The Journal of Immunology, 2008, 180, 809-816
Copyright © 2008 by The American Association of Immunologists, Inc.
Endosomal Translocation of CpG-Oligodeoxynucleotides Inhibits DNA-PKcs-Dependent IL-10 Production in Macrophages1
Satoshi Yotsumoto,
Kazuharu Saegusa and
Yukihiko Aramaki2
Tokyo University of Pharmacy and Life Science, Tokyo, Japan
 |
Abstract
|
|---|
Synthetic oligodeoxynucleotides containing unmethylated CpG motifs (CpG-ODNs) function as powerful immune adjuvants by activating macrophages, dendritic cells, and B cells. However, the molecular recognition mechanism that initiates signaling in response to CpG-ODN has not fully been identified. We show in this study that peritoneal macrophages from SCID mice having mutations in the catalytic subunit of DNA-protein kinase (DNA-PKcs) were almost completely defective in the production of IL-10 and in ERK activation when treated with CpG-ODN. In contrast, IL-12 p70 production significantly increased. Furthermore, small interfering RNA (siRNA)-mediated knockdown of DNA-PKcs expression in the mouse monocyte/macrophage cell line RAW264.7 led to reduced IL-10 production and ERK activation by CpG-ODN. IL-10 and IL-12 p70 production, but not ERK activation, are blocked by chloroquine, an inhibitor of endosomal acidification. Endosomal translocation of CpG-ODN in a complex with cationic liposomes consisting of 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP) (CpG-DOTAP-liposomes) decreased IL-10 production and ERK activation, whereas the endosomal escape of CpG-ODN in a complex with cationic liposomes consisting of DOTAP and dioleyl-phosphatidylethanolamine (DOPE) (CpG-DOTAP/DOPE-liposomes) increased. In contrast, IL-12 p70 production was increased by CpG-DOTAP-liposomes and decreased by CpG-DOTAP/DOPE-liposomes. IL-10 production induced by CpG-DOTAP/DOPE-liposomes was not observed in macrophages from SCID mice. Thus, our findings suggest that DNA-PKcs in the cytoplasm play an important role in CpG-ODN-induced production of IL-10 in macrophages. In addition, DNA-PKcs-mediated production of IL-10 and IL-12 p70 can be regulated by manipulating the intracellular trafficking of CpG-ODN in macrophages.
 |
Introduction
|
|---|
Oligodeoxynucleotides (ODNs)3containing unmethylated CpG motifs (CpG-ODNs) are powerful immunomodulatory agents capable of activating both humoral and cellular immunities. Studies in vitro and in vivo have shown that CpG-ODNs can directly stimulate macrophages, dendritic cells (DCs), and B cells to induce the production of cytokines such as IL-6, IL-10, IL-12, IFN-
β, and TNF-
and facilitate the activation of the type 1 helper T cell immune response. Consequently, CpG-ODN is expected to be an adjuvant for the treatment of cancers, infections, and allergic diseases (1, 2).
IL-10 has been shown to be a major counter-regulatory cytokine that can influence the immunomodulatory effects of IL-12 directly or indirectly (3, 4, 5). In contrast, bioactive IL-12 p70, which is composed of two disulfide-linked subunits (p35 and p40) encoded by separate genes, has been shown to be an important mediator of cellular immunity (6). In recent studies, treatment with CpG-ODN plus the anti-IL-10 receptor mAb strikingly enhanced antitumor activity, and CpG-ODN effectively induced tumor rejection in tumor-bearing IL-10 knockout mice (7, 8, 9). Indeed, IL-12 production was increased in IL-10-deficient mice. Thus, the reverse relationship between IL-10 and IL-12 is an important factor for the effective induction of cellular immunity by CpG-ODN. However, the regulatory mechanism of IL-10 and IL-12 production induced by CpG-ODN is not fully understood.
Previous studies established that CpG-ODN-induced immune responses are mediated by TLR9 (10). CpG-ODN interacts with TLR9 in endosomal vesicles and endosomal acidification is required for this interaction (11, 12, 13, 14), whereas a recent study found that CpG-ODN rescues DC and B cells from spontaneous apoptosis by activating NF-
B and Akt (15, 16), and Akt activation induced by CpG-ODN is independent of TLR9 (17). Thus, immune activation by CpG-ODN is mediated by TLR9-dependent and -independent signaling pathways.
DNA-PK is a serine/threonine protein kinase composed of a large 470-kDa catalytic subunit (DNA-PKcs) and Ku70/80 subunits (18, 19). Originally identified as a nuclear protein in human cells (20), DNA-PK was later found in the cytoplasm (21, 22). In the nucleus, DNA-PK plays a pivotal role in the repair of DNA double-stranded breaks created by environmental insults such as ionizing radiation or by intrinsic cellular processes such as programmed DNA rearrangements during lymphocyte differentiation (e.g., VDJ recombination) (18, 19). In contrast, the cytoplasmic functions of DNA-PKcs are unclear.
In this study, we investigated the contribution of DNA-PKcs to the production of IL-10 and IL-12 induced in mouse peritoneal macrophages following CpG-ODN treatment. Furthermore, we investigated whether the intracellular trafficking of CpG-ODN is involved in the regulation of IL-10 and IL-12 production through DNA-PKcs signaling.
 |
Materials and Methods
|
|---|
Mice
BALB/c, BALB/c SCID, C.B-17/lcr+/+, and C.B-17/lcr-SCID/SCID mice were purchased from CLEA Japan. All mice were used at 6 to 10 wk of age. Animal use and relevant experimental procedures were approved by the Tokyo University of Pharmacy and Life Science Committee on the Care and Use of Laboratory Animals.
Cell culture
The mouse monocyte/macrophage cell line RAW264.7 was maintained in RPMI 1640 supplemented with 100 U/ml penicillin, 100 µg/ml streptomycin, and 10% FCS.
Reagents and Abs
HPLC-purified phosphorothioate ODNs were obtained from Texas Genomics Japan. CpG-ODN and 5'-rhodamine-labeled CpG-ODN (TCCATGACGTTCCTGATGCT; underlining indicates the CpG motif) consist of 20 bases. 1,2-Dioleoyl-3-trimethylammonium-propane (DOTAP) and dioleyl-phosphatidylethanolamine (DOPE) were purchased from Avanti Polar Lipids.
Preparation of mouse peritoneal macrophages
BALB/c, BALB/c SCID, C.B-17/lcr-+/+, or C.B-17/lcr-SCID/SCID mice were injected i.p. with 1 ml of 3% thioglycollate (Difco Laboratories). On day 4, peritoneal exude cells were obtained by peritoneal lavage with 10 ml of ice-cold HBSS (Ca2+ and Mg2+ free) supplemented with 10 U/ml heparin. The peritoneal exude cells were washed twice, resuspended in RPMI 1640 medium, and dispensed into plastic plates. The plates were incubated in humidified 5% CO2 at 37°C for 1 h to allow macrophages to adhere, and a macrophage monolayer was obtained.
Detection of IL-10 and IL-12 p70 levels
Macrophages (5 x 105 cells) were incubated with CpG-ODN or non-CpG-ODN at 37°C for 18 h in 96-well culture plates, and IL-10 and IL-12 p70 concentrations in the culture supernatant were measured by sandwich ELISA using rat anti-mouse IL-10 and IL-12 p70 mAb (BD Pharmingen) as the capture Abs and biotinylated rat anti-mouse IL-10 and IL-12 p40/p70 mAb (BD Pharmingen) as the detection Abs, respectively.
siRNA treatments
DNA-PKcs-specific small interfering RNA (siRNA) (Stealth RNAi; Invitrogen Life Technologies) was transfected into RAW264.7 cells (1 x 105 cells) using Lipofectamine 2000 (Invitrogen Life Technologies) according to the manufacturers instructions. Cells were incubated for 24 h. DNA-PKcs knockdown was controlled by flow cytometry and compared with Stealth RNAi Negative Control Low GC Duplex (Invitrogen Life Technologies).
Preparation of CpG-liposomes
Lipids (10 µg of DOTAP only or 10 µg of DOTAP and 15.98 µg of DOPE at a ratio of 2:3 mol) were dried in a test tube under N2 gas and desiccated under a vacuum for at least 15 min. The dry lipid films were hydrated by the addition of 1 ml of HEPES-buffered saline (HBS; 20 mM HEPES and 150 mM NaCl (pH 7.4)), and DOTAP-liposomes and DOTAP-/DOPE-liposomes were prepared. CpG-ODN (5 µg) in 50 µl of HBS was mixed with DOTAP-liposomes or DOTAP/DOPE-liposomes in 50 µl of HBS. After 15 min of incubation, 100 µl of complete RPMI 1640 medium was added to the mixture of CpG-ODN and liposomes (CpG-DOTAP-liposomes or CpG-DOTAP/DOPE-liposomes). Macrophages (5 x 105 cells) in 100 µl of complete medium were incubated with 100 µl of CpG-DOTAP-liposomes or CpG-DOTAP/DOPE-liposomes for 18 h in 96-well culture plates.
CpG-ODN association
To determine the association of CpG-ODN or CpG-liposomes with macrophages, a flow cytometric analysis was performed. Cells were incubated with rhodamine (Rho)-labeled CpG-ODN (Rho-CpG-ODN) at 4°C or 37°C for 30 min. The cells were analyzed with a FACSCalibur flow cytometer. Data were analyzed using Cell Quest software (BD Biosciences).
Western blotting
Following treatment with CpG-ODN (0.2 µM) at 37°C for 30 min, macrophages (1 x 106 cells) were scraped off and lysed with lysis buffer (10 mM Tris-buffer (pH 7.2), 150 mM NaCl, 1% Triton X-100, 0.1 mM Na3VO4, 1 mM PMSF, 5 mM EDTA, 10 µg/ml aprotinin, and 10 µg/ml leupeptin) at 4°C for 1 h. Cell lysates (0.5 µg as protein) were separated by electrophoresis on 12% SDS-polyacrylamide gels and transferred onto Immobilon P membranes (Nihon Millipore). The membranes were blocked in 5% nonfat milk in TBS containing 0.1% Tween 20. For the determination of ERK and phosphorylated ERK, a PhosphoPlus MEK1/2 (Ser217/221) Antibody Kit (Cell Signaling Technology) was used. Specific bands were detected with an ECL assay kit (Amersham Biosciences). The intensity of each band was measured using NIH Image software.
Confocal laser scanning microscopy
Macrophages (1 x 105 cells) were incubated with Rho-CpG-ODN (0.2 µM) and/or Alexa 488-labeled transferrin for 30 or 45 min. The cells were washed with ice-cold PBS to remove excessive Rho-CpG-ODN. Subsequently, they were fixed in 2% formalin in PBS for 15 min at room temperature, permeabilized with 0.2% saponin and 0.2% BSA in PBS for 15 min, and incubated with anti-DNA-PKcs mAb (Lab Vision) at 4°C overnight. They were then incubated with Alexa 488-labeled goat anti-mouse IgG Ab (Invitrogen Life Technologies) for 2 h at room temperature. Cells were viewed with µRadiance (Bio-Rad).
In vivo experiments
CpG-ODN (5 µg) was dissolved in 100 µl of HBS. DOTAP (109.8 µg) was suspended in 100 µl of HBS. Subsequently, the CpG-ODN solution was mixed with the DOTAP-liposome solution and incubated for 15 min. Two hundred microliters of CpG-ODN-DOTAP-liposome was injected i.v. After 3 h the mice were killed, blood was collected, and IL-10 and IL-12 p70 levels in the serum were determined by ELISA.
Statistical analysis
Data are the means and SD values for three independent experiments with three replicates each. Statistical differences were determined at the level of p < 0.05, 0.01, 0.005 or 0.001 with Students t test or ANOVA.
 |
Results
|
|---|
The differential role of DNA-PKcs on CpG-ODN-induced IL-10 and IL-12 p70 production in macrophages
We first investigated whether DNA-PKcs contributes to CpG-ODN-induced IL-10 and IL-12 p70 production in mouse peritoneal macrophages. We used macrophages isolated from SCID mice in which a T to A mutation in the DNA-PKcs gene creates an unstable, truncated protein missing the last 83 amino acids of the kinase domain (23, 24, 25). As shown in Fig. 1A, the production of IL-10 in C.B-17 SCID and BALB/c SCID macrophages was much lower than that in the wild-type cells. In contrast, the level of IL-12 p70 is markedly higher in SCID macrophages than in the wild-type cells. Furthermore, siRNA-mediated knockdown of DNA-PKcs expression in the mouse monocyte/macrophage cell line RAW264.7 led to a reduction of the level of DNA-PKcs expression. The specificity of DNA-PKcs down-regulation mediated by siRNA was further confirmed by testing a negative control (Fig. 1B). Knockdown of the DNA-PKcs partly inhibited CpG-ODN-induced IL-10 production, whereas IL-12 p70 production in RAW264.7 cells was not observed under any conditions (Fig. 1C). These results suggest that DNA-PKcs activity is essential for IL-10 production and negatively regulates IL-12 p70 production in macrophages stimulated with CpG-ODN.

View larger version (20K):
[in this window]
[in a new window]
|
FIGURE 1. The different roles of DNA-PKcs in CpG-ODN-induced IL-10 and IL-12 p70 production in macrophages. A, Macrophages from SCID and wild-type mice were incubated with various concentrations of CpG-ODN for 18 h and assayed for IL-10 and IL-12 production using ELISA as described in Materials and Methods. The values are the means ± SD of triplicate cultures from three independent experiments. Asterisks indicate statistically significant differences between IL-10 and IL-12 production in SCID macrophages vs wild-type macrophages (*, p < 0.05; **, p < 0.01; ***, p < 0.005; or ****, p < 0.001). B, RAW264.7 cells (1 x 105 cells) were treated with DNA-PKcs siRNA (100 nM) for 24 h and the cells were fixed, permeabilized, and stained with anti-DNA-PKcs mAb and Alexa 488-labeled anti-mouse IgG Ab. The expression of DNA-PKcs was determined by flow cytometry. C, RAW264.7 cell (1 x 105 cells) were pretreated with DNA-PKcs siRNA (100 nM) for 24 h, incubated with CpG-ODN (0.2 µM) for 18 h, and assayed for IL-10 and IL-12 production using ELISA as described in Materials and Methods. The values are the means ± SD of triplicate cultures from three independent experiments. Asterisks indicate statistically significant differences between IL-10 production in DNA-PKcs siRNA-treated cells vs negative control siRNA-treated cells (**, p < 0.01). N.D. = not detected.
|
|
DNA-PKcs is essential for ERK activation
We recently reported that ERK signaling is essential for CpG-ODN-induced IL-10 production in macrophages (26). However, the molecular mechanism behind the activation of the ERK pathway is not clear. We investigated the role of DNA-PKcs in the activation of ERK. Wild-type and SCID macrophages were treated with CpG-ODN and the activation of ERK was determined by Western blotting. As shown in Fig. 2A, in wild-type macrophages the activation of ERK was observed as early as 5 min and decayed after 30 min. In contrast, the DNA-PKcs mutation impaired the activation of ERK by CpG-ODN.

View larger version (23K):
[in this window]
[in a new window]
|
FIGURE 2. DNA-PKcs is essential for CpG-ODN-induced ERK activation. A, Macrophages from SCID and wild-type mice were stimulated with CpG-ODN (0.2 µM) for the indicated times. B, RAW264.7 cell were pretreated with DNA-PKcs siRNA (100 nM) for 24 h and incubated with CpG-ODN (0.2 µM) for 5 min. Protein extracts were analyzed by Western blotting using specific Abs against phosphorylated ERK (pERK).
|
|
In addition, siRNA-mediated knockdown of DNA-PKcs expression in RAW264.7 cells was associated with a decrease in ERK activation (Fig. 2B). Our findings suggest that DNA-PKcs acts upstream of ERK in macrophages.
The role of DNA-PKcs in the cytoplasm on CpG-ODN-induced IL-10 and IL-12 p70 production
CpG-ODN is internalized via endocytosis and rapidly moves into the lysosomal compartment. Endosomal acidification is required for the binding of CpG-ODN to TLR9 and the CpG-ODN-induced release of cytokines (12, 13, 14, 15). Chloroquine, an inhibitor of endosomal acidification (11, 12, 14), was shown to block these events. As shown in Fig. 3A, chloroquine inhibited IL-10 and IL-12 p70 production in a dose-dependent manner. In contrast, the activation of ERK was not affected by chloroquine (Fig. 3B). These results suggest that the activation of ERK is independent of TLR9 signaling. We hypothesized that DNA-PKcs in the cytoplasm, but not in endosomes, contributes to CpG-ODN responses. To test this hypothesis, we examined whether IL-10 and IL-12 production could be regulated by manipulating the intracellular trafficking of CpG-ODN in macrophages. CpG-ODN complexed with cationic liposomes composed of DOTAP (CpG-DOTAP-liposomes) can be effectively translocated to the endosomal compartment of macrophages and DCs (27, 28). In contrast, cationic liposomes containing DOPE (29, 30, 31, 32, 33) are frequently used to release liposomal contents, such as pDNA and antisense DNA, from the endosome into the cytoplasm. As shown in Fig. 4, CpG-DOTAP-liposomes reduced IL-10 production to the control level and enhanced IL-12 p70 production in macrophages compared with CpG-ODN. In contrast, CpG-DOTAP/DOPE-liposomes enhanced IL-10 and reduced IL-12 p70 production. These results suggest that DNA-PKcs in the cytoplasm plays an important role in CpG-ODN-induced IL-10 and IL-12 p70 production.

View larger version (26K):
[in this window]
[in a new window]
|
FIGURE 3. Endosomal acidification is required for CpG-ODN-induced IL-10 and IL-12 production but not for ERK activation. A, Macrophages from BALB/c mice were pretreated with chloroquine for 20 min and then incubated with CpG-ODN (0.2 µM) for 18 h and assayed for IL-10 and IL-12 production using ELISA as described in Materials and Methods. The values are the means ± SD of triplicate cultures from three independent experiments. B, Macrophages (2.5 x 106/ml) were pretreated with chloroquine for 20 min and then incubated with CpG-ODN (0.2 µM) for 15 min. Protein extracts were analyzed by Western blotting using specific Abs against phosphorylated ERK (pERK).
|
|

View larger version (19K):
[in this window]
[in a new window]
|
FIGURE 4. Endosomal translocation of CpG-ODN completely abolishes IL-10 and enhances IL-12 p70 production. Macrophages from BALB/c mice were incubated with CpG-ODN (0.2 µM), CpG-DOTAP-liposomes, or CpG-DOTAP/DOPE-liposomes for 18 h and assayed for IL-10 and IL-12 production using ELISA as described in Materials and Methods. The values are the means ± SD of triplicate cultures from three independent experiments. Asterisks indicate statistically significant differences between IL-10 and IL-12 production in CpG-DOTAP-liposome-treated or CpG-DOTAP/DOPE-liposome-treated macrophages vs CpG-treated-macrophages (*, p < 0.05 or **, p < 0.01).
|
|
Endosomal translocation of CpG-ODN completely abolishes ERK activation
We examined the effect of manipulating the intracellular trafficking of CpG-ODN on the activation of ERK in macrophages. As shown in Fig. 5, CpG-DOTAP-liposomes completely abolished the activation as compared with CpG-ODN alone. In contrast, ERK activation by CpG-DOTAP/DOPE-liposomes was enhanced. This result suggests that the DNA-PKcs in the cytoplasm acts upstream of ERK.

View larger version (39K):
[in this window]
[in a new window]
|
FIGURE 5. Endosomal translocation of CpG-ODN completely abolishes ERK activation. Macrophages from BALB/c mice were incubated with CpG-ODN (0.2 µM), CpG-DOTAP-liposomes, and CpG-DOTAP/DOPE-liposomes for 15 min. Protein extracts were analyzed by Western blotting using specific Abs against phosphorylated ERK (pERK).
|
|
Intracellular distribution of DNA-PKcs in macrophages
We investigated the location of CpG-ODN and DNA-PKcs in macrophages. As expected, DNA-PKcs was mainly distributed in the nucleus and cytoplasm.
No colocalization of CpG-ODN and DNA-PKcs was observed in macrophages treated with CpG-ODN alone and CpG-DOTAP-liposomes. In contrast, CpG-ODN complexed to DOTAP/DOPE-liposomes colocalized with DNA-PKcs (Fig. 6A). Furthermore, CpG -DOTAP-liposomes predominantly merged with endosomal marker transferrin in macrophages. Meanwhile, CpG-ODN and CpG-DOTAP/DOPE-liposomes slightly colocalized with transferrin, indicating that the DNA-PKcs signal is activated in the cytoplasm of macrophages (Fig. 6B).

View larger version (48K):
[in this window]
[in a new window]
|
FIGURE 6. Intracellular localization of DNA-PKcs in macrophages. A, Macrophages from BALB/c mice were incubated with Rho-CpG-ODN (0.2 µM), Rho-CpG-DOTAP-liposomes, or Rho-CpG-DOTAP/DOPE-liposomes for 30 min. Cells were fixed, permeabilized, and stained with anti-DNA-PKcs mAb or Alexa 488-labeled anti-mouse IgG Ab. Images were obtained with a confocal laser-scanning microscope. White arrows indicate the colocalization of CpG-ODN (red) and DNA-PKcs (green). B, Macrophages from BALB/c mice were pretreated with Alexa 488-labeled transferrin (100 µg/ml) and incubated with Rho-CpG-ODN (0.2 µM), Rho-CpG-DOTAP-liposomes, or Rho-CpG-DOTAP/DOPE-liposomes for 45 min. Cells were fixed. Images were obtained with a confocal laser-scanning microscope. White arrows indicate the colocalization of CpG-ODN (red) and transferrin (green).
|
|
Internalization of CpG-ODN in macrophages
We examined the internalization of rhodamine-labeled CpG-ODN with or without liposomes in macrophages. The internalization of CpG-ODN was determined as the increase in macrophage-associated fluorescence intensity at 37°C over a background of the surface binding of CpG-ODN determined at 4°C. We found that the uptake of CpG-ODN was enhanced by the liposomal formulation and that DOTAP/DOPE-liposome-mediated internalization is greater than DOTAP-liposome-mediated internalization (Fig. 7). We show that an increased uptake of CpG-ODN is not responsible for the increase in IL-10 and the decrease in IL-12 p70 in macrophages.

View larger version (22K):
[in this window]
[in a new window]
|
FIGURE 7. Internalization of CpG-ODN in macrophages. Macrophages from BALB/c mice were incubated at 4°C or 37°C with Rho-CpG-ODN (0.2 µM), Rho-CpG-DOTAP-liposomes or Rho-CpG-DOTAP/DOPE-liposomes for 1 h. The amount of Rho-CpG-ODN associated with macrophages was analyzed by using flow cytometry. A, Histogram analysis of fluorescence intensity at 4°C (black) or 37°C (gray). One experiment representative of three is shown. B, Uptake of Rho-CpG-ODN was quantified as the fold-increase of the median of fluorescence intensity of samples incubated at 4°C and 37°C. The mean ± SD of three experiment are depicted. Asterisks indicate statistically significant differences between CpG-ODN uptake in CpG-DOTAP-liposome- or CpG-DOTAP/DOPE-liposome-treated macrophages vs CpG-treated macrophages (*, p < 0.05; **, p < 0.01).
|
|
The enhancement of IL-10 production induced by endosomal escape of CpG-ODN is dependent on DNA-PKcs
We investigated the contribution of DNA-PKcs to the production of IL-10 induced by the endosomal escape of CpG-ODN. The production of IL-10 was not observed when SCID macrophages were treated with CpG-ODN, CpG-DOTAP-liposomes, or CpG-DOTAP/DOPE-liposomes. In contrast, the production of IL-12 p70 was observed in each case. Interestingly, the level of production induced by CpG-DOTAP-liposomes was almost the same as that induced by CpG-DOTAP/DOPE-liposomes (Fig. 8). Our data suggest that IL-10 production by CpG-ODN is dependent on DNA-PKcs.

View larger version (13K):
[in this window]
[in a new window]
|
FIGURE 8. The enhancement of IL-10 production induced by the endosomal escape of CpG-ODN is dependent on DNA-PKcs. Macrophages from C.B-17 SCID mice were incubated with CpG-ODN (0.2 µM), CpG-DOTAP-liposomes, or CpG-DOTAP/DOPE-liposomes for 18 h and assayed for IL-10 and IL-12 production using ELISA as described in Materials and Methods. The values are the means ± SD of triplicate cultures from three independent experiments.
|
|
CpG-DOTAP-liposomes trigger systemic IL-12 p70 production
Following up our results in vitro, we explored whether the systemic delivery of CpG-ODN or CpG-ODN in a complex with DOTAP-liposomes triggers IL-12 p70 production in vivo. As shown Fig. 9, significant amounts of serum IL-12 p70 were observed in CpG-DOTAP-liposome-treated wild-type mice. There was not a significant difference in serum IL-10 production between CpG-ODN- and CpG-DOTAP-liposome-treated wild-type mice.

View larger version (10K):
[in this window]
[in a new window]
|
FIGURE 9. CpG-DOTAP-liposomes trigger systemic IL-12 production. Serum cytokine levels in mice after systemic delivery of CpG-ODN or CpG-ODN in a complex with DOTAP-liposomes are shown. CpG-ODN (5 µg) or CpG-ODN-DOTAP-liposome in 0.2 ml of saline was injected i.v. into wild-type mice. Blood was collected 3 h later. Each value represents the mean ± SD for five mice. (***, p < 0.01) compared with CpG-ODN.
|
|
 |
Discussion
|
|---|
We showed that DNA-PKcs is required for CpG-ODN-induced production of IL-10 and the production is accelerated by the endosomal escape of CpG-ODN in macrophages. In contrast, the production of IL-12 p70 is negatively regulated by DNA-PKcs and this regulatory effect is reduced by enforcing the endosomal translocation of CpG-ODN, suggesting that the DNA-PKcs in cytoplasm regulates IL-10 and IL-12 p70 production in macrophages. We demonstrated the close relationship between the intracellular trafficking of CpG-ODN and the DNA-PKcs-mediated immunoresponse to CpG-ODN in macrophages.
The SCID mouse, which arose spontaneously, has served as the murine model for the deficiency of DNA-PK activity (23, 24, 25). Characterization of the DNA-PKcs in SCID identified a nonsense mutation in the highly conserved C-terminal region of this gene localized downstream of the conserved Ser/Thr-PI3K domain. Although this mutation results in a large decrease in DNA-PKcs protein, residual DNA-PKcs protein can be detected at varying levels in SCID cell lines of different organs. The phenotype of SCID mice is closely similar to that of DNA-PK–/– mice. However, SCID mice may retain some level of residual DNA-PKcs function, suggesting that the production of CpG-ODN-induced IL-10 and IL-12 p70 in SCID macrophages may be not completely similar to that of DNA-PK–/– macrophages.
We found that the DNA-PKcs negatively regulates CpG-ODN-induced IL-12 p70 production in peritoneal exudate macrophages (Fig. 1) and that this negative regulatory effect is mediated by IL-10 production (26). Previous studies have shown that CpG-ODN-induced production of IL-12 p70 in conventional DCs (cDCs) and plasmacytoid DCs (pDCs) is independent of DNA-PKcs activity (34, 35). Boonstra et al. recently reported that in response to CpG-ODN, no detectable IL-10 is secreted by cDCs and pDCs (36). We speculate that the lack of IL-10 in cDCs and pDCs explains the production of IL-12 p70-independent DNA-PKcs. Contrary to the results in the present report, the production of IL-12 p70 in bone marrow-derived macrophages stimulated with CpG-ODN was positively regulated by DNA-PKcs. Currently, this discrepancy remains unexplained.
Dragoi et al. suggested that DNA-PKcs directly interacted with Akt and induced phosphorylation and activation of Akt upon treatment with CpG-ODN. The defect in TLR9 has a minimal effect on Akt activation (17). However, it is not clear how DNA-PKcs in cytoplasm involves the signal transduction of CpG-ODN, which enters the cell through the endocytic pathway. It is possible that CpG-ODN is passively transferred from endosome to cytoplasm, because CpG-DOTAP-liposomes (0.2 µM) did not induce IL-10 production, which a high dose of CpG-DOTAP-liposomes (0.5 µM
) enhanced (data not shown). We speculate that CpG-ODN, which is not accommodated in the endosome, is transferred to the cytoplasm and directly recognized with DNA-PKcs activation, which accelerates the production of the antiinflammatory cytokine IL-10. In support of this, smaller doses of CpG-ODN (0.5 and 5 µg/mouse) appear to be sufficient for the induction of immune responses, whereas a high dose of CpG-ODN (50 µg/mouse) results in the suppression of T cell expansion and CTL activity in the spleen (37). Thus, the dose of CpG-ODN is important for a sufficient immune response. There may be a close relationship between the dose and the intracellular trafficking of CpG-ODN.
We recently reported that PI3K positively and negatively regulated the production of CpG-ODN-induced IL-10 and IL-12 p70, respectively, in macrophages by using wortmannin and LY294002, inhibitors of PI3K (26). However, a high dose of wortmannin and LY294002 inhibit the activity of not only PI3K but also DNA-PKcs (38, 39, 40). It is likely that the reduction in the production of IL-10 and enhancement in that of IL-12 p70 are partly or largely involved in the inhibition of DNA-PKcs activity by wortmannin and LY294002. PI3K was suggested to be a signaling molecule for CpG-ODN-induced immune responses (35, 41, 42). The relationship between PI3K and DNA-PKcs in the regulation of IL-10 and IL-12 p70 production remains unknown.
The immunostimulatory activity of liposomal CpG-ODN significantly exceeded that of the unmodified CpG-ODN in vitro and in vivo (43, 44, 45). It is believed that this superior adjuvant activity mainly resulted from the enhanced uptake of CpG-ODN in macrophages and DCs. However, this molecular mechanism is not clear. We observed the enhanced uptake of CpG-ODN in a complex with DOTAP-liposomes or DOTAP/DOPE-liposomes in macrophages. However, this enhanced uptake results in the reduction or enhancement of IL-10 and IL-12 p70 production. It is unlikely that only the increased uptake of CpG-ODN is responsible for the superior adjuvant activities of the liposomal CpG-ODN.
In this study, we demonstrated that IL-10 and IL-12 p70 production could be regulated by manipulating the intracellular trafficking (endosome or cytosol) of CpG-ODN using cationic liposomes. We indicated that the manipulation of the intracellular trafficking of CpG-ODN with cationic liposomes is useful for regulating cytokine production, and this manipulation is one possible explanation for the superior adjuvant activity of liposomes.
Macrophages are a major source of the IL-10 induced by CpG-ODN (36). Treatment with anti-IL-10 receptor mAb plus CpG-ODN strikingly enhances antitumor activity compared with CpG-ODN alone (7, 9). Furthermore, the administration of CpG-ODN alone induces tumor rejection in tumor-bearing IL-10 knockout mice (8). We recently also reported that IL-12 p70 production was negatively regulated by autocrine IL-10 production. In addition, in our study siRNA-mediated knockdown of DNA-PKcs in RAW264.7 cells resulted in the reduction of IL-10 by CpG-ODN. In contrast, IL-12 p70 was not observed (Fig. 1C), suggesting that IL-12 p70 production may be indirectly inhibited through IL-10 regulated by DNA-PKcs rather than directly inhibited by DNA-PKcs. Thus, IL-10 powerfully inhibits CpG-ODN-induced immune responses. Methods of regulating IL-10 production are needed to develop an effective CpG-ODN vaccine. In this study, we demonstrated that the endosomal translocation of CpG-ODN by using cationic liposomes in macrophages reduced IL-10 production (Fig. 4). The endosomal translocation of CpG-ODN in macrophages using a drug delivery system may be a new strategy for a CpG-ODN vaccine.
DNA-PK activity is associated with cancer development and anticancer drug resistance (46, 47, 48). Recent reports suggest that tumor cells resistant to anticancer drugs show increases in both DNA-PK expression and activity (49, 50, 51) and that treatment with the DNA-PK inhibitor NU7026 improves the effectiveness of the anticancer drugs doxorubicin and etoposide (52). Thus, DNA-PK is a molecular target for anticancer chemotherapy (53). We speculate that the coadministration of CpG-ODN, a DNA-PK inhibitor, and an anticancer drug would result in a synergistic anticancer effect.
In conclusion, manipulation of the intracellular trafficking of CpG-ODN is important to regulate production of the anti-inflammatory cytokine IL-10 and inflammatory cytokine IL-12 p70 in macrophages through the DNA-PKcs-ERK pathway. This information is very useful for the development of a CpG-ODN vaccine for immunotherapy.
 |
Acknowledgments
|
|---|
We are grateful to S. Kanai, A. Kouno, E. Yanaka, and Y. Kondo for their technical assistance.
 |
Disclosures
|
|---|
The authors have no financial conflict of interest.
 |
Footnotes
|
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 This work was supported by a Grant-in-Aid for Scientific Research (KAKHENI) (19790074). 
2 Address correspondence and reprint requests to Dr. Yukihiko Aramaki, Tokyo University of Pharmacy and Life Science, 1432-1 Horinouchi, Hachioji, Tokyo 192-0392, Japan. E-mail address: aramaki{at}ps.toyaku.ac.jp 
3 Abbreviations used in this paper: ODN, oligodeoxynucleotide; DC, dendritic cell; cDC, conventional DC; pDC, plasmacytoid DC; DNA-PK, DNA-dependent protein kinase; DNA-PKcs, catalytic subunit of DNA-PK; DOPE, dioleyl-phosphatidylethanolamine; Rho, rhodamine; siRNA, small interfering RNA. 
Received for publication April 27, 2007.
Accepted for publication October 30, 2007.
 |
References
|
|---|
- Krieg, A. M.. 2006. Therapeutic potential of Toll-like receptor 9 activation. Nat. Rev. Drug Discov. 5: 471-484. [Medline]
- Wilson, H. L., A. Dar, S. K. Napper, A. Marianela Lopez, L. A. Babiuk, G. K. Mutwiri. 2006. Immune mechanisms and therapeutic potential of CpG oligodeoxynucleotides. Int. Rev. Immunol. 25: 183-213. [Medline]
- Akdis, C. A., K. Blaser. 2001. Mechanisms of interleukin-10-mediated immune suppression. Immunology 103: 131-136. [Medline]
- Mocellin, S., F. M. Marincola, H. A. Young. 2005. Interleukin-10 and the immune response against cancer: a counterpoint. J. Leukocyte Biol. 78: 1043-1051. [Abstract/Free Full Text]
- Duramad, O., K. L. Fearon, J. H. Chan, H. Kanzler, J. D. Marshall, R. L. Coffman, F. J. Barrat. 2003. IL-10 regulates plasmacytoid dendritic cell response to CpG-containing immunostimulatory sequences. Blood 102: 4487-4492. [Abstract/Free Full Text]
- Trinchieri, G.. 2003. Interleukin-12 and the regulation of innate resistance and adaptive immunity. Nat. Rev. Immunol. 3: 133-146. [Medline]
- Vicari, A. P., C. Chiodoni, C. Vaure, S. Ait-Yahia, C. Dercamp, F. Matsos, O. Reynard, C. Taverne, P. Merle, M. P. Colombo, et al 2002. Reversal of tumor-induced dendritic cell paralysis by CpG immunostimulatory oligonucleotide and anti-interleukin 10 receptor antibody. J. Exp. Med. 196: 541-549. [Abstract/Free Full Text]
- Dercamp, C., K. Chemin, C. Caux, G. Trinchieri, A. P. Vicari. 2005. Distinct and overlapping roles of interleukin-10 and CD25+ regulatory T cells in the inhibition of antitumor CD8 T-cell responses. Cancer Res. 65: 8479-8486. [Abstract/Free Full Text]
- Guiducci, C., A. P. Vicari, S. Sangaletti, G. Trinchieri, M. P. Colombo. 2005. Redirecting in vivo elicited tumor infiltrating macrophages and dendritic cells towards tumor rejection. Cancer Res. 65: 3437-3446. [Abstract/Free Full Text]
- Hemmi, H., O. Takeuchi, T. Kawai, T. Kaisho, S. Sato, H. Sanjo, M. Matsumoto, K. Hoshino, H. Wagner, K. Takeda, S. Akira. 2000. A Toll-like receptor recognizes bacterial DNA. Nature 408: 740-745. [Medline]
- Yi, A. K., R. Tuetken, T. Redford, M. Waldschmidt, J. Kirsch, A. M. Krieg. 1998. CpG motifs in bacterial DNA activate leukocytes through the pH-dependent generation of reactive oxygen species. J. Immunol. 160: 4755-4761. [Abstract/Free Full Text]
- Rutz, M., J. Metzger, T. Gellert, P. Luppa, G. B. Lipford, H. Wagner, S. Bauer. 2004. Toll-like receptor 9 binds single-stranded CpG-DNA in a sequence- and pH-dependent manner. Eur. J. Immunol. 34: 2541-2550. [Medline]
- Latz, E., A. Schoenemeyer, A. Visintin, K. A. Fitzgerald, B. G. Monks, C. F. Knetter, E. Lien, N. J. Nilsen, T. Espevik, D. T. Golenbock. 2004. TLR9 signals after translocating from the ER to CpG DNA in the lysosome. Nat. Immunol. 5: 190-198. [Medline]
- Hacker, H., H. Mischak, T. Miethke, S. Liptay, R. Schmid, T. Sparwasser, K. Heeg, G. B. Lipford, H. Wagner. 1998. CpG-DNA-specific activation of antigen-presenting cells requires stress kinase activity and is preceded by non-specific endocytosis and endosomal maturation. EMBO J. 17: 6230-6240. [Medline]
- Yi, A. K., M. Chang, D. W. Peckham, A. M. Krieg, R. F. Ashman. 1998. CpG oligodeoxyribonucleotides rescue mature spleen B cells from spontaneous apoptosis and promote cell cycle entry. J. Immunol. 160: 5898-5906. [Abstract/Free Full Text]
- Park, Y., S. W. Lee, Y. C. Sung. 2002. Cutting edge: CpG DNA inhibits dendritic cell apoptosis by up-regulating cellular inhibitor of apoptosis proteins through the phosphatidylinositide-3'-OH kinase pathway. J. Immunol. 168: 5-8. [Abstract/Free Full Text]
- Dragoi, A. M., X. Fu, S. Ivanov, P. Zhang, L. Sheng, D. Wu, G. C. Li, W. M. Chu. 2005. DNA-PKcs, but not TLR9, is required for activation of Akt by CpG-DNA. EMBO J. 24: 779-789. [Medline]
- Smith, G. C., S. P. Jackson. 1999. The DNA-dependent protein kinase. Genes Dev. 13: 916-934. [Free Full Text]
- Dip, R., H. Naegeli. 2005. More than just strand breaks: the recognition of structural DNA discontinuities by DNA-dependent protein kinase catalytic subunit. FASEB J. 19: 704-715. [Abstract/Free Full Text]
- Carter, T., I. Vancurova, I. Sun, W. Lou, S. DeLeon. 1990. A DNA-activated protein kinase from HeLa cell nuclei. Mol. Cell. Biol. 10: 6460-6471. [Abstract/Free Full Text]
- Koike, M., T. Awaji, M. Kataoka, G. Tsujimoto, T. Kartasova, A. Koike, T. Shiomi. 1999. Differential subcellular localization of DNA-dependent protein kinase components Ku and DNA-PKcs during mitosis. J. Cell Sci. 112: 4031-4039. [Abstract]
- Nilsson, A., F. Sirzen, R. Lewensohn, N. Wang, S. Skog. 1999. Cell cycle-dependent regulation of the DNA-dependent protein kinase. Cell Prolif. 32: 239-248. [Medline]
- Blunt, T., N. J. Finnie, G. E. Taccioli, G. C. Smith, J. Demengeot, T. M. Gottlieb, R. Mizuta, A. J. Varghese, F. W. Alt, P. A. Jeggo, et al 1995. Defective DNA-dependent protein kinase activity is linked to V(D)J recombination and DNA repair defects associated with the murine scid mutation. Cell 80: 813-823. [Medline]
- Meek, K., L. Kienker, C. Dallas, W. Wang, M. J. Dark, P. J. Venta, M. L. Huie, R. Hirschhorn, T. Bell. 2001. SCID in Jack Russell terriers: a new animal model of DNA-PKcs deficiency. J. Immunol. 167: 2142-2150. [Abstract/Free Full Text]
- Kashishian, A., H. Douangpanya, D. Clark, S. T. Schlachter, C. T. Eary, J. G. Schiro, H. Huang, L. E. Burgess, E. A. Kesicki, J. Halbrook. 2003. DNA-dependent protein kinase inhibitors as drug candidates for the treatment of cancer. Mol. Cancer Ther. 2: 1257-1264. [Abstract/Free Full Text]
- Saegusa, K., S. Yotsumoto, S. Kato, Y. Aramaki. 2007. Phosphatidylinositol 3-kinase-mediated regulation of IL-10 and IL-12 production in macrophages stimulated with CpG oligodeoxynucleotide. Mol. Immunol. 44: 1323-1330. [Medline]
- Yasuda, K., P. Yu, C. J. Kirschning, B. Schlatter, F. Schmitz, A. Heit, S. Bauer, H. Hochrein, H. Wagner. 2005. Endosomal translocation of vertebrate DNA activates dendritic cells via TLR9-dependent and -independent pathways. J. Immunol. 174: 6129-6136. [Abstract/Free Full Text]
- Honda, K., Y. Ohba, H. Yanai, H. Negishi, T. Mizutani, A. Takaoka, C. Taya, T. Taniguchi. 2005. Spatiotemporal regulation of MyD88-IRF-7 signalling for robust type-I interferon induction. Nature 434: 1035-1040. [Medline]
- Litzinger, D. C., L. Huang. 1992. Phosphatidylethanolamine liposomes: drug delivery, gene transfer, and immunodiagnostic applications. Biochim. Biophys. Acta 1113: 201-227. [Medline]
- Felgner, J. H., R. Kumar, C. N. Sridhar, C. J. Wheeler, Y. J. Tsai, R. Border, P. Ramsey, M. Martin, P. L. Felgner. 1994. Enhanced gene delivery and mechanism studies with a novel series of cationic lipid formulations. J. Biol. Chem. 269: 2550-2561. [Abstract/Free Full Text]
- Farhood, H., N. Serbina, L. Huang. 1995. The role of dioleoyl phosphatidylethanolamine in cationic liposome mediated gene transfer. Biochim. Biophys. Acta 1235: 289-295. [Medline]
- Legendre, J. Y., F. C. Szoka, Jr. 1992. Delivery of plasmid DNA into mammalian cell lines using pH-sensitive liposomes: comparison with cationic liposomes. Pharm. Res. 9: 1235-1242. [Medline]
- Hafez, I. M., P. R. Cullis. 2001. Roles of lipid polymorphism in intracellular delivery. Adv. Drug Deliv. Rev. 47: 139-148. [Medline]
- Hemmi, H., T. Kaisho, K. Takeda, S. Akira. 2003. The roles of Toll-like receptor 9, MyD88, and DNA-dependent protein kinase catalytic subunit in the effects of two distinct CpG DNAs on dendritic cell subsets. J. Immunol. 170: 3059-3064. [Abstract/Free Full Text]
- Ishii, K. J., F. Takeshita, I. Gursel, M. Gursel, J. Conover, A. Nussenzweig, D. M. Klinman. 2002. Potential role of phosphatidylinositol 3 kinase, rather than DNA-dependent protein kinase, in CpG DNA-induced immune activation. J. Exp. Med. 196: 269-274. [Abstract/Free Full Text]
- Boonstra, A., R. Rajsbaum, M. Holman, R. Marques, C. Asselin-Paturel, J. P. Pereira, E. E. M. Bates, S. Akira, P. Viera, Y.-J. Liu, et al 2006. Macrophages and myeloid dendritic cells, but not plasmacytoid dendritic cells, produce IL-10 in response to MyD88- and TRIF-dependent TLR signals, and TLR-independent signals. J. Immunol. 177: 7551-7558. [Abstract/Free Full Text]
- Wingender, G., N. Garbi, B. Schumak, F. Jungerkes, E. Endl, D. von Bubnoff, J. Steitz, J. Striegler, G. Moldenhauer, T. Tuting, et al 2006. Systemic application of CpG-rich DNA suppresses adaptive T cell immunity via induction of IDO. Eur. J. Immunol. 36: 12-20. [Medline]
- Rosenzweig, K. E., M. B. Youmell, S. T. Palayoor, B. D. Price. 1997. Radiosensitization of human tumor cells by the phosphatidylinositol3-kinase inhibitors wortmannin and LY294002 correlates with inhibition of DNA-dependent protein kinase and prolonged G2-M delay. Clin. Cancer Res. 3: 1149-1156. [Abstract]
- Smith, G. C., N. Divecha, N. D. Lakin, S. P. Jackson. 1999. DNA-dependent protein kinase and related proteins. Biochem. Soc. Symp. 64: 91-104. [Medline]
- Chu, W., X. Gong, Z. Li, K. Takabayashi, H. Ouyang, Y. Chen, A. Lois, D. J. Chen, G. C. Li, M. Karin, E. Raz. 2000. DNA-PKcs is required for activation of innate immunity by immunostimulatory DNA. Cell 103: 909-918. [Medline]
- Fukao, T., S. Koyasu. 2003. PI3K and negative regulation of TLR signaling. Trends Immunol. 24: 358-363. [Medline]
- Sester, D. P., K. Brion, A. Trieu, H. S. Goodridge, T. L. Roberts, J. Dunn, D. A. Hume, K. J. Stacey, M. J. Sweet. 2006. CpG DNA activates survival in murine macrophages through TLR9 and the phosphatidylinositol 3-kinase-Akt pathway. J. Immunol. 177: 4473-4480. [Abstract/Free Full Text]
- Gursel, I., M. Gursel, K. J. Ishii, D. M. Klinman. 2001. Sterically stabilized cationic liposomes improve the uptake and immunostimulatory activity of CpG oligonucleotides. J. Immunol. 167: 3324-3328. [Abstract/Free Full Text]
- Li, W. M., W. H. Dragowska, M. B. Bally, M. P. Schutze-Redelmeier. 2003. Effective induction of CD8+ T-cell response using CpG oligodeoxynucleotides and HER-2/neu-derived peptide co-encapsulated in liposomes. Vaccine 21: 3319-3329. [Medline]
- Suzuki, Y., D. Wakita, K. Chamoto, Y. Narita, T. Tsuji, T. Takeshima, H. Gyobu, Y. Kawarada, S. Kondo, S. Akira, et al 2004. Liposome-encapsulated CpG oligodeoxynucleotides as a potent adjuvant for inducing type 1 innate immunity. Cancer Res. 64: 8754-8760. [Abstract/Free Full Text]
- Muller, C., G. Christodoulopoulos, B. Salles, L. Panasci. 1998. DNA-dependent protein kinase activity correlates with clinical and in vitro sensitivity of chronic lymphocytic leukemia lymphocytes to nitrogen mustards. Blood 92: 2213-2219. [Abstract/Free Full Text]
- Xu, W., L. Liu, G. C. Smith, G. Charles. 2000. Nitric oxide upregulates expression of DNA-PKcs to protect cells from DNA-damaging anti-tumour agents. Nat. Cell. Biol. 2: 339-345. [Medline]
- Sirzen, F., A. Nilsson, B. Zhivotovsky, R. Lewensohn. 1999. DNA-dependent protein kinase content and activity in lung carcinoma cell lines: correlation with intrinsic radiosensitivity. Eur. J. Cancer 35: 111-116. [Medline]
- Shen, H., M. Schultz, G. D. Kruh, K. D. Tew. 1998. Increased expression of DNA-dependent protein kinase confers resistance to adriamycin. Biochim. Biophys. Acta 1381: 131-138. [Medline]
- Frit, P., Y. Canitrot, C. Muller, N. Foray, P. Calsou, E. Marangoni, J. Bourhis, B. Salles. 1999. Cross-resistance to ionizing radiation in a murine leukemic cell line resistant to cis-dichlorodiammineplatinum(II): role of Ku autoantigen. Mol. Pharmacol. 56: 141-146. [Abstract/Free Full Text]
- Kim, S. H., J. H. Um, B. Dong-Won, B. H. Kwon, D. W. Kim, B. S. Chung, C. D. Kang. 2000. Potentiation of chemosensitivity in multidrug-resistant human leukemia CEM cells by inhibition of DNA-dependent protein kinase using wortmannin. Leuk. Res. 24: 917-925. [Medline]
- Willmore, E., S. de Caux, N. J. Sunter, M. J. Tilby, G. H. Jackson, C. A. Austin, B. W. Durkacz. 2004. A novel DNA-dependent protein kinase inhibitor, NU7026, potentiates the cytotoxicity of topoisomerase II poisons used in the treatment of leukemia. Blood 103: 4659-4665. [Abstract/Free Full Text]
- Madhusudan, S., I. D. Hickson. 2005. DNA repair inhibition: a selective tumor targeting strategy. Trends Mol. Med. 11: 503-511. [Medline]
This article has been cited by other articles:

|
 |

|
 |
 
Q.-L. Wu, I. N. Buhtoiarov, P. M. Sondel, A. L. Rakhmilevich, and E. A. Ranheim
Tumoricidal Effects of Activated Macrophages in a Mouse Model of Chronic Lymphocytic Leukemia
J. Immunol.,
June 1, 2009;
182(11):
6771 - 6778.
[Abstract]
[Full Text]
[PDF]
|
 |
|