|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


* Department of Internal Medicine/Infectious Diseases and Pulmonary Medicine, Charité Universitätsmedizin Berlin, Berlin;
Institute of Biochemistry Charité, Berlin; and
Robert Koch-Institut, Research Group NG5 Pathogenesis of Legionella Infections, Berlin, Germany
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Innate immunity serves as the first-line defense system against invading pathogens such as bacteria or viruses. It senses microbial-derived molecules including LPS, microbial nucleic acids, peptidoglycan, or flagellin by so-called pattern recognition receptors (PRRs) like the TLRs, the retinoic acid-inducible gene-like receptors (RLRs), or the nucleotide-binding oligomerization domain (Nod)-like receptors (NLRs). Sensing by these receptors activates signaling cascades finally leading to the production of inflammatory mediators, recruitment of phagocytic cells, and to control of the acquired immune response (10, 11, 12). Additionally, innate intracellular resistance activities exist in different cell types and are particularly important for controlling intracellular bacterial infections (13, 14, 15). The mechanisms and the regulation of the innate intracellular defense against bacterial pathogens are, however, not well understood.
Members of the human NLR family are involved in pathogen detection within the cytosol. They consist of a leucine-rich repeat domain and a central Nod (16, 17, 18, 19). Additionally, they contain amino-terminal effector binding domains such as caspase recruitment domains (CARD), pyrin domains, or baculovirus inhibitor of apoptosis repeat domains that mediate activation of different signaling pathways. Thus, after activation of the NLRs NOD1 and NOD2, their CARDs mediate signal transduction finally leading to NF-
B-dependent gene expression (16, 17). In contrast, other NLRs such as Nalp1–3 do not seem to primarily regulate gene transcription but to control posttranslational processing and secretion of IL-1β and IL-18 by a mechanism involving their pyrin domain, the adaptor molecule apoptosis-associated speck-like protein containing a CARD (ASC), and caspase-1 (20).
Moreover, the mouse NLRs mNAIP5 (murine neuronal apoptosis inhibitory protein-5) and mIpaf (murine ICE protease-activating factor), which contain three baculovirus inhibitor of apoptosis repeat domains or a CARD, respectively, seem to control innate intracellular resistance mechanisms. Macrophages of most inbred mouse strains (such as C57BL/6 mice) restrict intracellular replication of L. pneumophila dependent on a functional mNAIP5. In contrast, A/J mice macrophages expressing a mNAIP5 that differs in 14 amino acids from C57BL/6 mNAIP5, and which have an overall low mNAIP5 expression, support Legionella growth (21, 22, 23, 24, 25). Additionally, mIpaf knock-out C57BL/6 mouse macrophages are also permissive for intracellular Legionella replication (25, 26, 27). Although both mNAIP5 and mIpaf appear to be involved in intracellular, TLR5-independent recognition of flagellin (23, 28, 29, 30), the mechanisms by which mNAIP5 and mIpaf restrict the bacterial replication are still a matter of controversy but may rely on a caspase-1-dependent inflammatory cell death, or on a (perhaps autophagy-dependent) promotion of LCV-lysosome fusion (22, 23, 25, 26, 27, 31, 32).
In contrast to most inbred mice strains, human beings show susceptibility to L. pneumophila by getting either the acute, febrile, self-limiting Pontiac fever or a severe pneumonia called Legionnaires disease (33, 34, 35). Especially the risk to develop Legionnaires disease might depend on the bacterial dose and on risk factors of the host such as age, smoking, chronic lung disease, cancer, and immunosuppression, but also on genetic factors including polymorphisms of innate immunity-related genes (36, 37).
In this study we show for the first time that the human orthologs of mNAIP5 and mIpaf are involved in L. pneumophila flagellin recognition and subsequent control of the bacterial replication.
| Materials and Methods |
|---|
|
|
|---|
The L. pneumophila Sg 1 strains used in this study were wild-type Corby and Corby deficient in flagellin (
flaA; kindly provided by K. Heuner, Würzburg, Germany). L. pneumophila was grown on buffered charcoal-yeast extract (BCYE) agar for 2 days at 37°C before use.
Polymerase chain reaction
Wild-type Corby and Corby deficient in flagellin were grown as described above, RNA was extracted using peqGOLD RNAPure (PeqLab Biotechnologie), and expression of flaA was assessed by PCR with bacterial gyrase serving as a control (flaA sense: AAGCTGCCAACTCGACCAATA, antisense: CCTCCTCCAATTGCGATAGTA; gyrase sense: CACATATGGCCGGCTTTAGAG, antisense TCGCGCTTGTTTTGCTGAG).
Cell culture
The human alveolar epithelial A549 cells (DSMZ) were cultured in Hams F12 (PAA) containing 10% FCS. The human monocyte cell line THP-1 was obtained from DSMZ and cultured in RPMI 1640 (Invitrogen) containing 10% FCS and 4.5 mM glutamine. Transfected (see below) or untreated THP-1 cells were seeded in appropriate culture dishes and treated with 100 ng/ml PMA (Sigma-Aldrich) for 1 day to induce maturation toward adherent macrophage-like cells. Subsequently, adherent THP-1 cells were cultured in medium without PMA for further 2 days before infection. Primary human monocytes were isolated from buffy coat preparations supplied by the German Red Cross (Berlin, Germany). Buffy coat was diluted 1/1 in RPMI 1640 containing 0.5% FCS and 0.2 mM EDTA, centrifuged twice over Ficoll (Amersham) for 25 min at 20°C and 800 x g, and immediately used for siRNA transfection experiments (see below). After transfection, monocytes were cultured in RPMI 1640 supplemented with 10% FCS, 4.5 mM glutamine for 5 days to get monocyte-derived macrophages (38, 39, 40). Studies with human alveolar macrophages were approved by the local ethics committee. Cells were recovered by bronchoalveolar lavage performed for routine diagnostic purposes, washed twice in cold PBS, then either resuspended at 106/ml in RPMI 1640/10% FCS/penicillin/streptomycin, or immediately transfected as described below. Untreated or transfected alveolar macrophages were placed into 24-well tissue culture plates and allowed to adhere for 2 h. The monolayers were then washed three times to remove nonadherent cells and antibiotics, and cultured in RPMI 1640/10% FCS until infections.
RNA interference in THP-1 cells, A549 cells, human monocytes, and alveolar macrophages
Control nonsilencing siRNA (sense UUCUCCGAACGUGUCACGUtt, antisense ACGUGACACGUUCGGAGAAtt), hNAIP siRNA (pool of sequence 1: sense, GGUCUUUGGCAACUUGAACtt; antisense, GUUCAAGUUGCCAAAGACCtc; sequence 2: sense, GGAGGUAAAAUGAGGUACCtt; antisense, GGUACCUCAUUUUACCUCCtt) and Ipaf siRNA (sense, GGUUCAAGCCAAAGUAUAAtt; antisense, UUAUACUUUGGCUUGAACCtt) were from Ambion. THP-1 cells or A549 cells were transfected by using Amaxa Nucleofector (Amaxa) according to the manufacturers protocol (Nucleofector solution V, Nucleofector program T-08 or G-16, respectively) with 2 µg siRNA per 106 cells (41, 42). Primary human monocytes were transfected by using Amaxa Nucleofector according to the manufacturers protocol (human monocyte Nucleofector kit, Nucleofector program Y-01) with 5 µg siRNA per 1.5 x 107 cells. Alveolar macrophages were transfected by using Amaxa Nucleofector (human monocyte Nucleofector kit, Nucleofector program Y-01) with 5 µg siRNA per 0.5 x 107 cells.
Overexpression assays
Full-length cDNA clone encoding hIpaf (IRAKp961A1050Q; RZPD) was subcloned into the human expression vector pcDNA3.1 (Invitrogen) via KpnI and NotI sites. Full-length hNAIP cDNA (NM_004536.1) in pCMV6-XL5 was from OriGene. pcDNA3 encoding A/J mice NAIP5 and pcDNA3 encoding C57BL/6 mice NAIP5 were kindly provided by Drs. D. Zamboni and C. Roy (New Haven, CT). A549 cells were transfected using Amaxa Nucleofector as described for siRNA with 1.5 µg empty control vector, hNAIP, mNAIP5s, or hIpaf.
Western blotting
Protein extracts of cells infected with L. pneumophila (Corby) with a multiplicity of infection (MOI) of 10 were separated by SDS-PAGE and blotted. Membranes were exposed to Abs specific to hNAIP (Biozol), hIpaf (ProSci), cyclooxygenase (COX)-2 (Santa Cruz Biotechnology), p38 (Santa Cruz Biotechnology), FAK (focal adhesion kinase) (Upstate Biotechnology), ERK-2 (Santa Cruz Biotechnology), or Akt (Cell Signaling Technology), and subsequently incubated with secondary Abs (IRDye 800-labeled anti-mouse or Cy5.5-labeled anti-rabbit). Proteins were detected using an Odyssey infrared imaging system (LI-COR).
Bacterial replication assay
Where indicated, 72 h (A549, THP-1, alveolar macrophages) or 120 h (monocyte-derived macrophages) after siRNA transfection, cells were infected with L. pneumophila (Corby) or flaA-deficient L. pneumophila (Corby) at a MOI of 0.1 (A549) or 0.02 (THP-1, human macrophages), centrifuged for 10–30 min at 800 x g, and incubated for a further 1.5 h at 37°C. Cells were then washed twice with PBS, and culture medium containing 50 µg/ml gentamicin was added to the cells for 1 h to kill remaining extracellular Legionella. Subsequently, cells were washed and culture medium was added (this time point represents the 0 h). Cells were incubated and washed at the indicated time intervals with PBS, lysed with aqua ad injectabilia for 10 min, and lysates were plated on BCYE agar to count Legionella CFU. Intracellular growth was calculated as (total CFU at x h)/(CFU at 0 h).
Confocal laser scanning microscopy
Seventy-two hours after siRNA transfection, THP-1 or A549 cells were infected with L. pneumophila strain Corby or flagellin-lacking Legionella at a MOI of 0.02 (THP-1) or 0.1 (A549) for 2 h, and extracellular bacteria were removed by washing and were killed by gentamicin. After 48 h, cells were fixed for 20 min at room temperature (RT) with 3% paraformaldehyde in PBS pH 7.4 and permeabilized for 15 min at RT with 1% Triton X-100, followed by incubation for 30 min at RT in blocking solution (5% goat serum) and exposure to an Ab specific to Legionella (Biozol) and subsequent incubation with a secondary Ab (Alexa Fluor 488-conjugated anti-mouse IgG; Invitrogen). Additional F-actin staining was conducted with phalloidin Alexa Fluor 546 (Molecular Probes). Coverslips were mounted on slides using PermaFluor and visualized using an LSM5 Pascal microscope (Carl Zeiss).
Statistics
Results were statistically evaluated using Students t tests (Fig. 1) or two-way ANOVA and Bonferroni post test (Figs. 3–7). p values of <0.05 are indicated by one asterisk.
|
|
|
|
|
|
| Results |
|---|
|
|
|---|
To characterize the effects of flagellin on L. pneumophila growth, THP-1 macrophage-like and A549 lung epithelial cells were infected with the bacteria and bacterial replication was assessed. We found that in both cell types, growth of flagellin-deficient L. pneumophila was enhanced after 24 and 48 h compared with L. pneumophila wild-type (Fig. 1, A and B).
Both human macrophages as well as human lung epithelial cells expressed hNAIP, whereas only macrophages expressed hIpaf
The effect of L. pneumophila flagellin on the bacterial replication in human cells together with the recent findings that mNAIP5 and mIpaf are involved in flagellin recognition and L. pneumophila growth restriction in murine cells (23, 28, 29, 30) led us to take a closer look at human orthologs of mNAIP5 and mIpaf. Humans express one hIpaf that is highly homologous to mIpaf. In contrast, mice and humans differ considerably in expression of NAIP/Birc1 proteins. Whereas mice express seven mNAIP/mBirc1 paralogs (mNAIP1–7/mBirc1a–g), humans contain only one hNAIP/hBirc1. Interestingly, hNAIP/hBirc1 shares 68% homology with C57BL/6 and A/J mNAIP5/mBirc1e. Moreover, concerning the 14 amino acids in which C57BL/6 mNAIP5 and A/J mNAIP5 differ and which thus seem to be crucial for functionality regarding L. pneumophila growth restriction in murine macrophages, hNAIP/hBirc1 is equally related to C57BL/6 and to A/J mNAIP5 (5 amino acids similar to C57BL/6 mNAIP5, and 5 amino acids similar to A/J mNAIP5; data not shown).
We analyzed expression of hNAIP and hIpaf in THP-1 macrophages, primary macrophages, and A549 epithelial cells and found that hNAIP was expressed in all three cell types, whereas hIpaf protein and transcript were found in macrophages but not in A549 epithelial cells (Fig. 2 and data not shown; see also Fig. 7 and 8). COX-2, which is up-regulated during L. pneumophila infection, and p38, which is constitutively expressed (43), were assessed in parallel as a positive control and as a loading control, respectively.
|
|
Gene silencing experiments were conducted to examine the function of hNAIP in L. pneumophila infection of human cells. First, it was verified that siRNA transfection per se did not affect Legionella growth (Fig. 3A). THP-1 and A549 cells were transfected with control siRNA or hNAIP-specific siRNA, infected with Legionella as indicated, and specific hNAIP knock-down was observed by immunoblot analysis at different time points (Fig. 3B). Functional assays demonstrated that L. pneumophila wild-type replicated more efficiently in macrophages (Fig. 3C) and epithelial cells (Fig. 3D) in which hNAIP expression was inhibited. In accord with these results, confocal microscopy studies demonstrated enhanced replication of L. pneumophila in hNAIP knock-down human THP-1 macrophages (Fig. 3E) and epithelial cells (Fig. 3F). Although in contrast to wild-type Legionella infections, hNAIP knock-down had a less prominent effect on the replication of flagellin-deficient Legionella, some differences could also be observed at least in epithelial cells (Fig. 3D). They were, however, statistically insignificant and might be related to an incomplete knock-down (and thus a remaining expression/function) of hNAIP in these cells. Overall, the data suggested that hNAIP restricted L. pneumophila growth within human macrophages and epithelial cells by a mechanism potentially involving recognition of bacterial flagellin.
Overexpression of hNAIP reduced L. pneumophila replication in human cells
To further support the hypothesis that hNAIP restricts L. pneumophila growth, overexpression assays were performed. For this assay, A549 epithelial cells were used in which cDNA transfection efficiency is higher (
55%) compared with THP-1 cells. Cells were transfected with hNAIP, C57BL/6 mNAIP5, A/J mNAIP5, or an empty control vector, and expression levels of mNAIP5/hNAIP were assessed by Western blotting (Fig. 4, upper panel). Next, untreated or transfected cells were infected with L. pneumophila wild-type for 24 and 48 h. As shown in Fig. 4 (lower panel), overexpression of hNAIP and C57BL/6 mNAIP5 reduced the bacterial growth within the cells examined. Moreover, overexpressed A/J mNAIP5 also appeared to partially restrict the bacterial growth; the effect, however, did not reach statistical significance. In contrast to direct overexpression of hNAIP/mNAIP5 in the host cells examined, treatment of nontransfected host cells with sterile-filtrated supernatants of hNAIP-overexpressing and Legionella-infected cells did not influence L. pneumophila replication in the nontransfected host cells (data not shown), thus indicating a direct rather than paracrine effect of hNAIP on Legionella growth. Overall, the results presented supported the knock-down data and clearly demonstrated that hNAIP mediated restriction of L. pneumophila growth within human host cells.
Ipaf siRNA led to an enhanced replication of L. pneumophila in human macrophages
To investigate whether hIpaf is functional in controlling L. pneumophila growth, hIpaf gene silencing experiments in human THP-1 macrophages, which in contrast to A549 epithelial cells expressed hIpaf, were performed. Fig. 5A shows a specific knock-down of endogenous hIpaf by siRNA 72 to 120 h after transfection. Moreover, hIpaf knock-down led to an enhanced replication of wild-type L. pneumophila in human THP-1 macrophages as demonstrated by replication assay (Fig. 5B) and by confocal microscopy (Fig. 5C). Similar to the situation in hNAIP knock-down cells, hIpaf gene silencing had little further effect on the enhanced replication of flagellin-deficient L. pneumophila. These data thus suggested that in addition to hNAIP, hIpaf was involved in L. pneumophila flagellin recognition and subsequent Legionella growth restriction.
hIpaf overexpression impaired replication of L. pneumophila in human cells
In a complementary approach, L. pneumophila replication in hIpaf-overexpressing A549 cells was examined. Legionella growth was strongly reduced in epithelial cells overexpressing hIpaf compared with untreated cells or cells that were transfected with the empty vector (Fig. 6). These results thus supported the aforementioned data and showed that hIpaf played a role in restricting growth of L. pneumophila. In contrast to direct overexpression of hIpaf in the host cells examined, treatment of nontransfected host cells with sterile-filtrated supernatants of Ipaf-overexpressing and Legionella-infected cells did not influence L. pneumophila replication within the nontransfected host cells (data not shown), thus indicating a direct rather than paracrine effect of hIpaf on Legionella growth.
Effect of L. pneumophila flagellin and host cell hNAIP and hIpaf on bacterial replication in primary human monocyte-derived macrophages and alveolar macrophages
To provide further evidence for the important role of bacterial flagellin and of host cell hNAIP and hIpaf on L. pneumophila replication, gene silencing and infection experiments in primary human monocyte-derived and primary alveolar macrophages were conducted. Control experiments showed that siRNA transfection did not unspecifically affect Legionella growth in these cells (Figs. 7A and 8A). Transfection with hNAIP-specific or hIpaf-specific siRNA resulted in knock-down of the respective proteins as determined by Western blotting (Figs. 7B and 8B). Following RNA interference, primary human monocyte-derived and alveolar macrophages were infected with wild-type L. pneumophila or flagellin-deficient L. pneumophila and CFU were counted. Figs. 7, C and D, 8, C and D, and Tables I and II indicate that replication of flagellin-deficient bacteria was enhanced compared with L. pneumophila wild-type. Moreover, L. pneumophila wild-type growth was increased in cells in which hNAIP or hIpaf expression was inhibited compared with control transfected cells. In contrast, hNAIP and hIpaf gene silencing had no effect on the enhanced replication of flagellin-deficient L. pneumophila. Thus, hNAIP and hIpaf were important in L. pneumophila infection of primary human macrophages.
|
|
| Discussion |
|---|
|
|
|---|
Our data suggest that hNAIP and hIpaf fulfill comparable functions in human cells to mNAIP5 and mIpaf in C57BL/6 mice. However, human macrophages and epithelial cells do support a stronger replication of L. pneumophila (
100-fold after 48 h) than do macrophages of, for example, C57BL/6 mice (not exceeding 10-fold) (22, 23, 25, 27, 30, 32). A possible explanation for this discrepancy could be that hNAIP or hIpaf are in principle functional but less effective in L. pneumophila growth restriction compared with mNAIP5 and mIpaf. The fact that hNAIP stays with respect to the apparently critical 14 amino acids exactly between the C57BL/6 mNAIP5 and the A/J mNAIP5 might have supported this suggestion, but our overexpression assay in which C57BL/6 mNAIP5 and hNAIP appear to be similarly effective in L. pneumophila restriction argues against this hypothesis. Another explanation would be that expression of mNAIP5/hNAIP in mice and man differs, or that different L. pneumophila strains were used in the mice studies and in our study. Strain Corby, which was used in this study, is clearly more infectious than the Philadelphia-originated strains (e.g., Lp01, Lp02) used in most of the mice studies (44).
On the other hand, full innate intracellular resistance to L. pneumophila (and certainly other intracellular bacteria) depends on many additional mechanisms such as types I and II IFN- as well as TNF-
-mediated effects, and perhaps also on Nramp1, antimicrobial peptides, or immunity-related GTPases (13, 15, 45, 46, 47, 48, 49, 50). It might thus be conceivable that in case of L. pneumophila infection, one of these last mentioned resistance mechanisms is less functional in human cells compared with mice resulting in an overall stronger replication of Legionella in human cells compared with, for example, C57BL/6 macrophages despite functional hNAIP and hIpaf. Considering the striking differences in expression and regulation of the immunity-related GTPases in mice and men (15, 47), these proteins might represent promising candidates for future studies.
Although in this study we did not intend to gain deep mechanistic insight into how hNAIP and hIpaf restrict L. pneumophila replication, some conclusions can be drawn. First, supernatants of hNAIP- or hIpaf-overexpressing cells did not influence L. pneumophila replication within nontransfected host cells, thus indicating a direct rather than paracrine effect of hNAIP and hIpaf on Legionella growth. Second, our finding that hNAIP is functional in lung epithelial cells that do not express hIpaf suggests that hNAIP/mNAIP5- and hIpaf/mIpaf-mediated growth restrictions represent two independent defense mechanisms, a suggestion that is supported by recent findings of G. Núñez and colleagues (27). The authors of this recent study indicated a role of caspase-1 in mIpaf-mediated Legionella growth restriction but not in mNAIP5-mediated effects (27).
Moreover, under our culture conditions, we did not observe significant differences in lactate dehydrogenase (LDH) release or apoptosis in hNAIP or hIpaf knock-down cells compared with control cells infected with L. pneumophila using low MOI (data not shown). This observation is consistent with some recent data (26, 27, 51) and does not necessarily contradict other studies in which much higher MOI were used. In these reports, a strong LDH release, which indicated an inflammatory cell death-dependent bacterial growth restriction, was noticed (23, 25, 29, 30). In contrast, we are aware of the fact that measurement of LDH release might not be sensitive enough, because in our assays using low MOI and observing 100-fold replication, only about every 20th cell gets infected after 48 h. Additionally, the previously reported binding and inhibition of caspase-3 (as well as casase-7 and caspase-9) by hNAIP (52, 53, 54) together with the published results that chemical caspase-3 inhibition blocks Legionella replication in U937 macrophages (55) might lead to the suggestion that caspase-3 contributes to hNAIP-mediated bacterial growth restriction. Own preliminary results, however, showing that caspase-3 siRNA did not affect intracellular Legionella replication (data not shown), together with published results demonstrating similar Legionella growth in wild-type mouse macrophages and caspase-3-deficient macrophages (25), argue against this hypothesis. Overall, while further elucidation is clearly needed, hNAIP/mNAIP5 and perhaps hIpaf/mIpaf might restrict L. pneumophila replication by different mechanisms including enforced phagoendosomal maturation/autophagy (22, 26, 27, 31, 32) and caspase-1-dependent cell death (23, 25, 29, 30) depending on the bacterial dose.
Although (knock-out) mice studies constitute an unique contribution to the understanding of biological processes (10, 11), many immune defense mechanisms differ considerably between humans and mice. For example, humans are thought to express functional TLRs 1–10, whereas mice express TLRs 1–7 and 9–13 (10, 11). There are seven mNAIP/mBirc1 paralogs in mice, only one hNAIP/hBirc1 protein in humans, and >20 immunity-related p47 GTPases in mice compared with 1–3 functional human orthologs (15, 47, 56). The innate defense mechanisms against intracellular/intravacuolar bacteria in mice and humans are therefore also likely to be different. We thus think that studies with human cells are mandatory, as they constitute an important contribution to the fragmentary knowledge of innate immune responses, especially those dealing with intracellular bacteria.
Overall, our results show that L. pneumophila flagellin is (directly or indirectly) recognized by hNAIP and hIpaf, which in turn mediate partial growth restriction of the bacteria. Further work, however, is required to better understand underlying mechanisms. Considering the strong phenotype of the different mNAIP5 alleles in mice, future studies should also examine whether hNAIP gene variations in humans exist and whether they affect human susceptibility toward Legionella infection and its different disease course (Pontiac fever vs Legionnaires disease).
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported in part by grants given by the Deutsche Forschungsgemeinschaft, the Deutsche Gesellschaft für Pneumologie und Beatmungsmedizin, and the Jürgen Manchot Stiftung (to B.O.), and by the Bundesministerium für Bildung und Forschung-funded network PROGRESS (to S.H. and N.S.). Parts of this work will be included in the M.D. thesis of M.V. ![]()
2 Address correspondence and reprint requests to Dr. Bastian Opitz, Department of Internal Medicine/Infectious Diseases and Pulmonary Medicine, Charité Universitätsmedizin Berlin, Augustenburger Platz 1, 13353 Berlin, Germany. E-mail address: bastian.opitz{at}charite.de ![]()
3 Abbreviations used in this paper: LCV, Legionella-containing vacuole; ASC, apoptosis-associated speck-like protein containing a CARD; CARD, caspase recruitment domain; COX, cyclooxygenase; FAK, focal adhesion kinase; Ipaf, ICE protease-activating factor; LDH, lactate dehydrogenase; MOI, multiplicity of infection; NAIP, neuronal apoptosis inhibitory protein; NLR, Nod-like receptor; Nod, nucleotide-binding oligomerization domain; PRR, pattern recognition receptor; RLR, RIG-like receptors; RT, room temperature. ![]()
Received for publication August 1, 2007. Accepted for publication March 10, 2008.
| References |
|---|
|
|
|---|
28 factor on virulence and flagellum expression of Legionella pneumophila. Infect. Immun. 70: 1604-1608.
-, MAPK-, and NF-
B-dependent COX-2 expression in human lung epithelium. Am. J. Physiol. 292: L267-L277.
reverses the evasion of Birc1e/Naip5 gene mediated murine macrophage immunity by Legionella pneumophila mutant lacking flagellin. Microbiol. Immunol. 51: 279-287. [Medline]
-independent pathway. J. Immunol. 173: 1266-1275. This article has been cited by other articles:
![]() |
K. Vardarova, S. Scharf, F. Lang, B. Schmeck, B. Opitz, J. Eitel, A. C. Hocke, H. Slevogt, A. Flieger, S. Hippenstiel, et al. PKC{alpha} and PKC{epsilon} differentially regulate Legionella pneumophila-induced GM-CSF Eur. Respir. J., November 1, 2009; 34(5): 1171 - 1179. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Fortier, K. Doiron, M. Saleh, S. Grinstein, and P. Gros Restriction of Legionella pneumophila Replication in Macrophages Requires Concerted Action of the Transcriptional Regulators Irf1 and Irf8 and Nod-Like Receptors Naip5 and Nlrc4 Infect. Immun., November 1, 2009; 77(11): 4794 - 4805. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Rumble and C. S. Duckett Diverse functions within the IAP family J. Cell Sci., November 1, 2008; 121(21): 3505 - 3507. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |