domains. We extracted the pairwise alignment between UL18 and HLA-A2 from the multiple-sequence alignment (Fig. 3) and used it together with the structure recorded in the 1akj entry (36) of the PDB database (37) to build a model using Modeler (27). There are two different determinations of the structure of HLA-A2 (PDB = 1akj, resolution = 2.65; PDB = 1p7q, resolution = 3.40). We selected the 1akj structure because it has a significantly better resolution. The 1p7q structure (13), although at lower resolution, contains a complex between the HLA-A2 molecule and CD85j, so it was used as a template for reconstructing the complex. To achieve this, we first superimposed the main chain atoms of our model with the corresponding regions of 1p7q (267 equivalent positions; root mean square deviation of the C_ atoms = 2.95) and merged the coordinates of the CD85j molecule with those of our model (Fig. 4).
|
|
2 domain (D1–D3) and three in the
3 domain (D4–D6). The first region along the sequence is named D1 (Gly136 to Thr143). This is a Gly-rich region expected to have a high degree of flexibility and predicted by our model to be involved in the interaction between UL18 and β2m.
The second region, named D2 (Gly156 to Lys168), contains a long insertion (nine residues long) when compared with the template. Interestingly, this region, predicted to form an
-helix, could provide additional interactions with CD85j because, in our model, it lies very close to it. However, as mentioned before, D2 is not structurally conserved, and therefore the reliability of our model in this region is necessarily limited.
The next two putative regions of interaction are called D3 (Phe204 to His210) and D4 (Asn219 to Arg224). D3 is the linker region between domains
2 and
3 and is rather different from the corresponding region in HLA-A2 because of the presence of a four-residue gap. This deletion could cause a different orientation of the domains and a higher rigidity of the linker fragment, which could be further increased by the presence of two Pro residues in wild-type UL18, which are absent in HLA-A2. In our model, D4 is directly involved in the interaction with CD85j; however, because of the presence of a deletion, it cannot assume the same conformation as the corresponding region in HLA-A2, and the model predicts that the residues of UL18 involved in the interaction in this region might differ from those of HLA-A2. The UL18 D4 residue Asp222, although conserved between the viral and human proteins, is in a different relative position than the corresponding Asp196 of HLA-A2. The HLA-A2 Asp196 interacts with Tyr76 of CD85j, while the UL18 Asp222 is rather far from this residue. Furthermore, in our model, UL18 Glu226 interacts with CD85j Lys42, and UL18 Arg224 forms an ion pair with CD85j Glu40 (distance 3.46 Å). UL18 Arg224 structurally corresponds to HLA-A2 Glu198, which interacts with CD85j Lys41 (distance 3.95 Å). This region is very well conserved among the UL18 variants, with the only exception being the substitution of Gln220 which is a His in 11 of 30 UL18 sequences (Fig. 5).
|
The D6 region contains three additional cysteine residues. From a visual inspection of the model, two of these, Cys258 and Cys273, belong to the same β-sheet (filaments D and E of the β-sandwich domain) and may form a disulfide bridge. Consistently with this hypothesis, these residues are highly conserved among the UL18 sequences (Fig. 5). The entire D5–D6 region is a proline-rich fragment, containing four Pro residues (Pro260 and Pro263 in D6, Pro251 and Pro256 in D5) that are highly conserved among the HCMV sequences (Pro263 also among CMV of other species and throughout the whole HLA family). They could confer significant rigidity to this domain and could affect the binding between the D6 fragment and β2m. The D6 region contains another cysteine (Cys279) that is exposed to the solvent and conserved only in HCMV.
Mutational analysis of the
3 domain of the UL18 molecule
Analyses of both the model and the multiple-sequence alignment led us to design a set of cassette mutants with the aim of obtaining a more detailed picture of the role of the D1–D6 regions in the UL18–CD85j interaction. We chose to replace these regions of the UL18Fc-wt molecule with the corresponding regions of the HLA-A2 sequence. The mutations were selected by taking into account the three-dimensional model of the protein, and they are therefore located in regions unlikely to be part of the conserved core or to be important for maintaining the fold of the protein. Because of this and because of the structural similarity between UL18 and HLA-A2, we expect the mutations not to change the overall fold of the chimeric molecules.
We constructed the following mutants: UL18Fc-D4, UL18Fc-D5, and UL18Fc-D6 (Fig. 3). These mutated UL18Fc molecules were produced by transiently transfecting HEK293T cells. The presence of the recombinant protein was verified by ELISA, and the supernatant was then concentrated 100x and used to stain the Jurkat/CD85j cell line. This procedure was used for the production of all recombinant proteins and for all cytofluorimetric analyses except where noted. Consistent with our expectations, the results show that all mutants lose their capacity to bind CD85j (Fig. 6B).
To have a more sensitive measurement method for evaluating the binding capacity of the UL18Fc mutants to CD85j, we performed binding measurements using Biacore. We consequently obtained HEK293T cell lines stably transfected with UL18Fc-wt, UL18Fc mutants, and HLA-A2Fc. These transfectants were used to produce high amounts of recombinant proteins. The supernatants were collected, purified, and dialyzed, and their recombinant protein concentrations were normalized by ELISA as described in Materials and Methods. Furthermore, we produced and purified soluble CD85j protein (CD85jFc) from the supernatants obtained by culturing Sp2/0 cells stably transfected with the CD85jFc construct. The CD85jFc molecule was immobilized on a biosensor chip where the recombinant purified proteins were injected and Biacore analysis was performed. This procedure was used for all Biacore analyses. With Biacore measurements no binding of UL18Fc-D4, UL18Fc-D5, and UL18Fc-D6 to CD85jFc was observed (Fig. 7, B and D). This result is in agreement with our model that predicts D4 to directly mediate the interaction with CD85j, an indirect role for the D5 region in binding β2m, and the presence of a potentially important disulfide bridge in D6.
|
The results of the cytofluorimetric analysis of the above mutants are as follows (Fig. 6C): 1) Mutants UL18Fc-D6M1, UL18Fc- D6M6, and UL18Fc- D6M7 do not bind CD85j. The result obtained with the UL18Fc-D6M1 mutant strongly supports the presence of a disulfide bridge between Cys258 and Cys273. The result obtained with the UL18Fc-D6M6 emphasizes the structural role of Pro260 and Pro263 (the latter is very well conserved also in the HLA family), which can significantly contribute to the rigidity of the domain. Furthermore, according to our model, Pro263 may specifically interact with β2m. Finally, loss of binding of the UL18Fc-D6M7 mutant is consistent with our prediction that Asp266 is involved in the interaction with β2m, which, in turn, is necessary for the interaction with CD85j. 2) Mutants UL18Fc-D5M4 and UL18Fc- D6M5 retained binding capacity. The Pro251 mutated in UL18Fc-D5M4 is located, in our alignment, inside an insertion with respect to HLA-A2, and it is situated in the corresponding CD85j-binding area. It probably has a structural role (contributing to the rigidity of the local structure), but, as predicted by our model, does not seem to play a major role in the interaction with CD85j or β2m. Similarly, the two leucine residues mutated in UL18Fc-D6M5 (Leu261 and Leu262) are predicted to not directly interact with the β2m, differing from what is observed for the corresponding region in HLA-A2. In our model, Leu261 is oriented toward the core of the UL18 molecule, while Leu262 is more exposed. 3) Mutants UL18Fc-D5M8 and UL18Fc-D6M9 bind CD85j better than UL18Fc-wt. As mentioned earlier, in our model the D5 region does not seem to be involved in the interaction between UL18 and CD85j. The data suggest that the increased flexibility of this region upon mutation of Pro256 might favor the formation of novel interactions with CD85j. The result for the UL18Fc-D5M8 mutant confirms our model, as the D5 region is not essential for the interaction between UL18 and CD85j.
All of the above mutants, except for UL18Fc-D6M7, were used for Biacore analyses of their binding to CD85jFc (Fig. 7, B and D). Unfortunately, we were not able to obtain a stable transfectant producing the UL18Fc-D6M7 protein. The Biacore analysis showed that UL18, as well as all the mutants, bind to CD85j with a good binding stability and a dissociation rate much slower than that of the natural binder HLA-A2 (see slopes of the dissociation curves in Fig. 7D). The only mutant that shows a different dissociation profile is UL18Fc-DM4, which has a faster dissociation compared with the UL18Fc-wt, but it is still slower when compared with HLA-A2. This faster dissociation may explain why its binding to CD85j is higher by Biacore analysis, although it is lower than UL18Fc-wt by flow cytometry. Altogether, taking into account the differences in the protein production method and sensitivity in the two systems, the data obtained by Biacore for these mutants are in good agreement with those obtained with the cytofluorimetric analysis.
We also constructed a mutant of the wild-type transmembrane UL18 molecule in which Cys279 was mutated to Ser and Tyr362 and Lys374 were mutated to Ala (UL18-M10). The Cys279 was predicted by our model to be exposed on the surface of the molecule and therefore available for intermolecular disulphide bonds, whereas Tyr362 and Lys364 are involved in regulation of the intracellular trafficking of UL18 (41). Basically, Tyr362 and Lys364 were mutated to allow the UL18-M10 mutant to be expressed on the surface of the cell. The UL18-M10 mutant construct was used to transiently transfect HeLa cells. After 24 h the cells were stained with the recombinant protein CD85jFc and analyzed by confocal microscopy (Fig. 7A). The figure shows that CD85jFc bound to the UL18-M10 mutant, thus revealing that Cys279 is not directly involved in binding of the two molecules.
Mutational analysis the
2 domain of the UL18 molecule
To further investigate the role of the
2 domain regions identified by our model in the UL18–CD85j interaction, we designed three cassette mutants in this domain: UL18Fc-D1, UL18Fc-D2, and UL18Fc-D3 (Fig. 3). The D1 region is predicted to interact with β2m. It is rich in Gly residues and is therefore expected to be very flexible. In UL18Fc-D1, we replaced it with the corresponding less flexible HLA-A2 sequence. In UL18Fc-D2, we substituted a region predicted to have an
-helix structure with the shorter HLA-A2 corresponding sequence. In UL18Fc-D3, we replaced the short (7 residues) UL18 loop, located at the boundary between the
2 and
3 domains, with the longer and more structured corresponding portion of HLA-A2 (11 residues, 4 of which are in
-helical conformation).
Results of the cytofluorimetric analysis show that mutants UL18Fc-D1 and UL18Fc-D3 did not bind CD85j. Surprisingly, mutant UL18Fc-D2 showed a higher binding capacity compared with UL18Fc-wt (Fig. 6B).
For mutants UL18Fc-D2 and UL18Fc-D3, we also perfomed Biacore analysis (Fig. 7, B and C). No binding of UL18Fc-D3 was observed, whereas UL18Fc-D2 bound CD85j better than did UL18Fc-wt, as shown by cytofluorimetric analysis. Different UL18Fc-D2 dilutions were used for Biacore analysis showing that an eight-fold diluted solution of UL18Fc-D2 binds CD85j with the same capability of undiluted UL18Fc-wt (Fig. 7E).
In the first two cases, the results are consistent with our model. In the UL18Fc-D1 mutant, the binding with β2m is expected to be disrupted. The UL18Fc-D3 mutant, where a linker region is replaced with a longer and more flexible region, is likely to cause a different orientation of the
3 and
1–2 domains. The results obtained with the UL18Fc-D2 mutant cannot be easily explained on the basis of our three-dimensional model. This implies that this region plays a different function in UL18 with respect to its counterpart in HLA-A2 (e.g., a regulatory role).
We next focused on the role played by selected amino acid residues inside the UL18Fc-D3 cassette. We constructed the following mutants: UL18Fc-D3M2 (Pro207 to Ala) and UL18Fc-D3M3 (His210 to Ala) (Fig. 3). The results of the cytofluorimetric analysis showed that the UL18Fc-D3M2 mutant weakly bound CD85j whereas UL18Fc-D3M3 was not able to bind CD85j (Fig. 6C).
The Biacore analysis confirmed the weak binding of UL18Fc-D3M2 and showed a very low level of binding of UL18Fc-D3M3 to CD85j (Fig. 7, B and D). These results point to an important role played by Pro207 and His210 in the UL18–CD85j interaction. Our model suggests that the role played by Pro207 is likely to be structural and related to the rigidity of the linker region, while His210 (which forms hydrogen bonds with UL18
3 domain CD85j residues) is predicted to be important for the correct orientation of the
3 domain with respect to CD85j.
| Discussion |
|---|
|
|
|---|
1000-fold higher than MHC class I molecules (11). The class I-like molecule HFE, in which the
3 domain was replaced with the
3 domain of the UL18 molecule, is able to bind CD85j, indicating that the primary sites of interaction are in the
3 domain and/or in the β2m; also, both the extensive UL18 glycosylation and the presence or absence of a loaded peptide do not influence its binding to CD85j (11). Furthermore, CD85j bind both class I MHC molecules and UL18 through the same D1 and D2 domains (12). In the work presented here, we attempted to dissect the structural determinants of binding of UL18 to CD85j. We constructed a three-dimensional model of the complex and used it to design mutants in selected regions of the putative interaction interface and to interpret their effects on binding. The model was built by comparative modeling and therefore can be effectively used to predict the role of structurally conserved regions and to rationally design mutants unlikely to affect the overall structure of the protein. The detailed structural prediction of regions where evolutionary changes are expected to modify the structure more substantially (e.g., where insertions and deletions are present) is unfortunately still beyond our present capabilities. Nevertheless, in these regions, if used in conjunction with experimental data, a model can still be used to derive general conclusions about the putative functional effect of the structural differences.
Using this strategy, we identified six regions (named D1 to D6) in both the
2 and
3 domains and specific amino acids within them, potentially involved in the UL18–CD85j function and interaction and unlikely to be involved in the overall stabilization of the fold. These regions were replaced with the equivalent regions of HLA-A2, with the rationale that the structural similarity of this latter molecule with UL18 would reduce the probability of mutations causing major structural effects.
We first investigated whether β2m is necessary for binding to CD85j. Our results indicate that the UL18
3 domain is not sufficient per se for binding and that the presence of the β2m is required. This suggests a direct role of β2m in the interaction. Additionally, mutations in β2m residues described to interact with CD85j in the CD85j/HLA-A2 complex structure (13) almost completely abolish the UL18–CD85j interaction.
The complete replacement of each of the D1–D6 regions, except for UL18Fc-D2, led to mutants unable to bind the CD85j molecule, suggesting a key role of these regions in the UL18–CD85j interaction. Surprisingly, the UL18Fc-D2 mutant showed a significantly increased binding affinity for CD85j. Because the D2 region is not structurally conserved between the CD85j molecule and the structural template HLA-A2, our model must be speculative in this region. We speculate that the substitution reduces the rigidity of the segment, predicted to be structured as an
-helix in CD85j but not in HLA-A2, and therefore allows more interactions to take place. This aspect requires further investigation, as it might be important for understanding specific aspects of the UL18 interactions and, possibly, for its regulation.
The D4 region is the only one predicted to directly interact with CD85j, although its conformation is different from that of its HLA-A2 counterpart. Regions D1 and D6 seem to play a role in interaction with β2m, probably affecting its direct interaction with CD85j. Region D3, situated at the boundary between the
2 and
3 domains, may affect the relative orientation of the two domains, whereas region D5 may play a structural role.
We do not have direct biophysical evidence that our cassette mutants preserve a protein folding closely similar to native UL18, except for UL18Fc-D2 mutant. The fact that this mutant binds UL18 with a higher affinity than does UL18Fc-wt indicates that, at least in the regions interacting with UL18, the folding of the protein is maintained as fully functional. UL18Fc-D1 and especially UL18Fc-D4 are mutants in which a short cassette is replaced and no insertions or deletions are present, making it very unlikely that the fold is different from the wild-type molecule. This might not be true for mutants UL18Fc-D3, UL18Fc-D5, and UL18Fc-D6 where, in fact, the mutated regions were investigated in more detail.
To further dissect the role of these regions in the interaction with CD85j, we mutated single or a few amino acids in some of them. Amino acids with peculiar characteristics (e.g., disulfide bridge formation, structure rigidity, steric hindrance, and electric charge) within regions shown to be potentially important by the model were chosen to infer the importance of such regions. Most mutations were likely to modify the local folding of the protein. Conversely, mutants that were likely not to mutate the local folding (i.e., UL18Fc-D5M4 and UL18Fc-D6M9) were observed not to significantly modify the UL18–CD85j interaction. This analysis showed that there are positions that play a pivotal role in the UL18–CD85j interaction. The mutation of His210 alone (UL18Fc-D3M3 mutant) almost completely abolished binding to CD85j. The mutation of Cys258 and Cys273 (UL18Fc-D6M1) also had a dramatic effect on the binding of UL18 to CD85j, suggesting that they may form a disulfide bridge, as predicted by our model. Furthermore, the loop formed by Cys258 and Cys273 contains two Pro (Pro260 and Pro263) that, when mutated (UL18Fc-D6M6), dramatically reduced the binding to CD85j, strongly suggesting that both the structure and flexibility of this region are important for binding. Of note, a very recent study investigated the structural elements that underlie the UL18 high affinity for CD85j. The results pointed out, in accordance with our study, the importance of the D4 region as well as the pivotal role of the disulfide bridge formed by Cys258 and Cys273 (40).
A few interesting speculations can be derived from our analysis. Both the family sequence alignment and the fact that regions selected on the basis of the HLA-A2/CD85j/β2m template structure do affect binding of UL18 strongly suggest that the architecture of the complex is conserved. Furthermore, no large insertions or regions expected to have substantially different local structure are present in the regions involved in the interaction, and both experimental and modeling results indicate that the binding of UL18 to CD85j is mediated by several regions that correspond to those known to interact in the HLA-A2 complex. Taken together, our results suggest that the higher affinity of UL18 compared with class I MHC molecule is unlikely to be brought about by the presence of additional interaction regions, but rather by an overall better fit of the two molecules, possibly brought about by a combination of changes in the flexibility of key parts of the interface and/or by subtle effects that could lead to more effective exploitation of the involvement of the β2m moiety in complex formation.
The results presented here, together with the three-dimensional model of the complex now publicly available, are important for understanding details of the complex interactions between UL18 and its host partner, and may contribute to comprehension of the molecular basis of UL18 function.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by grants from Fondazione Compagnia di San Paolo, Ministero per lIstruzione, lUniversità e la Ricerca Scientifica, and Progetto Finalizzato Ministero della Salute (to E.C.), and was partially supported by the European Commission within its FP6 Programme contract number LSHG-CT-2003-503265, and by the Istituto Pasteur Fondazione Cenci Bolognetti (to A.T.). ![]()
2 M.O. and F.G. contributed equally to this work. ![]()
3 Address correspondence and reprint requests to Dr. Fabio Ghiotto, Department of Experimental Medicine, University of Genoa, Via De Toni 14, 16132 Genoa, Italy. E-mail address: fghiotto{at}unige.it ![]()
4 Abbreviations used in this paper: HCMV, human cytomegalovirus; β2m, β2-microglobulin; PDB, Brookhaven Protein Data Bank. ![]()
5 The online version of this article contains supplemental material. ![]()
Received for publication July 24, 2007. Accepted for publication October 30, 2007.
| References |
|---|
|
|
|---|
(
) and HLA-A2. Nature 387: 630-634. [Medline]This article has been cited by other articles:
![]() |
Z. Yang and P. J. Bjorkman Structure of UL18, a peptide-binding viral MHC mimic, bound to a host inhibitory receptor PNAS, July 22, 2008; 105(29): 10095 - 10100. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Maffei, F. Ghiotto, M. Occhino, M. Bono, A. De Santanna, L. Battini, G. L. Gusella, F. Fais, S. Bruno, and E. Ciccone Human Cytomegalovirus Regulates Surface Expression of the Viral Protein UL18 by Means of Two Motifs Present in the Cytoplasmic Tail J. Immunol., January 15, 2008; 180(2): 969 - 979. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |