The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


The Journal of Immunology, 2008, 180, 6808 -6815
Copyright © 2008 by The American Association of Immunologists, Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vinzing, M.
Right arrow Articles by Opitz, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vinzing, M.
Right arrow Articles by Opitz, B.

NAIP and Ipaf Control Legionella pneumophila Replication in Human Cells1

Maya Vinzing*, Julia Eitel*, Juliane Lippmann*, Andreas C. Hocke*, Janine Zahlten*, Hortense Slevogt*, Philippe Dje N'Guessan*, Stefan Günther{dagger}, Bernd Schmeck*, Stefan Hippenstiel*, Antje Flieger{ddagger}, Norbert Suttorp* and Bastian Opitz2,*

* Department of Internal Medicine/Infectious Diseases and Pulmonary Medicine, Charité Universitätsmedizin Berlin, Berlin; {dagger} Institute of Biochemistry Charité, Berlin; and {ddagger} Robert Koch-Institut, Research Group NG5 Pathogenesis of Legionella Infections, Berlin, Germany


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
In mice, different alleles of the mNAIP5 (murine neuronal apoptosis inhibitory protein-5)/mBirc1e gene determine whether macrophages restrict or support intracellular replication of Legionella pneumophila, and whether a mouse is resistant or (moderately) susceptible to Legionella infection. In the resistant mice strains, the nucleotide-binding oligomerization domain (Nod)-like receptor (NLR) family member mNAIP5/mBirc1e, as well as the NLR protein mIpaf (murine ICE protease-activating factor), are involved in recognition of Legionella flagellin and in restriction of bacterial replication. Human macrophages and lung epithelial cells support L. pneumophila growth, and humans can develop severe pneumonia (Legionnaires disease) after Legionella infection. The role of human orthologs to mNAIP5/mBirc1e and mIpaf in this bacterial infection has not been elucidated. Herein we demonstrate that flagellin-deficient L. pneumophila replicate more efficiently in human THP-1 macrophages, primary monocyte-derived macrophages, and alveolar macrophages, and in A549 lung epithelial cells compared with wild-type bacteria. Additionally, we note expression of the mNAIP5 ortholog hNAIP in all cell types examined, and expression of hIpaf in human macrophages. Gene silencing of hNAIP or hIpaf in macrophages or of hNAIP in lung epithelial cells leads to an enhanced bacterial growth, and overexpression of both molecules strongly reduces Legionella replication. In contrast to experiments with wild-type L. pneumophila, hNAIP or hIpaf knock-down affects the (enhanced) replication of flagellin-deficient Legionella only marginally. In conclusion, hNAIP and hIpaf mediate innate intracellular defense against flagellated Legionella in human cells.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Legionella pneumophila is a Gram-negative bacterium that replicates in diverse eukaryotic cell types. Dependent on its type IVB secretion system Dot/Icm, L. pneumophila initiates biogenesis of a specialized vacuole that is critical for Legionella replication (1, 2, 3, 4). This Legionella-containing vacuole (LCV)3 avoids fusion with lysosomes and acquires vesicles from the endoplasmic reticulum (5, 6, 7). Additionally, the bacterial flagellum with its major component flagellin is also considered to represent a virulence-associated factor (8, 9).

Innate immunity serves as the first-line defense system against invading pathogens such as bacteria or viruses. It senses microbial-derived molecules including LPS, microbial nucleic acids, peptidoglycan, or flagellin by so-called pattern recognition receptors (PRRs) like the TLRs, the retinoic acid-inducible gene-like receptors (RLRs), or the nucleotide-binding oligomerization domain (Nod)-like receptors (NLRs). Sensing by these receptors activates signaling cascades finally leading to the production of inflammatory mediators, recruitment of phagocytic cells, and to control of the acquired immune response (10, 11, 12). Additionally, innate intracellular resistance activities exist in different cell types and are particularly important for controlling intracellular bacterial infections (13, 14, 15). The mechanisms and the regulation of the innate intracellular defense against bacterial pathogens are, however, not well understood.

Members of the human NLR family are involved in pathogen detection within the cytosol. They consist of a leucine-rich repeat domain and a central Nod (16, 17, 18, 19). Additionally, they contain amino-terminal effector binding domains such as caspase recruitment domains (CARD), pyrin domains, or baculovirus inhibitor of apoptosis repeat domains that mediate activation of different signaling pathways. Thus, after activation of the NLRs NOD1 and NOD2, their CARDs mediate signal transduction finally leading to NF-{kappa}B-dependent gene expression (16, 17). In contrast, other NLRs such as Nalp1–3 do not seem to primarily regulate gene transcription but to control posttranslational processing and secretion of IL-1β and IL-18 by a mechanism involving their pyrin domain, the adaptor molecule apoptosis-associated speck-like protein containing a CARD (ASC), and caspase-1 (20).

Moreover, the mouse NLRs mNAIP5 (murine neuronal apoptosis inhibitory protein-5) and mIpaf (murine ICE protease-activating factor), which contain three baculovirus inhibitor of apoptosis repeat domains or a CARD, respectively, seem to control innate intracellular resistance mechanisms. Macrophages of most inbred mouse strains (such as C57BL/6 mice) restrict intracellular replication of L. pneumophila dependent on a functional mNAIP5. In contrast, A/J mice macrophages expressing a mNAIP5 that differs in 14 amino acids from C57BL/6 mNAIP5, and which have an overall low mNAIP5 expression, support Legionella growth (21, 22, 23, 24, 25). Additionally, mIpaf knock-out C57BL/6 mouse macrophages are also permissive for intracellular Legionella replication (25, 26, 27). Although both mNAIP5 and mIpaf appear to be involved in intracellular, TLR5-independent recognition of flagellin (23, 28, 29, 30), the mechanisms by which mNAIP5 and mIpaf restrict the bacterial replication are still a matter of controversy but may rely on a caspase-1-dependent inflammatory cell death, or on a (perhaps autophagy-dependent) promotion of LCV-lysosome fusion (22, 23, 25, 26, 27, 31, 32).

In contrast to most inbred mice strains, human beings show susceptibility to L. pneumophila by getting either the acute, febrile, self-limiting Pontiac fever or a severe pneumonia called Legionnaires disease (33, 34, 35). Especially the risk to develop Legionnaires disease might depend on the bacterial dose and on risk factors of the host such as age, smoking, chronic lung disease, cancer, and immunosuppression, but also on genetic factors including polymorphisms of innate immunity-related genes (36, 37).

In this study we show for the first time that the human orthologs of mNAIP5 and mIpaf are involved in L. pneumophila flagellin recognition and subsequent control of the bacterial replication.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Bacterial strains

The L. pneumophila Sg 1 strains used in this study were wild-type Corby and Corby deficient in flagellin ({Delta}flaA; kindly provided by K. Heuner, Würzburg, Germany). L. pneumophila was grown on buffered charcoal-yeast extract (BCYE) agar for 2 days at 37°C before use.

Polymerase chain reaction

Wild-type Corby and Corby deficient in flagellin were grown as described above, RNA was extracted using peqGOLD RNAPure (PeqLab Biotechnologie), and expression of flaA was assessed by PCR with bacterial gyrase serving as a control (flaA sense: AAGCTGCCAACTCGACCAATA, antisense: CCTCCTCCAATTGCGATAGTA; gyrase sense: CACATATGGCCGGCTTTAGAG, antisense TCGCGCTTGTTTTGCTGAG).

Cell culture

The human alveolar epithelial A549 cells (DSMZ) were cultured in Ham’s F12 (PAA) containing 10% FCS. The human monocyte cell line THP-1 was obtained from DSMZ and cultured in RPMI 1640 (Invitrogen) containing 10% FCS and 4.5 mM glutamine. Transfected (see below) or untreated THP-1 cells were seeded in appropriate culture dishes and treated with 100 ng/ml PMA (Sigma-Aldrich) for 1 day to induce maturation toward adherent macrophage-like cells. Subsequently, adherent THP-1 cells were cultured in medium without PMA for further 2 days before infection. Primary human monocytes were isolated from buffy coat preparations supplied by the German Red Cross (Berlin, Germany). Buffy coat was diluted 1/1 in RPMI 1640 containing 0.5% FCS and 0.2 mM EDTA, centrifuged twice over Ficoll (Amersham) for 25 min at 20°C and 800 x g, and immediately used for siRNA transfection experiments (see below). After transfection, monocytes were cultured in RPMI 1640 supplemented with 10% FCS, 4.5 mM glutamine for 5 days to get monocyte-derived macrophages (38, 39, 40). Studies with human alveolar macrophages were approved by the local ethics committee. Cells were recovered by bronchoalveolar lavage performed for routine diagnostic purposes, washed twice in cold PBS, then either resuspended at 106/ml in RPMI 1640/10% FCS/penicillin/streptomycin, or immediately transfected as described below. Untreated or transfected alveolar macrophages were placed into 24-well tissue culture plates and allowed to adhere for 2 h. The monolayers were then washed three times to remove nonadherent cells and antibiotics, and cultured in RPMI 1640/10% FCS until infections.

RNA interference in THP-1 cells, A549 cells, human monocytes, and alveolar macrophages

Control nonsilencing siRNA (sense UUCUCCGAACGUGUCACGUtt, antisense ACGUGACACGUUCGGAGAAtt), hNAIP siRNA (pool of sequence 1: sense, GGUCUUUGGCAACUUGAACtt; antisense, GUUCAAGUUGCCAAAGACCtc; sequence 2: sense, GGAGGUAAAAUGAGGUACCtt; antisense, GGUACCUCAUUUUACCUCCtt) and Ipaf siRNA (sense, GGUUCAAGCCAAAGUAUAAtt; antisense, UUAUACUUUGGCUUGAACCtt) were from Ambion. THP-1 cells or A549 cells were transfected by using Amaxa Nucleofector (Amaxa) according to the manufacturer’s protocol (Nucleofector solution V, Nucleofector program T-08 or G-16, respectively) with 2 µg siRNA per 106 cells (41, 42). Primary human monocytes were transfected by using Amaxa Nucleofector according to the manufacturer’s protocol (human monocyte Nucleofector kit, Nucleofector program Y-01) with 5 µg siRNA per 1.5 x 107 cells. Alveolar macrophages were transfected by using Amaxa Nucleofector (human monocyte Nucleofector kit, Nucleofector program Y-01) with 5 µg siRNA per 0.5 x 107 cells.

Overexpression assays

Full-length cDNA clone encoding hIpaf (IRAKp961A1050Q; RZPD) was subcloned into the human expression vector pcDNA3.1 (Invitrogen) via KpnI and NotI sites. Full-length hNAIP cDNA (NM_004536.1) in pCMV6-XL5 was from OriGene. pcDNA3 encoding A/J mice NAIP5 and pcDNA3 encoding C57BL/6 mice NAIP5 were kindly provided by Drs. D. Zamboni and C. Roy (New Haven, CT). A549 cells were transfected using Amaxa Nucleofector as described for siRNA with 1.5 µg empty control vector, hNAIP, mNAIP5s, or hIpaf.

Western blotting

Protein extracts of cells infected with L. pneumophila (Corby) with a multiplicity of infection (MOI) of 10 were separated by SDS-PAGE and blotted. Membranes were exposed to Abs specific to hNAIP (Biozol), hIpaf (ProSci), cyclooxygenase (COX)-2 (Santa Cruz Biotechnology), p38 (Santa Cruz Biotechnology), FAK (focal adhesion kinase) (Upstate Biotechnology), ERK-2 (Santa Cruz Biotechnology), or Akt (Cell Signaling Technology), and subsequently incubated with secondary Abs (IRDye 800-labeled anti-mouse or Cy5.5-labeled anti-rabbit). Proteins were detected using an Odyssey infrared imaging system (LI-COR).

Bacterial replication assay

Where indicated, 72 h (A549, THP-1, alveolar macrophages) or 120 h (monocyte-derived macrophages) after siRNA transfection, cells were infected with L. pneumophila (Corby) or flaA-deficient L. pneumophila (Corby) at a MOI of 0.1 (A549) or 0.02 (THP-1, human macrophages), centrifuged for 10–30 min at 800 x g, and incubated for a further 1.5 h at 37°C. Cells were then washed twice with PBS, and culture medium containing 50 µg/ml gentamicin was added to the cells for 1 h to kill remaining extracellular Legionella. Subsequently, cells were washed and culture medium was added (this time point represents the 0 h). Cells were incubated and washed at the indicated time intervals with PBS, lysed with aqua ad injectabilia for 10 min, and lysates were plated on BCYE agar to count Legionella CFU. Intracellular growth was calculated as (total CFU at x h)/(CFU at 0 h).

Confocal laser scanning microscopy

Seventy-two hours after siRNA transfection, THP-1 or A549 cells were infected with L. pneumophila strain Corby or flagellin-lacking Legionella at a MOI of 0.02 (THP-1) or 0.1 (A549) for 2 h, and extracellular bacteria were removed by washing and were killed by gentamicin. After 48 h, cells were fixed for 20 min at room temperature (RT) with 3% paraformaldehyde in PBS pH 7.4 and permeabilized for 15 min at RT with 1% Triton X-100, followed by incubation for 30 min at RT in blocking solution (5% goat serum) and exposure to an Ab specific to Legionella (Biozol) and subsequent incubation with a secondary Ab (Alexa Fluor 488-conjugated anti-mouse IgG; Invitrogen). Additional F-actin staining was conducted with phalloidin Alexa Fluor 546 (Molecular Probes). Coverslips were mounted on slides using PermaFluor and visualized using an LSM5 Pascal microscope (Carl Zeiss).

Statistics

Results were statistically evaluated using Student’s t tests (Fig. 1) or two-way ANOVA and Bonferroni post test (Figs. 3–7). p values of <0.05 are indicated by one asterisk.


Figure 1
View larger version (19K):
[in this window]
[in a new window]

 
FIGURE 1. Effect of L. pneumophila flagellin on the bacterial replication. THP-1 macrophages (A) or A549 cells (B) were infected with wild-type L. pneumophila strain Corby (L. p. Corby) or flagellin-deficient L. pneumophila (L. p. Corby {Delta}flaA) at a MOI of 0.02 (THP-1) or 0.1 (A549) for 2 h, extracellular bacteria were removed by washing and possibly remaining extracellular bacteria were killed by gentamicin, and multiplication of Legionella was assessed by CFU counting. Results are means ± SE of three independent experiments. C, Control experiments demonstrate expression of flagellin (flaA) in wild-type L. pneumophila strain Corby (L. p. Corby) but not in flagellin-deficient L. pneumophila (L. p. Corby {Delta}flaA), which both had been cultured similarly to the conditions used in the host cell infection experiments.

 

Figure 3
View larger version (34K):
[in this window]
[in a new window]

 
FIGURE 3. hNAIP is required for restricting L. pneumophila growth in human macrophages and lung epithelial cells. A, THP-1 cells were either left untreated or were transfected with control siRNA. After 3 days, cells were infected with L. pneumophila strain Corby (L. p. Corby) for 2 h, extracellular bacteria were removed by washing and killed by gentamicin, and multiplication of Legionella was assessed by CFU counting. Data represent mean of duplicates of one representative experiment out of two. B, THP-1 macrophages or A549 cells were transfected with control siRNA (contr.) or siRNA targeting hNAIP, and after 72 h infected with L. pneumophila strain Corby at a MOI of 0.02 as indicated. After additional 0, 24, and 48 h, specific knock-down of hNAIP was assessed by Western blotting. THP-1 macrophages (C) or A549 cells (D) were transfected as indicated. After 72 h, cells were infected with L. pneumophila strain Corby (L. p. Corby) or flagellin-deficient L. pneumophila (L. p. Corby {Delta}flaA) for 2 h, extracellular bacteria were removed by washing, and possibly remaining extracellular bacteria were killed by gentamicin. Multiplication of Legionella was assessed by CFU counting. Results are means ± SE of three (A549) or five (THP-1) independent experiments. *, p values <0.05. THP-1 (E) or A549 cells (F) were transfected with siRNAs as indicated, and after 72 h infected with L. pneumophila strain Corby (L. p. Corby) or flagellin-lacking L. pneumophila (L. p. Corby {Delta}flaA) at a MOI of 0.02 (THP-1) or 0.1 (A549) for 2 h, extracellular bacteria were removed by washing and killed by gentamicin. Forty-eight hours after infection, Legionella was visualized by a specific L. pneumophila Ab (green) and F-actin was stained with phalloidin Alexa Fluor 546 (red). Representative figures of three different experiments with similar results are given.

 

Figure 4
View larger version (23K):
[in this window]
[in a new window]

 
FIGURE 4. Overexpression of C57BL/6 mNAIP5 and hNAIP restricts L. pneumophila replication. A549 cells were transfected with either an empty vector or expression vectors encoding C57BL/6 mNAIP5, A/J mNAIP5, or hNAIP, and NAIP expression was analyzed by immunoblotting, with Akt detection serving as a loading control. The band intensities of three independent experiments normalized to the corresponding loading controls were quantified and expressed as fold of the values (mean ± SE) with intensities in mock-transfected cells set as 1 (upper panel). A549 cells were transfected with either an empty vector or expression vectors encoding C57BL/6 mNAIP5, A/J mNAIP5, or hNAIP. After 24 h, cells were infected with L. pneumophila Corby at a MOI of 0.1 for 2 h, extracellular bacteria were removed by washing and killed by gentamicin, and multiplication of Legionella was assessed by CFU counting. Results are means ± SE of four independent experiments. *, p values <0.05 (lower panel).

 

Figure 5
View larger version (30K):
[in this window]
[in a new window]

 
FIGURE 5. hIpaf is required for restricting L. pneumophila growth in human macrophages. A, THP-1 macrophages were transfected with control siRNA (contr.) or siRNA targeting hIpaf, and after 72 h infected with L. pneumophila strain Corby at a MOI of 0.02 as indicated. After additional 0, 24, and 48 h, specific knock-down of hIpaf was assessed by Western blotting. B, Cells were infected with L. pneumophila strain Corby (L. p. Corby) or flagellin-deficient L. pneumophila (L. p. Corby {Delta}flaA) for 2 h, extracellular bacteria were removed by washing and killed by gentamicin, and multiplication of Legionella was assessed by CFU counting. Results are means ± SE of four independent experiments; *, p values <0.05. C, THP-1 cells were transfected as indicated and infected with L. pneumophila strain Corby (L. p. Corby) or flagellin-lacking L. pneumophila (L. p. Corby {Delta}flaA) at a MOI of 0.02 for 2 h, and extracellular bacteria were removed by washing and killed by gentamicin. Forty-eight hours after infection, cells were fixed and permeabilized, and L. pneumophila (green) and F-actin (red) were visualized. Representative figures of three different experiments with similar results are given.

 

Figure 6
View larger version (20K):
[in this window]
[in a new window]

 
FIGURE 6. Overexpression of hIpaf restricts L. pneumophila replication. A549 cells were left untreated or were transfected with either an empty vector or an expression vector encoding hIpaf, and hIpaf expression was analyzed by immunoblotting, with FAK detection serving as a loading control (upper panel). A549 cells were transfected as indicated and, after 24 h, infected with L. pneumophila wild-type at a MOI of 0.1 for 2 h, extracellular bacteria were removed by washing and killed by gentamicin, and multiplication of Legionella was assessed by CFU counting. Results are means ± SE of four independent experiments, and significant differences (*, p < 0.05) are indicated.

 

Figure 7
View larger version (29K):
[in this window]
[in a new window]

 
FIGURE 7. hNAIP and hIpaf are required for restricting L. pneumophila growth in primary human monocyte-derived macrophages. A, Primary human macrophages were either left untreated or were transfected with control siRNA. After 5 days, cells were infected with L. pneumophila strain Corby (L. p. Corby) for 2 h, extracellular bacteria were removed by washing and killed by gentamicin, and multiplication of Legionella was assessed by CFU counting after 24 h. Results are means ± SE of three independent experiments. B, Human macrophages were transfected with control siRNA (contr.) or siRNAs targeting hNAIP or hIpaf. After 5 days, specific knock-down of hNAIP and hIpaf was assessed by Western blotting, with FAK serving as a loading control. C and D, Macrophages were transfected as indicated, and after 5 days were infected with L. pneumophila strain Corby (L. p. Corby) or flagellin-deficient L. pneumophila (L. p. Corby {Delta}flaA) for 2 h, extracellular bacteria were removed by washing and killed by gentamicin, and multiplication of L. pneumophila was assessed by CFU counting after 24 h. Results are means ± SE of eight independent experiments of fold replications after 24 h, and significant differences (*, p < 0.05) are indicated.

 

    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Flagellin-deficient L. pneumophila replicated more efficiently in human macrophages and lung epithelial cells compared with wild-type bacteria

To characterize the effects of flagellin on L. pneumophila growth, THP-1 macrophage-like and A549 lung epithelial cells were infected with the bacteria and bacterial replication was assessed. We found that in both cell types, growth of flagellin-deficient L. pneumophila was enhanced after 24 and 48 h compared with L. pneumophila wild-type (Fig. 1, A and B).

Both human macrophages as well as human lung epithelial cells expressed hNAIP, whereas only macrophages expressed hIpaf

The effect of L. pneumophila flagellin on the bacterial replication in human cells together with the recent findings that mNAIP5 and mIpaf are involved in flagellin recognition and L. pneumophila growth restriction in murine cells (23, 28, 29, 30) led us to take a closer look at human orthologs of mNAIP5 and mIpaf. Humans express one hIpaf that is highly homologous to mIpaf. In contrast, mice and humans differ considerably in expression of NAIP/Birc1 proteins. Whereas mice express seven mNAIP/mBirc1 paralogs (mNAIP1–7/mBirc1a–g), humans contain only one hNAIP/hBirc1. Interestingly, hNAIP/hBirc1 shares 68% homology with C57BL/6 and A/J mNAIP5/mBirc1e. Moreover, concerning the 14 amino acids in which C57BL/6 mNAIP5 and A/J mNAIP5 differ and which thus seem to be crucial for functionality regarding L. pneumophila growth restriction in murine macrophages, hNAIP/hBirc1 is equally related to C57BL/6 and to A/J mNAIP5 (5 amino acids similar to C57BL/6 mNAIP5, and 5 amino acids similar to A/J mNAIP5; data not shown).

We analyzed expression of hNAIP and hIpaf in THP-1 macrophages, primary macrophages, and A549 epithelial cells and found that hNAIP was expressed in all three cell types, whereas hIpaf protein and transcript were found in macrophages but not in A549 epithelial cells (Fig. 2 and data not shown; see also Fig. 7 and 8). COX-2, which is up-regulated during L. pneumophila infection, and p38, which is constitutively expressed (43), were assessed in parallel as a positive control and as a loading control, respectively.


Figure 2
View larger version (36K):
[in this window]
[in a new window]

 
FIGURE 2. Expression of hNAIP and hIpaf in human THP-1 macrophages and lung epithelial cells. THP-1 macrophages (A) and A549 lung epithelial cells (B) were infected with L. pneumophila wild-type strain Corby (L. p. Corby) at a MOI of 10. hNAIP and hIpaf expression was analyzed by immunoblots. COX-2 was detected in parallel as a positive control for a protein whose expression responds to L. pneumophila infection, and p38, a constitutively expressed protein, was assessed as a loading control. Shown is one representative experiment out of three.

 

Figure 8
View larger version (37K):
[in this window]
[in a new window]

 
FIGURE 8. hNAIP and hIpaf are required for restricting L. pneumophila growth in primary human alveolar macrophages. A, Alveolar macrophages were either left untreated or were transfected with control siRNA. After 3 days, cells were infected with L. pneumophila strain Corby (L. p. Corby) at a MOI of 0.02 for 2 h, extracellular bacteria were removed by washing and killed by gentamicin, and multiplication of Legionella was assessed by CFU counting after 24 h. B, Alveolar macrophages were transfected with control siRNA (contr.) or siRNAs targeting hNAIP or hIpaf, and after 3 days they were infected with L. pneumophila at a MOI of 0.02. At this time point and after an additional 24 h, specific knock-down of hNAIP and hIpaf was assessed by Western blotting, with ERK-2 serving as a loading control. C and D, Alveolar macrophages were transfected as indicated, and after 3 days they were infected with L. pneumophila strain Corby (L. p. Corby) or flagellin-deficient L. pneumophila (L. p. Corby {Delta}flaA) for 2 h, extracellular bacteria were removed by washing and killed by gentamicin, and multiplication of L. pneumophila was assessed by CFU counting after 24 h. Data represent one experiment out of four independent experiments with similar results. Results of all four experiments are presented in Tables I and II.

 
hNAIP knock-down led to an enhanced replication of wild-type L. pneumophila in macrophages and lung epithelial cells

Gene silencing experiments were conducted to examine the function of hNAIP in L. pneumophila infection of human cells. First, it was verified that siRNA transfection per se did not affect Legionella growth (Fig. 3A). THP-1 and A549 cells were transfected with control siRNA or hNAIP-specific siRNA, infected with Legionella as indicated, and specific hNAIP knock-down was observed by immunoblot analysis at different time points (Fig. 3B). Functional assays demonstrated that L. pneumophila wild-type replicated more efficiently in macrophages (Fig. 3C) and epithelial cells (Fig. 3D) in which hNAIP expression was inhibited. In accord with these results, confocal microscopy studies demonstrated enhanced replication of L. pneumophila in hNAIP knock-down human THP-1 macrophages (Fig. 3E) and epithelial cells (Fig. 3F). Although in contrast to wild-type Legionella infections, hNAIP knock-down had a less prominent effect on the replication of flagellin-deficient Legionella, some differences could also be observed at least in epithelial cells (Fig. 3D). They were, however, statistically insignificant and might be related to an incomplete knock-down (and thus a remaining expression/function) of hNAIP in these cells. Overall, the data suggested that hNAIP restricted L. pneumophila growth within human macrophages and epithelial cells by a mechanism potentially involving recognition of bacterial flagellin.

Overexpression of hNAIP reduced L. pneumophila replication in human cells

To further support the hypothesis that hNAIP restricts L. pneumophila growth, overexpression assays were performed. For this assay, A549 epithelial cells were used in which cDNA transfection efficiency is higher (~55%) compared with THP-1 cells. Cells were transfected with hNAIP, C57BL/6 mNAIP5, A/J mNAIP5, or an empty control vector, and expression levels of mNAIP5/hNAIP were assessed by Western blotting (Fig. 4, upper panel). Next, untreated or transfected cells were infected with L. pneumophila wild-type for 24 and 48 h. As shown in Fig. 4 (lower panel), overexpression of hNAIP and C57BL/6 mNAIP5 reduced the bacterial growth within the cells examined. Moreover, overexpressed A/J mNAIP5 also appeared to partially restrict the bacterial growth; the effect, however, did not reach statistical significance. In contrast to direct overexpression of hNAIP/mNAIP5 in the host cells examined, treatment of nontransfected host cells with sterile-filtrated supernatants of hNAIP-overexpressing and Legionella-infected cells did not influence L. pneumophila replication in the nontransfected host cells (data not shown), thus indicating a direct rather than paracrine effect of hNAIP on Legionella growth. Overall, the results presented supported the knock-down data and clearly demonstrated that hNAIP mediated restriction of L. pneumophila growth within human host cells.

Ipaf siRNA led to an enhanced replication of L. pneumophila in human macrophages

To investigate whether hIpaf is functional in controlling L. pneumophila growth, hIpaf gene silencing experiments in human THP-1 macrophages, which in contrast to A549 epithelial cells expressed hIpaf, were performed. Fig. 5A shows a specific knock-down of endogenous hIpaf by siRNA 72 to 120 h after transfection. Moreover, hIpaf knock-down led to an enhanced replication of wild-type L. pneumophila in human THP-1 macrophages as demonstrated by replication assay (Fig. 5B) and by confocal microscopy (Fig. 5C). Similar to the situation in hNAIP knock-down cells, hIpaf gene silencing had little further effect on the enhanced replication of flagellin-deficient L. pneumophila. These data thus suggested that in addition to hNAIP, hIpaf was involved in L. pneumophila flagellin recognition and subsequent Legionella growth restriction.

hIpaf overexpression impaired replication of L. pneumophila in human cells

In a complementary approach, L. pneumophila replication in hIpaf-overexpressing A549 cells was examined. Legionella growth was strongly reduced in epithelial cells overexpressing hIpaf compared with untreated cells or cells that were transfected with the empty vector (Fig. 6). These results thus supported the aforementioned data and showed that hIpaf played a role in restricting growth of L. pneumophila. In contrast to direct overexpression of hIpaf in the host cells examined, treatment of nontransfected host cells with sterile-filtrated supernatants of Ipaf-overexpressing and Legionella-infected cells did not influence L. pneumophila replication within the nontransfected host cells (data not shown), thus indicating a direct rather than paracrine effect of hIpaf on Legionella growth.

Effect of L. pneumophila flagellin and host cell hNAIP and hIpaf on bacterial replication in primary human monocyte-derived macrophages and alveolar macrophages

To provide further evidence for the important role of bacterial flagellin and of host cell hNAIP and hIpaf on L. pneumophila replication, gene silencing and infection experiments in primary human monocyte-derived and primary alveolar macrophages were conducted. Control experiments showed that siRNA transfection did not unspecifically affect Legionella growth in these cells (Figs. 7A and 8A). Transfection with hNAIP-specific or hIpaf-specific siRNA resulted in knock-down of the respective proteins as determined by Western blotting (Figs. 7B and 8B). Following RNA interference, primary human monocyte-derived and alveolar macrophages were infected with wild-type L. pneumophila or flagellin-deficient L. pneumophila and CFU were counted. Figs. 7, C and D, 8, C and D, and Tables I and II indicate that replication of flagellin-deficient bacteria was enhanced compared with L. pneumophila wild-type. Moreover, L. pneumophila wild-type growth was increased in cells in which hNAIP or hIpaf expression was inhibited compared with control transfected cells. In contrast, hNAIP and hIpaf gene silencing had no effect on the enhanced replication of flagellin-deficient L. pneumophila. Thus, hNAIP and hIpaf were important in L. pneumophila infection of primary human macrophages.


View this table:
[in this window]
[in a new window]

 
Table I. Growth of flagellin-deficient L. pneumophila in primary human alveolar macrophages is enhanced compared to wild-type Legionellaa

 

View this table:
[in this window]
[in a new window]

 
Table II. hNAIP and hIpaf are required for restricting L. pneumophila growth in primary human alveolar macrophagesa

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
In this study, we examined the role of hNAIP and hIpaf in innate intracellular defense against L. pneumophila in different human macrophages and epithelial cells. Loss- and gain-of-function experiments demonstrated that depending on L. pneumophila flagellin, hNAIP and hIpaf did not prevent but clearly restricted the bacterial replication in these human cells. This study represents, to our knowledge, the first report demonstrating a role of hNAIP in bacterial infections in human cells.

Our data suggest that hNAIP and hIpaf fulfill comparable functions in human cells to mNAIP5 and mIpaf in C57BL/6 mice. However, human macrophages and epithelial cells do support a stronger replication of L. pneumophila (~100-fold after 48 h) than do macrophages of, for example, C57BL/6 mice (not exceeding 10-fold) (22, 23, 25, 27, 30, 32). A possible explanation for this discrepancy could be that hNAIP or hIpaf are in principle functional but less effective in L. pneumophila growth restriction compared with mNAIP5 and mIpaf. The fact that hNAIP stays with respect to the apparently critical 14 amino acids exactly between the C57BL/6 mNAIP5 and the A/J mNAIP5 might have supported this suggestion, but our overexpression assay in which C57BL/6 mNAIP5 and hNAIP appear to be similarly effective in L. pneumophila restriction argues against this hypothesis. Another explanation would be that expression of mNAIP5/hNAIP in mice and man differs, or that different L. pneumophila strains were used in the mice studies and in our study. Strain Corby, which was used in this study, is clearly more infectious than the Philadelphia-originated strains (e.g., Lp01, Lp02) used in most of the mice studies (44).

On the other hand, full innate intracellular resistance to L. pneumophila (and certainly other intracellular bacteria) depends on many additional mechanisms such as types I and II IFN- as well as TNF-{alpha}-mediated effects, and perhaps also on Nramp1, antimicrobial peptides, or immunity-related GTPases (13, 15, 45, 46, 47, 48, 49, 50). It might thus be conceivable that in case of L. pneumophila infection, one of these last mentioned resistance mechanisms is less functional in human cells compared with mice resulting in an overall stronger replication of Legionella in human cells compared with, for example, C57BL/6 macrophages despite functional hNAIP and hIpaf. Considering the striking differences in expression and regulation of the immunity-related GTPases in mice and men (15, 47), these proteins might represent promising candidates for future studies.

Although in this study we did not intend to gain deep mechanistic insight into how hNAIP and hIpaf restrict L. pneumophila replication, some conclusions can be drawn. First, supernatants of hNAIP- or hIpaf-overexpressing cells did not influence L. pneumophila replication within nontransfected host cells, thus indicating a direct rather than paracrine effect of hNAIP and hIpaf on Legionella growth. Second, our finding that hNAIP is functional in lung epithelial cells that do not express hIpaf suggests that hNAIP/mNAIP5- and hIpaf/mIpaf-mediated growth restrictions represent two independent defense mechanisms, a suggestion that is supported by recent findings of G. Núñez and colleagues (27). The authors of this recent study indicated a role of caspase-1 in mIpaf-mediated Legionella growth restriction but not in mNAIP5-mediated effects (27).

Moreover, under our culture conditions, we did not observe significant differences in lactate dehydrogenase (LDH) release or apoptosis in hNAIP or hIpaf knock-down cells compared with control cells infected with L. pneumophila using low MOI (data not shown). This observation is consistent with some recent data (26, 27, 51) and does not necessarily contradict other studies in which much higher MOI were used. In these reports, a strong LDH release, which indicated an inflammatory cell death-dependent bacterial growth restriction, was noticed (23, 25, 29, 30). In contrast, we are aware of the fact that measurement of LDH release might not be sensitive enough, because in our assays using low MOI and observing 100-fold replication, only about every 20th cell gets infected after 48 h. Additionally, the previously reported binding and inhibition of caspase-3 (as well as casase-7 and caspase-9) by hNAIP (52, 53, 54) together with the published results that chemical caspase-3 inhibition blocks Legionella replication in U937 macrophages (55) might lead to the suggestion that caspase-3 contributes to hNAIP-mediated bacterial growth restriction. Own preliminary results, however, showing that caspase-3 siRNA did not affect intracellular Legionella replication (data not shown), together with published results demonstrating similar Legionella growth in wild-type mouse macrophages and caspase-3-deficient macrophages (25), argue against this hypothesis. Overall, while further elucidation is clearly needed, hNAIP/mNAIP5 and perhaps hIpaf/mIpaf might restrict L. pneumophila replication by different mechanisms including enforced phagoendosomal maturation/autophagy (22, 26, 27, 31, 32) and caspase-1-dependent cell death (23, 25, 29, 30) depending on the bacterial dose.

Although (knock-out) mice studies constitute an unique contribution to the understanding of biological processes (10, 11), many immune defense mechanisms differ considerably between humans and mice. For example, humans are thought to express functional TLRs 1–10, whereas mice express TLRs 1–7 and 9–13 (10, 11). There are seven mNAIP/mBirc1 paralogs in mice, only one hNAIP/hBirc1 protein in humans, and >20 immunity-related p47 GTPases in mice compared with 1–3 functional human orthologs (15, 47, 56). The innate defense mechanisms against intracellular/intravacuolar bacteria in mice and humans are therefore also likely to be different. We thus think that studies with human cells are mandatory, as they constitute an important contribution to the fragmentary knowledge of innate immune responses, especially those dealing with intracellular bacteria.

Overall, our results show that L. pneumophila flagellin is (directly or indirectly) recognized by hNAIP and hIpaf, which in turn mediate partial growth restriction of the bacteria. Further work, however, is required to better understand underlying mechanisms. Considering the strong phenotype of the different mNAIP5 alleles in mice, future studies should also examine whether hNAIP gene variations in humans exist and whether they affect human susceptibility toward Legionella infection and its different disease course (Pontiac fever vs Legionnaires disease).


    Acknowledgments
 
We are grateful to J. Hellwig and D. Stoll for excellent technical assistance.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflicts of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported in part by grants given by the Deutsche Forschungsgemeinschaft, the Deutsche Gesellschaft für Pneumologie und Beatmungsmedizin, and the Jürgen Manchot Stiftung (to B.O.), and by the Bundesministerium für Bildung und Forschung-funded network PROGRESS (to S.H. and N.S.). Parts of this work will be included in the M.D. thesis of M.V. Back

2 Address correspondence and reprint requests to Dr. Bastian Opitz, Department of Internal Medicine/Infectious Diseases and Pulmonary Medicine, Charité Universitätsmedizin Berlin, Augustenburger Platz 1, 13353 Berlin, Germany. E-mail address: bastian.opitz{at}charite.de Back

3 Abbreviations used in this paper: LCV, Legionella-containing vacuole; ASC, apoptosis-associated speck-like protein containing a CARD; CARD, caspase recruitment domain; COX, cyclooxygenase; FAK, focal adhesion kinase; Ipaf, ICE protease-activating factor; LDH, lactate dehydrogenase; MOI, multiplicity of infection; NAIP, neuronal apoptosis inhibitory protein; NLR, Nod-like receptor; Nod, nucleotide-binding oligomerization domain; PRR, pattern recognition receptor; RLR, RIG-like receptors; RT, room temperature. Back

Received for publication August 1, 2007. Accepted for publication March 10, 2008.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Joshi, A. D., S. Sturgill-Koszycki, M. S. Swanson. 2001. Evidence that Dot-dependent and -independent factors isolate the Legionella pneumophila phagosome from the endocytic network in mouse macrophages. Cell. Microbiol. 3: 99-114. [Medline]
  2. Roy, C. R., K. H. Berger, R. R. Isberg. 1998. Legionella pneumophila DotA protein is required for early phagosome trafficking decisions that occur within minutes of bacterial uptake. Mol. Microbiol. 28: 663-674. [Medline]
  3. Segal, G., M. Purcell, H. A. Shuman. 1998. Host cell killing and bacterial conjugation require overlapping sets of genes within a 22-kb region of the Legionella pneumophila genome. Proc. Natl. Acad. Sci. USA 95: 1669-1674. [Abstract/Free Full Text]
  4. Vogel, J. P., H. L. Andrews, S. K. Wong, R. R. Isberg. 1998. Conjugative transfer by the virulence system of Legionella pneumophila. Science 279: 873-876. [Abstract/Free Full Text]
  5. Horwitz, M. A.. 1983. The Legionnaires’ disease bacterium (Legionella pneumophila) inhibits phagosome-lysosome fusion in human monocytes. J. Exp. Med. 158: 2108-2126. [Abstract/Free Full Text]
  6. Horwitz, M. A.. 1983. Formation of a novel phagosome by the Legionnaires’ disease bacterium (Legionella pneumophila) in human monocytes. J. Exp. Med. 158: 1319-1331. [Abstract/Free Full Text]
  7. Kagan, J. C., C. R. Roy. 2002. Legionella phagosomes intercept vesicular traffic from endoplasmic reticulum exit sites. Nat. Cell. Biol. 4: 945-954. [Medline]
  8. Heuner, K., C. Dietrich, C. Skriwan, M. Steinert, J. Hacker. 2002. Influence of the alternative {sigma}28 factor on virulence and flagellum expression of Legionella pneumophila. Infect. Immun. 70: 1604-1608. [Abstract/Free Full Text]
  9. Molofsky, A. B., L. M. Shetron-Rama, M. S. Swanson. 2005. Components of the Legionella pneumophila flagellar regulon contribute to multiple virulence traits, including lysosome avoidance and macrophage death. Infect. Immun. 73: 5720-5734. [Abstract/Free Full Text]
  10. Akira, S., S. Uematsu, O. Takeuchi. 2006. Pathogen recognition and innate immunity. Cell 124: 783-801. [Medline]
  11. Beutler, B., Z. Jiang, P. Georgel, K. Crozat, B. Croker, S. Rutschmann, X. Du, K. Hoebe. 2006. Genetic analysis of host resistance: Toll-like receptor signaling and immunity at large. Annu. Rev. Immunol. 24: 353-389. [Medline]
  12. Meylan, E., J. Tschopp, M. Karin. 2006. Intracellular pattern recognition receptors in the host response. Nature 442: 39-44. [Medline]
  13. Radtke, A. L., M. X. O'Riordan. 2006. Intracellular innate resistance to bacterial pathogens. Cell. Microbiol. 8: 1720-1729. [Medline]
  14. Swanson, M. S.. 2006. Autophagy: eating for good health. J. Immunol. 177: 4945-4951. [Abstract/Free Full Text]
  15. Taylor, G. A.. 2007. IRG proteins: key mediators of interferon-regulated host resistance to intracellular pathogens. Cell. Microbiol. 9: 1099-1107. [Medline]
  16. Franchi, L., C. McDonald, T. D. Kanneganti, A. Amer, G. Núñez. 2006. Nucleotide-binding oligomerization domain-like receptors: intracellular pattern recognition molecules for pathogen detection and host defense. J. Immunol. 177: 3507-3513. [Abstract/Free Full Text]
  17. Fritz, J. H., R. L. Ferrero, D. J. Philpott, S. E. Girardin. 2006. Nod-like proteins in immunity, inflammation and disease. Nat. Immunol. 7: 1250-1257. [Medline]
  18. Opitz, B., S. Hippenstiel, J. Eitel, N. Suttorp. 2007. Extra- and intracellular innate immune recognition in endothelial cells. Thromb. Haemostasis 98: 319-326. [Medline]
  19. Ting, J. P., D. L. Kastner, H. M. Hoffman. 2006. CATERPILLERs, pyrin and hereditary immunological disorders. Nat. Rev. Immunol. 6: 183-195. [Medline]
  20. Martinon, F., J. Tschopp. 2005. NLRs join TLRs as innate sensors of pathogens. Trends Immunol. 26: 447-454. [Medline]
  21. Diez, E., S. H. Lee, S. Gauthier, Z. Yaraghi, M. Tremblay, S. Vidal, P. Gros. 2003. Birc1e is the gene within the Lgn1 locus associated with resistance to Legionella pneumophila. Nat. Genet. 33: 55-60. [Medline]
  22. Fortier, A., C. de Chastellier, S. Balor, P. Gros. 2006. Birc1e/Naip5 rapidly antagonizes modulation of phagosome maturation by Legionella pneumophila. Cell. Microbiol. 9: 910-923. [Medline]
  23. Molofsky, A. B., B. G. Byrne, N. N. Whitfield, C. A. Madigan, E. T. Fuse, K. Tateda, M. S. Swanson. 2006. Cytosolic recognition of flagellin by mouse macrophages restricts Legionella pneumophila infection. J. Exp. Med. 203: 1093-1104. [Abstract/Free Full Text]
  24. Wright, E. K., S. A. Goodart, J. D. Growney, V. Hadinoto, M. G. Endrizzi, E. M. Long, K. Sadigh, A. L. Abney, I. Bernstein-Hanley, W. F. Dietrich. 2003. Naip5 affects host susceptibility to the intracellular pathogen Legionella pneumophila. Curr. Biol. 13: 27-36. [Medline]
  25. Zamboni, D. S., K. S. Kobayashi, T. Kohlsdorf, Y. Ogura, E. M. Long, R. E. Vance, K. Kuida, S. Mariathasan, V. M. Dixit, R. A. Flavell, et al 2006. The Birc1e cytosolic pattern-recognition receptor contributes to the detection and control of Legionella pneumophila infection. Nat. Immunol. 7: 318-325. [Medline]
  26. Amer, A., L. Franchi, T. D. Kanneganti, M. Body-Malapel, N. Ozoren, G. Brady, S. Meshinchi, R. Jagirdar, A. Gewirtz, S. Akira, G. Núñez. 2006. Regulation of Legionella phagosome maturation and infection through flagellin and host Ipaf. J. Biol. Chem. 281: 35217-35223. [Abstract/Free Full Text]
  27. Lamkanfi, M., A. Amer, T. D. Kanneganti, R. Munoz-Planillo, G. Chen, P. Vandenabeele, A. Fortier, P. Gros, G. Núñez. 2007. The Nod-like receptor family member naip5/birc1e restricts Legionella pneumophila growth independently of caspase-1 activation. J. Immunol. 178: 8022-8027. [Abstract/Free Full Text]
  28. Franchi, L., A. Amer, M. Body-Malapel, T. D. Kanneganti, N. Ozoren, R. Jagirdar, N. Inohara, P. Vandenabeele, J. Bertin, A. Coyle, et al 2006. Cytosolic flagellin requires Ipaf for activation of caspase-1 and interleukin 1β in salmonella-infected macrophages. Nat. Immunol. 7: 576-582. [Medline]
  29. Miao, E. A., C. M. Alpuche-Aranda, M. Dors, A. E. Clark, M. W. Bader, S. I. Miller, A. Aderem. 2006. Cytoplasmic flagellin activates caspase-1 and secretion of interleukin 1β via Ipaf. Nat. Immunol. 7: 569-575. [Medline]
  30. Ren, T., D. S. Zamboni, C. R. Roy, W. F. Dietrich, R. E. Vance. 2006. Flagellin-deficient Legionella mutants evade caspase-1- and Naip5-mediated macrophage immunity. PLoS Pathog. 2: e18[Medline]
  31. Amer, A. O., M. S. Swanson. 2005. Autophagy is an immediate macrophage response to Legionella pneumophila. Cell. Microbiol. 7: 765-778. [Medline]
  32. Derre, I., R. R. Isberg. 2004. Macrophages from mice with the restrictive Lgn1 allele exhibit multifactorial resistance to Legionella pneumophila. Infect. Immun. 72: 6221-6229. [Abstract/Free Full Text]
  33. Fraser, D. W., T. R. Tsai, W. Orenstein, W. E. Parkin, H. J. Beecham, R. G. Sharrar, J. Harris, G. F. Mallison, S. M. Martin, J. E. McDade, et al 1977. Legionnaires’ disease: description of an epidemic of pneumonia. N. Engl. J. Med. 297: 1189-1197. [Abstract]
  34. Sabria, M., M. Campins. 2003. Legionnaires’ disease: update on epidemiology and management options. Am. J. Respir. Med. 2: 235-243. [Medline]
  35. Stout, J. E., V. L. Yu. 1997. Legionellosis. N. Engl. J. Med. 337: 682-687. [Free Full Text]
  36. Hawn, T. R., A. Verbon, K. D. Lettinga, L. P. Zhao, S. S. Li, R. J. Laws, S. J. Skerrett, B. Beutler, L. Schroeder, A. Nachman, et al 2003. A common dominant TLR5 stop codon polymorphism abolishes flagellin signaling and is associated with susceptibility to Legionnaires’ disease. J. Exp. Med. 198: 1563-1572. [Abstract/Free Full Text]
  37. Hawn, T. R., A. Verbon, M. Janer, L. P. Zhao, B. Beutler, A. Aderem. 2005. Toll-like receptor 4 polymorphisms are associated with resistance to Legionnaires’ disease. Proc. Natl. Acad. Sci. USA 102: 2487-2489. [Abstract/Free Full Text]
  38. Akiyama, Y., R. Griffith, P. Miller, G. W. Stevenson, S. Lund, D. J. Kanapa, H. C. Stevenson. 1988. Effects of adherence, activation and distinct serum proteins on the in vitro human monocyte maturation process. J. Leukocyte Biol. 43: 224-231. [Abstract]
  39. Andreesen, R., W. Brugger, C. Scheibenbogen, M. Kreutz, H. G. Leser, A. Rehm, G. W. Lohr. 1990. Surface phenotype analysis of human monocyte to macrophage maturation. J. Leukocyte Biol. 47: 490-497. [Abstract]
  40. Musson, R. A.. 1983. Human serum induces maturation of human monocytes in vitro: changes in cytolytic activity, intracellular lysosomal enzymes, and nonspecific esterase activity. Am. J. Pathol. 111: 331-340. [Abstract]
  41. Opitz, B., A. Rejaibi, B. Dauber, J. Eckhard, M. Vinzing, B. Schmeck, S. Hippenstiel, N. Suttorp, T. Wolff. 2007. IFNβ induction by influenza A virus is mediated by RIG-I which is regulated by the viral NS1 protein. Cell. Microbiol. 9: 930-938. [Medline]
  42. Slevogt, H., J. Seybold, K. N. Tiwari, A. C. Hocke, C. Jonatat, S. Dietel, S. Hippenstiel, B. B. Singer, S. Bachmann, N. Suttorp, B. Opitz. 2007. Moraxella catarrhalis is internalized in respiratory epithelial cells by a trigger-like mechanism and initiates a TLR2- and partly NOD1-dependent inflammatory immune response. Cell. Microbiol. 9: 694-707. [Medline]
  43. N'Guessan, P. D., M. O. Etouem, B. Schmeck, A. C. Hocke, S. Scharf, K. Vardarova, B. Opitz, A. Flieger, N. Suttorp, S. Hippenstiel. 2007. Legionella pneumophila-induced PKC{alpha}-, MAPK-, and NF-{kappa}B-dependent COX-2 expression in human lung epithelium. Am. J. Physiol. 292: L267-L277.
  44. Samrakandi, M. M., S. L. Cirillo, D. A. Ridenour, L. E. Bermudez, J. D. Cirillo. 2002. Genetic and phenotypic differences between Legionella pneumophila strains. J. Clin. Microbiol. 40: 1352-1362. [Abstract/Free Full Text]
  45. Akamine, M., F. Higa, S. Haranaga, M. Tateyama, N. Mori, K. Heuner, J. Fujita. 2007. Interferon-{gamma} reverses the evasion of Birc1e/Naip5 gene mediated murine macrophage immunity by Legionella pneumophila mutant lacking flagellin. Microbiol. Immunol. 51: 279-287. [Medline]
  46. Coers, J., R. E. Vance, M. F. Fontana, W. F. Dietrich. 2007. Restriction of Legionella pneumophila growth in macrophages requires the concerted action of cytokine and Naip5/Ipaf signalling pathways. Cell. Microbiol. 9: 2344-2357. [Medline]
  47. MacMicking, J. D.. 2005. Immune control of phagosomal bacteria by p47 GTPases. Curr. Opin. Microbiol. 8: 74-82. [Medline]
  48. Opitz, B., M. Vinzing, V. van Laak, B. Schmeck, G. Heine, S. Gunther, R. Preissner, H. Slevogt, P. D. N'Guessan, J. Eitel, et al 2006. Legionella pneumophila induces IFNβ in lung epithelial cells via IPS-1 and IRF3, which also control bacterial replication. J. Biol. Chem. 281: 36173-36179. [Abstract/Free Full Text]
  49. Peracino, B., C. Wagner, A. Balest, A. Balbo, B. Pergolizzi, A. A. Noegel, M. Steinert, S. Bozzaro. 2006. Function and mechanism of action of dictyostelium Nramp1 (Slc11a1) in bacterial infection. Traffic 7: 22-38. [Medline]
  50. Schiavoni, G., C. Mauri, D. Carlei, F. Belardelli, M. C. Pastoris, E. Proietti. 2004. Type I IFN protects permissive macrophages from Legionella pneumophila infection through an IFN-{gamma}-independent pathway. J. Immunol. 173: 1266-1275. [Abstract/Free Full Text]
  51. Damiano, J. S., R. M. Newman, J. C. Reed. 2004. Multiple roles of CLAN (caspase-associated recruitment domain, leucine-rich repeat, and NAIP CIIA HET-E, and TP1-containing protein) in the mammalian innate immune response. J. Immunol. 173: 6338-6345. [Abstract/Free Full Text]
  52. Davoodi, J., L. Lin, J. Kelly, P. Liston, A. E. MacKenzie. 2004. Neuronal apoptosis-inhibitory protein does not interact with Smac and requires ATP to bind caspase-9. J. Biol. Chem. 279: 40622-40628. [Abstract/Free Full Text]
  53. Hutchison, J. S., R. E. Derrane, D. L. Johnston, N. Gendron, D. Barnes, H. Fliss, W. J. King, I. Rasquinha, J. MacManus, G. S. Robertson, A. E. MacKenzie. 2001. Neuronal apoptosis inhibitory protein expression after traumatic brain injury in the mouse. J. Neurotrauma 18: 1333-1347. [Medline]
  54. Maier, J. K., Z. Lahoua, N. H. Gendron, R. Fetni, A. Johnston, J. Davoodi, D. Rasper, S. Roy, R. S. Slack, D. W. Nicholson, A. E. MacKenzie. 2002. The neuronal apoptosis inhibitory protein is a direct inhibitor of caspases 3 and 7. J. Neurosci. 22: 2035-2043. [Abstract/Free Full Text]
  55. Molmeret, M., S. D. Zink, L. Han, A. Abu-Zant, R. Asari, D. M. Bitar, K. Y. Abu. 2004. Activation of caspase-3 by the Dot/Icm virulence system is essential for arrested biogenesis of the Legionella-containing phagosome. Cell. Microbiol. 6: 33-48. [Medline]
  56. Bekpen, C., J. P. Hunn, C. Rohde, I. Parvanova, L. Guethlein, D. M. Dunn, E. Glowalla, M. Leptin, J. C. Howard. 2005. The interferon-inducible p47 (IRG) GTPases in vertebrates: loss of the cell autonomous resistance mechanism in the human lineage. Genome Biol. 6: R92[Medline]



This article has been cited by other articles:


Home page
Eur Respir JHome page
K. Vardarova, S. Scharf, F. Lang, B. Schmeck, B. Opitz, J. Eitel, A. C. Hocke, H. Slevogt, A. Flieger, S. Hippenstiel, et al.
PKC{alpha} and PKC{epsilon} differentially regulate Legionella pneumophila-induced GM-CSF
Eur. Respir. J., November 1, 2009; 34(5): 1171 - 1179.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
A. Fortier, K. Doiron, M. Saleh, S. Grinstein, and P. Gros
Restriction of Legionella pneumophila Replication in Macrophages Requires Concerted Action of the Transcriptional Regulators Irf1 and Irf8 and Nod-Like Receptors Naip5 and Nlrc4
Infect. Immun., November 1, 2009; 77(11): 4794 - 4805.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
J. M. Rumble and C. S. Duckett
Diverse functions within the IAP family
J. Cell Sci., November 1, 2008; 121(21): 3505 - 3507.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vinzing, M.
Right arrow Articles by Opitz, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vinzing, M.
Right arrow Articles by Opitz, B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS