HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Related articles in The JI Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Xiang, Y. Articles by Garrard, W. T. Search for Related Content PubMed PubMed Citation Articles by Xiang, Y. Articles by Garrard, W. T.

The Downstream Transcriptional Enhancer, Ed, Positively Regulates Mouse Ig Gene Expression and Somatic Hypermutation¹

Department of Molecular Biology University of Texas, Southwestern Medical Center, Dallas, TX 75390

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
The mouse Ig locus has three known transcriptional enhancers: the matrix association region/intronic enhancer, the 3' enhancer (E3'), and the further downstream enhancer (Ed). Previous studies have shown that both matrix association region/intronic and E3' enhancers are required for maximal gene rearrangement of the locus, and that E3' is also required for maximal expression and somatic hypermutation (SHM). To functionally elucidate Ed in vivo, we generated knockout mice with a targeted germline deletion of Ed. Ed deleted homozygous mice (Ed–/–) have moderately reduced numbers of Ig expressing B cells and correspondingly increased numbers of Ig expressing B cells in spleen. Ed–/– mice also have decreased Ig mRNA expression in resting and T cell-dependent activated splenic B cells and reduced Ig chains in sera. However, our analysis indicates that Ig gene rearrangement is normal in Ed–/– mice. In addition, our results show that Ed–/– mice exhibit reduced SHM in the Ig gene J-C intronic region in germinal center B cells from Peyer’s patches. We conclude that Ed positively regulates Ig gene expression and SHM, but not gene rearrangement.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
During B cell development, the IgH chain gene rearranges first, by sequential D-J and then by V(D)J joining, leading to the pro- and pre-B cell stages of development, respectively (1). The Ig locus is poised for rearrangement in pre-B cells, and, upon appropriate signaling, one of the 95 V genes is semi-randomly selected for recombination to a J region (for review of recombination, see Ref. 2), evidently by the RAG proteins first making single-stranded nicks at V recombination signal sequences (RSS)³ followed by a capture model for synapsis (3). The Ig locus thus offers the opportunity to visualize changes in chromatin structure that may precede gene rearrangement and transcriptional activation during B lymphocyte differentiation, as well as those remodeling events that may accompany or be a consequence of gene activation (4 and Refs. within). In addition, the mouse Ig gene locus has provided a paradigm for investigating site-specific recombination and tissue-specific transcriptional regulation (reviewed in Ref. 5); somatic hypermutation (SHM) (reviewed in Ref.6); DNA methylation (7); higher-order chromatin organization (8); and nuclear organization and allelic exclusion (reviewed in ref. 9).

Several previous studies have identified a number of cis-acting regulatory elements in the mouse Ig gene locus. All of these elements reside in a 32 kb segment near or within the J-C region toward the 3' end of the 3.2 mega base locus, except for V gene promoter elements and their RSSs (10) and the recombining sequence (11). These include: a recombination silencer (12), two germline promoter elements (13, 14), KI-KII sequences (15), RSSs associated with J regions (16), a nuclear matrix association region (MAR) (17), an intronic enhancer (Ei) (18), a transcription terminating region (19), a 3' enhancer (E3') (20), and further downstream enhancer (Ed) (4).

The functional significance of several of the above cis-acting sequences has been addressed by creating their targeted deletion from the native locus in cell lines or mice. Deletion of a germline promoter, or KI-KII sequences, or both, results in lower levels of gene rearrangement (15, 21, 22). Deletion of the MAR from the mouse germline down-regulates SHM and mildly stimulates precocious V-J joining (23), whereas its deletion in a pre-B cell line results in hyper-recombination (24). Deletion of either MAR/intronic enhancer (MEi) or E3' severely reduces, but does not abolish, Ig gene rearrangement (25, 26), whereas deletion of both enhancers nearly completely blocks recombination, indicating that each element has a redundant, but critical, role in regulating gene rearrangement in the locus (27). Deletion of E3' also results in reduced SHM (28), in contrast to an earlier report (29), and also reduced Ig gene expression (26, 28).

Several years ago, our laboratory discovered a third enhancer in the mouse Ig locus, initially from an analysis of B cell-specific DNase I hypersensitive sites in chromatin (4). This enhancer is in the far downstream region, some 8 kb 3' of the E3' element, and was coined Ed. Because the mouse Ed sequence is heavily conserved in the human genome and shares NF-B and E2A binding sites, we decided to elucidate its function in the native locus by creating a targeted deletion in the mouse germline, and report here the phenotypes resulting from this deletion. We demonstrate that Ed plays no role in regulating recombination, a result consistent with our previous findings that the element exhibits hypersensitive sites in plasmacytoma cells but not in pre-B cells (4). Rather, we have found that Ed is required for maximal Ig gene expression in resting and T cell-dependent stimulated splenic B cells. We further demonstrate the SHM is down-regulated in germinal center (GC) B cells from Peyer’s patches of these Ed–/– knockout mice.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Generation of Ed knockout mice

Homology arms of the Ed targeting vector were genomic DNA fragments from a phage clone containing the mouse Ed genomic locus, which was isolated by screening a 129SVJ mouse genomic library (Stratagene). The Ed targeting vector was constructed as follows: first, a PGK-neo^r gene fragment flanked by two loxP sites was excised from the NL-24 vector (30) and cloned into pBluescript II KS (Stratagene), and a NdeI site was introduced into the PBS vector by inserting a polylinker. Next, a 3.6 kb NdeI 129SVJ genomic DNA fragment as a 3' homology arm was cloned into the NdeI site. And then, a 1.8 kb HindIII 129SVJ genomic DNA fragment corresponding to the 5' homology arm was cloned into a HindIII site. Finally, the 1.2 kb HindIII/NdeI Ed enhancer-containing fragment was PCR amplified using 129SVJ genomic DNA as template. A loxp site was introduced into this PCR fragment using the primers: Eddu:CATTAGCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCTGGGTGTATCTGATCGTTTTAG and Eddd: CATTAGCGGCCGCATGTATGCTATGGTACACTCAGG. The PCR used 35 cycles, each cycle consisted of 1 min at 94°C, 1 min at 59°C, and 2 min at 68°C. Then, the PCR-amplified Ed fragment was cloned into the Ed targeting vector. The SM-1 (129/SvEvTac) embryonic stem cell line was transformed by electroporation with SacII linearized targeting vector. G418 drug-resistant embryonic stem cell clones were first screened by PCR and correctly targeted clones were then verified by Southern blotting. Probe A or B (Fig. 1), residing outside of the targeting vector, were used to hybridize NcoI-digested embryonic stem (ES) cell genomic DNA. Three independent Ed targeted clones were injected into C57/BL6 blastocysts. Chimeric mice were bred with C57/BL6 mice to obtain germline transmission. Then germline transmissible mice were bred with Cre recombinase expressing MORE mice (31) to obtain Ed and neo^r deletion mice. All mice were used in accordance with protocols approved by the UT Southwestern Medical Center Institutional Animal Care and Use Committee.

View larger version (25K): [in this window] [in a new window]   FIGURE 1. Generation of Ed knockout mice. A, Genomic organization of the 3' region of the Ig locus. The 1.2 kb HindIII-NdeI fragment shown as a shaded oval contains the entire Ed region. B, Targeting construct, with Ed and the neor gene flanked by three loxP sites. The HindIII-HindIII and NdeI-NdeI fragments were used as 5' and 3' homology arms. C, Targeted locus. Endogenous Ed was replaced with Ed-PGK-neor flanked by loxP sites. Probes are represented with thick lines. D, Ed deleted locus. Ed and the neor gene were deleted in vivo by Cre-loxP mediated recombination. E and F, Southern blot analysis of tail DNA. Tail genomic DNA was digested with NcoI and hybridized with probe A (E) or B (F). A 9.9 kb band derived from the WT allele and a 8.6 kb band derived from the Ed deleted allele were detected by probe A or B. A 5.0 kb band and a 6.2 kb band derived from the floxed allele were detected by probe A and B, respectively. New England BioLabs DNA markers were used for gel calibrations to determine fragment sizes.

Single-cell suspensions were prepared from bone marrow and spleen. Cells (1 x 10⁶) were stained with an optimal concentration of FITC-, PE-, or biotin-conjugated Abs in 100 µl of PBS/2%FCS for 20 min on 4°C. Stained cells were analyzed by a FACSCalibur (BD Biosciences). The following Abs were used: FITC-anti-B220 (RA3–6B2), anti- (R26–46), anti-CD21 (7G6) (BD Pharmingen); PE-anti-Ig (187.1), anti-B220 (RA3–6B2) (BD Pharmingen); biotinylated-anti-IgM (II/41), anti-CD138 (syndecan-1) (281-2) (BD Pharmingen); and FITC-anti-IgD (11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26), allophycocyanin-anti-CD23 (2G8) (Southern Biotechnology Associates). The biotin conjugates were revealed with allophycocyanin-streptavidin (Southern Biotechnology Associates). Only cells residing in the lymphocyte gate were analyzed. Dead cells were excluded by size and forward scatter gating. Data were analyzed with CellQuest (BD Biosciences) or FlowJo (Tree Star) software.

Northern blotting analysis of Ig expression

Single-cell suspensions were prepared and 2 x 10⁷ spleen cells from wild-type (WT) or Ed–/– mice were incubated with an optimal concentration of biotinylated anti- Abs and purified by using MACS MS separation columns (Miltenyi Biotec) according to the manufacturer’s instructions. ⁺ cell populations were found to be >93% pure by FACS analysis (data not shown). Splenic activated and resting B cells were purified by Percoll (Sigma-Aldrich) gradient centrifugation as described (32). Total RNA was isolated from purified cells by extraction with Trizol reagent (Invitrogen) according to the manufacturer’s instructions. Northern blotting was performed by using NorthernMax kits (Ambion) according to the manufacturer’s protocol. The β-actin probe was supplied by Ambion. The µ-chain probe was a 300 bp PCR product from the mouse IgH Cµ exon1. The -chain probe was a 410 bp XmnI fragment from the C region from the pSPIg8 plasmid.

B cell culture

Single-cell suspensions of spleens from WT and Ed–/– mice were incubated with an optimal concentration of biotinylated-anti-CD43 (Ly-48; BD Pharmingen) Ab and biotinylated-anti- (JC5-1; Southern Biotechnology Associates) Ab. Then MACS MS separation columns (Miltenyi Biotec) were used to deplete CD43⁺ and ⁺ B cells. ⁺ enriched B cells were cultured in RPMI 1640 medium supplemented with 10% FBS, penicillin/streptomycin, L-glutamine, and 50 µM 2-ME at 10⁶ cells/ml, and then were stimulated with 20 µg/ml LPS (Sigma-Aldrich), 2.5 µg/ml anti-CD40 Abs (HM40-3; BD Pharmingen) or 2.5 µg/ml anti-CD40 Abs and 10 ng/ml recombinant mouse IL-4 (BD Pharmingen) for 4 days.

ELISA analysis

Sera collected from 10–16-wk-old WT and Ed–/– mice were analyzed for Ig and Ig chain concentrations by sandwich ELISA. PVC microtiter plates (DYNEX Technologies) were coated with polyclonal goat anti-mouse Ig (H+L) (Southern Biotechnology Associates) at 10 µg/ml as the capturing Ab. After blocking for 2 h with 3% BSA in PBS at room temperature, diluted sera were added and incubated at 4°C overnight. Plates were subsequently washed three times and incubated with either goat anti-mouse -HRP or goat anti-mouse -HRP (Southern Biotechnology Associates) for 2 h. After washing three times, plates were developed with the ABTS substrate (Southern Biotechnology Associates) following the manufacturer’s instructions. Purified mouse IgG3, isotype standard and purified mouse IgG2a, isotype standard (BD Pharmingen) were used to quantitate ELISA data.

Southern blotting and quantitative PCR analysis of Ig V-J rearrangement

Single-cell suspensions containing 2 x 10⁷ splenic or bone marrow cells from WT or Ed–/– mice were incubated with an optimal concentration of biotinylated-anti- Ab or biotinylated-anti-B220 Ab, and ⁺ cells or B220⁺ cells were purified by using MACS MS separation columns. The purified cells were lysed in lysis buffer with proteinase K. Genomic DNA was then purified by phenol/chloroform extraction, followed by ethanol precipitation. A total of 10 µg of genomic DNA was digested with BamHI/EcoRI and transferred to Zeta-probe GT genomic membrane (Bio-Rad) after electrophoretic separation on agarose gels. Prehybridization and hybridization were performed at 65°C with ExpressHyb hybridization buffer (Clonetech). The membranes were hybridized with [-³²P] dCTP-labeled C and c-myb probes (26). Membranes were exposed to PhosphorImaging screens, and images were analyzed using ImageQuant software (Molecular Dynamics). A quantitative Ig V-J rearrangement PCR assay was performed as described (23, 27). Briefly, the VJ rearrangement products were PCR amplified by using the Platinum Taq high fidelity DNA polymerase (Invitrogen) with a degenerate V primer (VD) (33) and a MAR35 primer (27). PCR cycles were as follows: 94°C denaturation for 3 min, followed by 27 cycles at 94°C for 1 min, 60°C for 1 min, 68°C for 3 min, and a final 5 min extension at 68°C. The amount of genomic DNA used in each PCR was controlled by the c-myb PCR, which specifically amplifies a 0.7-kb c-myb gene genomic fragment (26). PCR products were resolved by electrophoresis in 1% agarose gels and transferred to -probe GT genomic membrane (Bio-Rad). The membranes were hybridized with a probe within the J to MEi region (Fig. 7D). Membranes were exposed to PhosphorImaging screens, and images were analyzed using ImageQuant software (Molecular Dynamics).

View larger version (25K): [in this window] [in a new window]   FIGURE 7. Analysis of V-J rearrangement levels by Southern blotting and quantitative PCR. A, Schematic diagram of the Southern blot assay for V-J rearrangement. E = EcoRI; B = BamHI. B, Electrophoretically resolved genomic DNA from splenic Ig+ cells that had been digested with EcoRI plus BamHI and transferred was hybridized with C and c-myb probes. The amount of EcoRI plus BamHI digested DNA was normalized by the c-myb signal. Ig germline (°)/c-myb ratio in ES cells was set as 100%. The % ° for each sample were calculated as: [(°/c-myb in samples)/(°/c-myb in ES cells)] x 100%. C, Bone marrow B220+ cells genomic DNA was analyzed as described in B. B and C, Data are representative of at least two independent experiments. D, Schematic diagram of the quantitative PCR assay used for VJ rearrangement. The positions of VD and MAR35 primers are indicated by the arrows, and the probe used for the Southern blot is indicated by a thick line. E, Analysis of J regions usage in splenic + and bone marrow B cells. VJ rearrangement PCR products were electrophoretically separated on agarose gels, and the intensities of VJ1 to VJ5 bands were quantitated by PhosphorImager analysis of the resulting Southern blot. The VJ5/VJ1 ratio of WT samples was set as 100%, and the ratio of Ed+/– and Ed–/– samples are shown in the figure. The Southern blot results of PCR amplification of c-myb are shown at the bottom, which were used to control for the amount of genomic DNA template in PCR.

Single-cell suspensions prepared from Peyer’s patches were stained with PE-anti-B220 and FITC-PNA (Vector Laboratories). B200⁺ PNA^high GC cells and B220⁺ PNA^low B cells were sorted on a MoFlo machine (Dako). For the J-C intronic region SHM analysis, genomic DNA was purified from sorted WT and Ed–/– GC B cells. The J-C intronic regions from rearranged genes were PCR amplified by using the Platinum Taq high fidelity DNA polymerase (Invitrogen) with a degenerate V primer (33) and a reverse primer located 600 bp downstream of the J5: AGCGAATTCAACTTAGGAGACAAAAGAGAGAAC. The PCR used 35 cycles, each cycle consisted of 30 s at 94°C, 30 s at 56°C, and 1 min at 68°C. Gel purified V-J5 PCR products were cloned into the PGEM-T vector (Promega). V-J5 clones were identified and sequenced by use of a T7 primer. Sequences were aligned with the mouse J5 downstream sequence using the Vector NT I (Invitrogen) AlignX program, and mismatches were scored as mutations in the 500 bp region downstream of J5.

	Results

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Generation of Ed–/– mice

To delete Ed from the native locus, we first constructed a targeting vector in which the entire 1.2 kb enhancer was replaced with Ed and a PGK-neo^r gene flanked by loxP sites (Fig. 1, A and B). ES cells were transfected with this linearized construct, and several clones that exhibited site-directed integration were obtained after screening by PCR and Southern blotting (Fig. 1C). Three independent targeted ES cell clones were used to generate chimeric mice lines. Chimeric mice were bred with C57/BL6 mice to obtain germline transmission. To delete Ed and the PGK-neo^r gene (Fig. 1D), we bred germline transmissible mice with Cre recombinase expressing MORE mice (31). Ed-deleted heterozygous mice were interbred to obtain Ed-deleted homozygous mice, which are referred to hereafter as Ed–/– mice. Various stages of the targeting and Ed deletion were confirmed by Southern blotting. Genomic DNA was digested with NcoI and hybridized with either probe A or B, which generated a 9.9 kb WT band, a 8.6 kb Ed-deleted band, and a 5.0 or 6.2 kb PGK-neo^r gene replacement band detected by probe A and B, respectively (Fig. 1, E and F).

Ed–/– mice exhibit a modest decrease in Ig expression in splenic B cells

We found that Ed–/– mice exhibited no significant differences in bone marrow and spleen B cell numbers compared with those of their WT littermates or age-matched WT mice (data not shown). However, Ed–/– mice exhibited a moderate decrease of Ig⁺ B cells in spleen compared with WT mice (Fig. 2A; 43 ± 1% vs 48 ± 2%, as percentages of Ig⁺ B cells among total lymphocytes, n = 6, p < 0.01, Student’s t test). In contrast, the percentage of Ig⁺ B cells was increased by 2-fold (Fig. 2A; 5.3 ± 1.5% vs 2.8 ± 0.5%, as percentages of Ig⁺ B cells among total lymphocytes, n = 5, p < 0.01, Student’s t test). These changes resulted in a moderate decrease of Ig/ ratio, 8.1/1 in Ed–/– mice as opposed to 17.1/1 in WT mice. Because the percentages of Ig⁺ and Ig⁺ B cells in bone marrow were not different between Ed–/– and WT mice (Fig. 2B), we conclude that the alteration in the distributions of Ig⁺ and Ig⁺ cells occurs in the periphery. Furthermore, FACS analysis showed that the percentages of pro- and pre-B cells (B220^low/IgM^–), newly generated immature B cells, and recirculating B cells (B220⁺/IgM⁺) in bone marrow exhibited no significant differences between Ed–/– and WT mice (data not shown). We also observed a similar decrease of Ig⁺ cells in gated splenic IgM⁺ cells in Ed–/– mice (Fig. 2C). And the mean fluorescence intensity of Ig expressing B cells in Ed–/– mice was decreased compared with those of WT (Fig. 2C; 1138 ± 5.0 vs 1268 ± 21.5, n = 3, p < 0.01, Student’s t test). These results indicate that the decreased Ig⁺ cells and altered Ig/ ratio in the spleen of Ed–/– mice must be primarily established during the maturation of B cells in the spleen, and not during the generation of B cells in bone marrow at the level of recombination.

View larger version (38K): [in this window] [in a new window]   FIGURE 2. Flow-cytometric analysis of cell surface Ig expression in spleen and bone marrow. A, Single-cell suspensions from spleen were simultaneously stained with PE-conjugated anti-Ig and FITC-conjugated anti-B220 Abs (upper); or PE-conjugated anti-B220 and FITC-conjugated anti-Ig Abs (lower). Stained cells were analyzed by FACS. Only cells residing in the lymphocyte gate were analyzed. Percentages of cells residing in various windows are shown in the figure subpanels. Data are representative of independent FACS analyses from at least five mice of each genotype. B, Single-cell suspensions from bone marrow were stained and analyzed as described in A. C, Splenic cells were stained with PE-conjugated anti-Ig, FITC-conjugated anti-B220, and biotinylated anti-IgM. The biotinylated anti-IgM was revealed with allophycocyanin-streptavidin. IgM+ cells were analyzed for cell surface expression of Ig. Histograms of Ig fluorescence intensity and cell percentages are displayed for WT and Ed–/– splenic cells. Only cells residing in the lymphocyte gate were analyzed. The asterisks indicate small peaks of IgM+ + cells, which disappear if samples are first depleted in + B cells with biotinylated-anti- Ab and MACS columns before FACS (data not shown).

To further investigate the effect of Ed deletion on the development of B cells, we analyzed the percentages of transitional B cells, follicular mature B cells, and marginal zone B cells in the spleen by FACS. Ed–/– mice exhibited a slight increase in T1 (IgM^highIgD^–lo) and T2 (IgM^highIgD^high) transitional B cells, and a slight decrease in follicular mature (IgM^intIgD^high) B cells relative to the corresponding cell distributions exhibited by WT mice (Fig. 3A). We also found that the percentage of marginal zone B cells was normal in Ed–/– mice (Fig. 3B). Previous studies in our laboratory demonstrated that Ed exhibits a plasmacytoma cell-specific DNase I hypersensitive site (4). To address the question of whether plasma cell development is impaired in Ed–/– mice, we analyzed the percentages of B220^+/–CD138⁺ plasma cells in spleen by FACS, and we found there was no significant difference between WT and Ed–/– mice (0.27 ± 0.13% vs 0.29 ± 0.05%, respectively; data not shown). When cultured with LPS in vitro, splenic B cells proliferate and differentiate into Ig-secreting cells (34). We found that the percentage of B220^+/–CD138⁺ Ig-secreting cells was almost the same between LPS-treated WT and Ed–/– splenic B cells (Fig. 3C; 13 ± 1.5% vs 12 ± 0.6%). Northern blot analysis showed that the level of Ig mRNA expression in these purified Ed–/– B220^+/–CD138⁺ Ab-secreting cells was also normal (data not shown). In summary, these data indicate that the splenic B cell distributions and plasma cell formation are approximately normal in Ed–/– mice.

View larger version (50K): [in this window] [in a new window]   FIGURE 3. Flow-cytometric analysis of B cell development and Ig-secreting cell differentiation in spleen. A, Single-cell suspensions from spleen were simultaneously stained with FITC-conjugated anti-IgD and biotinylated anti-IgM. The biotinylated anti-IgM was revealed with allophycocyanin-streptavidin. Stained cells were analyzed by FACS. Only cells residing in the lymphocyte gate were analyzed. Gates of IgMlowIgDhigh, IgMhighIgDhigh, IgMhighIgDlow are shown with the percentages of cells indicated. Data are representative of independent FACS analyses from at least five mice of each genotype. B, Single-cell suspensions from spleen were simultaneously stained with FITC-conjugated anti-CD21 and allophycocyanin-conjugated anti-CD23 Abs and analyzed by FACS as described in A. Gates of follicular B cells (CD21+CD23+) and marginal zone B cells (CD21+CD23–lo) are shown with the percentages of cells indicated. C, Analysis of Ig-secreting cell differentiation. Splenic cells were stimulated with LPS for 4 days and stained with PE-conjugated anti-B220 and biotinylated anti-CD138. The biotinylated anti-CD138 was revealed with allophycocyanin-streptavidin. Stained cells were analyzed by FACS. Gates of B220+/– CD138+ Ig-secreting cells are shown with the percentages of cells indicated.

Ed is required for normal Ig expression

Because we found that cell surface Ig expression levels were decreased in Ed–/– splenic Ig⁺ B cells (Fig. 2C), we assayed for the steady-state levels of Ig mRNA by Northern blot analysis. RNA samples from splenic Ig⁺ cells were hybridized with C, Cµ, and β-actin probes. Then, Ig RNA levels were normalized to the total amount of β-actin RNA in the corresponding lanes. Ig RNA levels of Ed–/– B cells were decreased compared with those of WT (Fig. 4, A and C; 67 ± 8.2% vs 100 ± 5.6%, n = 5, p < 0.01, Student’s t test). Furthermore, when we normalized Ig RNA levels to those of Igµ RNA, we found a similar decrease in Ed–/– B cells compared with those of WT (Fig. 4A; 51 ± 22.8% vs 100 ± 7.7%, n = 3, p < 0.01, Student’s t test). We also compared Ig RNA levels of Ed–/– and WT B cells after 4 days of LPS stimulation in culture. We found Ed–/– and WT B cells expressed similar levels of Ig RNA after LPS stimulation (Fig. 4, B and D; 105 ± 13% vs 100 ± 8.7%, n = 5, p = 0.51, Student’s t test). To further determine whether Ig RNA levels were decreased in either activated and/or resting B cells, we purified activated and resting B cells from spleen by use of Percoll gradient centrifugation and analyzed the Ig RNA levels by Northern blotting as above. We found Ig RNA levels were decreased 50% in Ed–/– resting B cells compared with those of WT. In contrast, when compared with resting B cells, the reduction of Ig RNA levels in Ed–/– activated B cells was less dramatic (Fig. 4E). We also analyzed sera for Ig chain protein levels by ELISA. The sera Ig chain levels were decreased in Ed–/– mice compared with those of WT (Fig. 5; 15.3 ± 6.4 vs 22.5 ± 6.7 mg/ml, n = 10, p = 0.02, Student’s t test). A corresponding increase in sera Ig chain levels was observed in Ed–/– (Fig. 5; 1.46 ± 0.56 vs 0.91 ± 0.40 mg/ml, n = 10, p = 0.02, Student’s t test). In summary, these data indicate that Ig expression is impaired in splenic B cells lacking the Ed enhancer.

View larger version (44K): [in this window] [in a new window]   FIGURE 4. Northern blot analysis of Ig expression. A, Total RNA from splenic Ig+ cells was blotted and probed first with a C probe, and then sequentially hybridized with β-actin and Cµ probes. B, Total RNA from splenic Ig+ cells cultured for 4 days with 20 µg/ml LPS was blotted and probed as described in A. C, The Northern blot signals of splenic Ig+ cells were quantitated by PhosphorImager analysis. The levels of Ig expression were normalized to those of β-actin (C/β-actin) or Cµ (C/Cµ). The C/β-actin ratios of WT mice were set as 100% expression. The percentages of Ig expression (C (%), y-axis) in Ed–/– mice were calculated as: [(C/β-actin ratio of Ed–/– mice)/(C/β-actin ratio of WT mice)] x 100%. Data are presented as means ± SD. Statistical significance was determined by a paired Student’s t test. D, The Northern blot signals of LPS stimulated splenic Ig+ cells RNA were quantitated by PhosphorImager analysis. The percentages of Ig expression in Ed–/– mice were calculated as described in C. A–D, Data representative of three independent experiments. E, Northern blot analysis of Ig expression in activated and resting B cells. Activated and resting B cells were purified by Percoll gradient centrifugation from pooled WT and Ed–/– splenic cells. Total RNA from the purified cells was blotted and hybridized with C and β-actin probes. The percentages of Ig expression in Ed–/– mice were calculated as described in C.

View larger version (13K): [in this window] [in a new window]   FIGURE 5. Analysis of sera Ig and Ig chain concentrations by ELISA. Sera from 10–16-wk-old WT mice (n = 10) and Ed–/– mice (n = 10) were collected and analyzed by ELISA. The bar represents mean value of samples. Statistical significance was determined by a paired Student’s t test.

Ig expression is impaired in T cell-dependent stimulated Ed–/– splenic B cells

Previous studies have shown that Ig expression is normal in E3' enhancer knockout splenic B cells after stimulation with LPS (26). However, Ig expression was decreased in these cells if activated by BCR or T cell-dependent stimulation, such as anti-IgM and/or anti-CD40 Ab (28). To test whether Ed is required for normal Ig expression in a T cell-dependent simulated immune response, we stimulated splenic B cells with anti-CD40 Ab or anti-CD40 Ab plus IL-4. Northern analyses revealed that Ig mRNA levels were decreased in anti-CD40 activated Ed–/– splenic B cells compared with those of WT (Fig. 6, A and C; 66 ± 4% vs 100 ± 15%, n = 3, p = 0.02, Student’s t test). Similar results were found in anti-CD40 plus IL-4 activated Ed–/– splenic B cells (Fig. 6, B and D; 75 ± 7% vs 100 ± 9%, n = 3, p = 0.02, Student’s t test). Furthermore, when we normalized the Ig RNA levels to those of Igµ, we found a similar decrease in Ed–/– B cells compared with those of WT (Fig. 6, A and B, and data not shown). We also found that the percentages of B220^+/–CD138⁺ Ig-secreting cells were similar between these T cell-dependent stimulated Ed–/– and WT B cells (data not shown), indicating that the stimulation efficiencies were similar between Ed–/– and WT B cells.

View larger version (48K): [in this window] [in a new window]   FIGURE 6. Northern blot analysis of Ig expression in T cell-dependent stimulated splenic B cells. A and B, Total RNA from splenic Ig+ cells cultured for 4 days with anti-CD40 (A) or anti-CD40 plus IL-4 (B) was blotted and hybridized first with a C probe and then sequentially with β-actin and Cµ probes. C, The Northern blot signals of anti-CD40-stimulated splenic Ig+ cells were quantitated by PhosphorImager analysis. The levels of Ig expression were normalized by β-actin (C/β-actin) or Cµ (C/Cµ) expression. The C/β-actin ratios of WT mice were set as 100% expression. The percentages of expression (C (%), y-axis) in Ed–/– mice were calculated as: [(C/β-actin ratio of Ed–/– mice)/(C/β-actin ratio of WT mice)] x 100%. Statistical significance was determined by a paired Student’s t test. D, The Northern blot signals of anti-CD40 plus IL-4-stimulated splenic Ig+ cells were quantitated by PhosphorImager analysis. The percentages of Ig expression in Ed–/– mice were calculated as described in C.

Ig locus rearrangement is normal in Ed–/– splenic and bone marrow B cells

To further investigate the mechanism responsible for decreased splenic Igk⁺ cells in Ed–/– mice, Southern blotting was used to assay for VJ rearrangement levels in purified splenic Ig⁺ and bone marrow B cells. Electrophoretically resolved genomic DNA from purified cells that had been digested with EcoRI-BamHI was transferred and hybridized with a C probe. In agreement with a previous report (35), the level of germline fragments was 29% in Ig⁺ splenic B cells (Fig. 7B; WT), very similar to the levels seen in the corresponding cells from Ed–/– mice (Fig. 7B; 27 ± 3% vs 29 ± 9%, n = 3, p = 0.65, Student’s t test). Related assays on bone marrow B cells also revealed very similar levels of germline fragments from WT and Ed–/– mice that were not statistically different (Fig. 7C; 60 ± 11% vs 51 ± 11%, n = 3, p = 0.33, Student’s t test). To examine the possibility that J region usage and secondary VJ rearrangement levels might be altered in Ed–/– mice, we used a quantitative PCR assay to analyze VJ rearrangement products in purified splenic Ig⁺ and bone marrow B cells. The results revealed that the relative frequencies of J region usage were similar in WT and Ed–/– samples (Fig. 7E). We conclude that Ig gene rearrangement is unaffected in Ed–/– mice.

SHM is decreased in the J-C intronic region of Ed–/– GC B cells

The E box motif has been reported to enhance SHM (36, 37). In addition, the Ig transcription efficiency has also been correlated with levels of SHM (6). Because Ed contains two E box sites and we also observed reduced Ig expression in Ed–/– B cells and T cell-dependent activated B cells, we investigated the possibility that SHM might be decreased in Ed–/– GC B cells. We purified B220⁺PNA^high GC B cells from Peyer’s patches of Ed–/– and WT mice by flow cytometry. Genomic DNA was isolated from these GC B cells and VJ rearrangements were amplified using high fidelity PCR. VJ5 rearrangement products were gel purified, cloned, and sequenced. We found that the mutation frequency of a 500 bp intronic region downstream of J5 was 11.1 x 10^–3 mutations per base in WT GC B cells. In contrast, only 4.3 x 10^–3 mutations per base were detected in Ed–/– GC B cells (Fig. 8; p < 0.01). The overall mutation frequency in Ed–/– GC B cells was 2.5-fold reduced compared with that of WT GC B cells. Among clones bearing mutations, the mutation frequency was 17.1 x 10^–3 mutations per base in WT GC B cells, and only 6.6 x 10^–3 mutations per base in Ed–/– GC B cells (Fig. 8). The mutation frequency was also 2.5-fold reduced in Ed–/– GC B cells. Control experiments revealed that error frequency of the high fidelity PCR was only 0.13 mutations per kb, and the mutation frequency of WT B220⁺PNA^low B cells was <1 mutation per kb (data not shown). Furthermore, we found that the percentage of clones with no mutations was 43% in Ed–/– GC B cells, but only 25% in WT GC B cells. In summary, these data indicate that Ig SHM is decreased in Ed–/– GC B cells from Peyer’s patches.

View larger version (30K): [in this window] [in a new window]   FIGURE 8. Analysis of Ig SHM in GC B cells. B220+PNAhigh GC B cells were sorted from 4–6-mo-old WT (left) and Ed–/– (right) mice, and SHM in a 500 bp J-C region that is immediately 3' of V-J5 recombination products was analyzed. Each pie slice represents the proportions of sequences having the indicated numbers of mutations. The numbers of plasmid clones that were sequenced are shown in pie centers. The mutation frequencies from the total or mutated clones are shown at the bottom.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

We have previously noted that Ed forms a DNase I hypersensitive site in B cell chromatin in plasmacytoma but not pre-B cell lines (4), an observation also consistent with a functional role for Ed later in B cell maturation. These findings prompted us to measure the percentages of plasma cells in spleen and the production of Ig-secreting cells upon stimulating splenic B cells with LPS. However, we found that there was no difference in plasma cell number between WT and Ed–/– cells (Fig. 3C). The deficit of Ig chains in Ed–/– mice sera can’t be explained only by decreased Ig⁺ cells in the periphery, because MEi–/– and E3'–/– knockout mice have more dramatic decreases in Ig⁺ cells in the periphery than do Ed–/– mice, but Ig chains in sera of MEi–/– and E3'–/– mice are at concentrations similar to those of WT (25, 26, 27). In conclusion, we still cannot rule out the possibility that Ed plays roles in Ab secretion in vivo. T cell-dependent and -independent immunization experiments are required to further elucidate the function of Ed in immune responses and/or Ab secretion.

With respect to transcription levels of rearranged genes in unstimulated B cells, previous studies have shown the MEi–/– mice have no defect in rearranged Ig gene expression (25, 28). By contrast, lower levels of rearranged gene transcripts exist in splenic B cells of E3'–/– mice (26, 27), or upon their BCR or T cell-dependent stimulation (28), but not after LPS stimulation (26, 28). Ed–/– mice Ig gene transcription levels closely fit the same patterns as those exhibited by E3'–/– mice, with moderately reduced cell surface Ig chains and Ig gene mRNA levels in splenic ⁺ cells, serious deficits in resting splenic B cells transcript levels (Figs. 2C and 4, C and E), and in responsiveness to transcriptional activation by a T cell-dependent pathway (Fig. 6, C and D), but not by the LPS activation pathway (Fig. 4D). We found that in vivo activated Ed–/– splenic B cells only exhibited slightly reduced Ig gene transcript levels, which can be explained by the fact that part of splenic B cells, maginal zone cells, can be activated by T cell-independent Ags (38). Our previous studies have shown that the Ed enhancer synergistically activates transcription in combination with other enhancers, like Ei (4), and that Ed forms complexes with Ei and E3' with the looping out of the intervening DNA in stimulated splenic B cells as well as plasmacytoma cell lines (8). Taken together with the results of the present investigation, it seems clear that E3' and Ed in particular must work together to optimally set up active chromatin loop domains and to drive high level Ig gene expression during resting and activated B cell states.

We also studied Igµ transcript levels relative to those of Ig in WT and Ed–/– mice in various B cell populations. Surprisingly, in cell populations where Ig transcript levels were compromised in Ed–/– mice, no corresponding down-regulation was observed for Igµ transcript levels (Figs. 4 and 6). This raises the possibilities that overabundant Igµ chains may be cytoplasmic, or associated with up-regulated surrogate light chains on the cell surface, or that Igµ protein levels are stoichiometrically adjusted to be equimolar with Ig chains by regulation of their translational efficiency.

Studies on cis-acting elements that are involved in specifying SHM in mice were first performed on rearranged Ig transgenes that lacked Ed (39, 40). These studies found that both MEi and E3' were required for SHM and that the level of SHM correlated with the level of expression. Another more recent transgenic study, again with a construct lacking Ed, was able to disconnect the correlation between expression level and SHM, because upon mutation of E2A binding sites in the transgene, no affect on transcription was seen, but SHM went down by 4-fold (36). This result points to a role for certain transcription factors, and not simply to the levels of RNA polymerase II traversal, in the targeting of the mutator apparatus. The first experiments on SHM in Ig enhancer knockouts in the native locus were performed in the Alt laboratory. By contrast to the transgenic studies and unexpectedly, E3'–/– mice were found to exhibit no defects in the production of high-affinity Ab when immunized against 2-phenyl-5-oxazolone and these Ab possessed the normal levels of SHM (29). Recognizing that Ag-driven affinity maturation may have selected for survival of this B cell subset, Inlay et al. (28) recently reinvestigated the role of E3' in the process of SHM under physiological conditions without continuous challenge with a single Ag and did find that E3' was necessary to achieve WT levels of SHM in the 5' end of the Ig gene J-C intron. They further showed that MEi in the native locus played no role in determining the level of SHM. Taking a similar experimental approach to that of Inlay et al. (28), we have found that Ed–/– mice show about a 2.5-fold decrease in the level of SHM relative to those of WT mice (Fig. 8). This fold decline is in the same range as that seen in E3'–/– mice (28). We conclude that both E3' and Ed contribute to SHM. Notably, both these enhancers contribute to Ig gene transcription levels and each also have E2A binding sites, making it difficult to judge which of these defects or both might be responsible for a decline in SHM.

In conclusion, our results together with other published studies on endogenous Ig locus enhancer knockout mice permit the conclusions that MEi and E3', but not Ed, are required for maximal gene rearrangement (25, 26, 27), that E3' and Ed, but not MEi, are required for maximal Ig rearranged gene transcription (25, 26, 27, 28), and that E3' and Ed, but not MEi, are required for maximal SHM in rearranged Ig genes (28). Because E3' and Ed might have redundant functions to drive Ig rearranged gene transcription and SHM, one might predict from these combined results that E3' and Ed double knockout mice might be severely impaired for high level expression of rearranged Ig genes, and totally compromised with respect to the process of SHM.

	Disclosures

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
The authors have no financial conflict of interest.

	Footnotes

 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ This work was supported by Grants GM29935 and AI067906 from the National Institutes of Health and Grant I-0823 from the Robert A. Welch Foundation (to W.T.G.).

² Address correspondence and reprint requests to Dr. William T. Garrard, Department of Molecular Biology, University of Texas Southwestern Medical Center, 5323 Harry Hines Boulevard, Dallas, TX 75390-9148. E-mail address: william.garrard{at}utsouthwestern.edu

³ Abbreviations used in this paper: RSS, recombination signal sequence; GC, germinal center; SHM, somatic hypermutation; MAR, matrix association region; MEi, MAR/intronic enhancer; WT, wild type; ES, embryonic stem.

Received for publication January 18, 2008. Accepted for publication March 19, 2008.

	References

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 

1. Yancopoulos, G. D., F. W. Alt. 1985. Developmental controlled and tissue-specific expression of unrearranged VH gene segments. Cell 40: 271-281. [Medline]
2. Gellert, M.. 2002. Recombination: RAG proteins, repair factors, and regulation. Ann. Rev. Biochem. 71: 101-132. [Medline]
3. Curry, J. D., J. K. Geier, M. S. Schlissel. 2005. Single-strand recombination signal sequence nicks in vivo: evidence for a capture model of synapsis. Nat. Immunol. 6: 1272-1279. [Medline]
4. Liu, Z. M., J. B. George-Raizen, S. Li, K. C. Meyers, M. Y. Chang, W. T. Garrard. 2002. Chromatin structural analyses of the mouse Ig gene locus reveal new hypersensitive sites specifying a transcriptional silencer and enhancer. J. Biol. Chem. 277: 32640-32649. [Abstract/Free Full Text]
5. Schlissel, M. S.. 2004. Regulation of activation and recombination of the murine Ig locus. Immunol. Rev. 200: 215-223. [Medline]
6. Odegard, V. H., D. G. Schatz. 2006. Targeting of somatic hypermutation. Nat. Rev. Immunol. 6: 573-583. [Medline]
7. Mostoslavsky, R., N. Singh, A. Kirillov, R. Pelanda, H. Cedar, A. Chess, Y. Bergman. 1998. chain monoallelic demethylation and the establishment of allelic exclusion. Genes Dev. 12: 1801-1811. [Abstract/Free Full Text]
8. Liu, Z., W. T. Garrard. 2005. Long range interactions between three transcriptional enhancers, active V gene promoters and a 3' boundary sequence spanning 46 kb. Mol. Cell. Biol. 25: 3220-3231. [Abstract/Free Full Text]
9. Fuxa, M., J. A. Skok. 2007. Transcriptional regulation in early B cell development. Curr. Opin. Immunol. 19: 1-8. [Medline]
10. Brekke, K. M., W. T. Garrard. 2004. Assembly and analysis of the mouse immunoglobulin gene sequence. Immunogenetics 56: 490-505. [Medline]
11. Durdik, J. M., M. W. Moore, E. Selsing. 1984. Novel light chain rearrangements in mouse light chain producing B lymphocytes. Nature 307: 749-750. [Medline]
12. Liu, Z., P. Widlak, Y. Zou, F. Xiao, M. Oh, S. Li, M. Y. Chang, J. W. Shay, W. T. Garrard. 2006. A recombination silencer that specifies heterochromatin positioning and Ikaros association in the immunoglobulin locus. Immunity 24: 405-415. [Medline]
13. Van Ness, B., M. Weigert, C. Coleclough, E. L. Mather, D. E. Kelle, R. P. Perry. 1981. Transcription of the unrearranged mouse C locus: sequence of the initiation region and comparison of activity with a rearranged V - C gene. Cell 27: 593-602. [Medline]
14. Martin, D., B. Van Ness. 1990. Initiation and processing of two immunoglobulin germline transcripts in mouse B cell. Mol. Cell. Biol. 10: 1950-1958. [Abstract/Free Full Text]
15. Ferradini, L., H. Gu, A. D. Smet, K. Rajewsky, C.-A. Reynaud, J.-C. Weill. 1996. Rearrangement-enhancing element upstream of the mouse immunoglobulin chain J cluster. Science 271: 1416-1420. [Abstract]
16. Max, E. E., J. V. Maizel, Jr, P. Leder. 1981. The nucleotide sequence of a 5.5 kilobase DNA segment containing the mouse immunoglobulin J and C region genes. J. Biol. Chem. 256: 5116-5120. [Abstract/Free Full Text]
17. Cockerill, P. N., W. T. Garrard. 1986. Chromosomal loop anchorage of the immunoglobulin gene occurs next to the enhancer in a region containing topoisomerase II sites. Cell 44: 273-282. [Medline]
18. Queen, C., D. Baltimore. 1983. Immunoglobulin gene transcription is activated by downstream sequence elements. Cell 33: 741-748. [Medline]
19. Xu, M., M. B. Barnard, S. M. Rose, P. N. Cockerill, S.-Y. Huang, W. T. Garrard. 1986. Transcription termination and chromatin structure of the active immunoglobulin gene locus. J. Biol. Chem. 261: 3838-3845. [Abstract/Free Full Text]
20. Meyer, K. B., M. S. Neuberger. 1989. The immunoglobulin locus contains a second, stronger B cell specific enhancer which is located downstream of the constant region. EMBO J. 8: 1959-1964. [Medline]
21. Cocea, L., A. DeSmet, M. Saghatchian, S. Fillatreau, L. Ferradini, S. Schurmans, J.-C. Weill, C.-A. Reynaud. 1999. A targeted deletion of a region upstream from the J cluster impairs chain rearrangement in cis in mice and in the 103/bcl2 cell line. J. Exp. Med. 189: 1443-1449. [Abstract/Free Full Text]
22. Liu, X., B. Van Ness. 1999. Gene targeting of the KI-KII sequence elements in a model pre-B cell line: effects on germline transcription and rearrangement of the locus. Mol. Immunol. 36: 464-469.
23. Yi, M., P. Wu, K. W. Trevorrow, L. Claflin, W. T. Garrard. 1999. Evidence that the Ig gene MAR regulates the probability of premature V-J joining and somatic hypermutation. J. Immunol. 162: 6029-6039. [Abstract/Free Full Text]
24. Hale, M. A., W. T. Garrard. 1998. A targeted immunoglobulin gene containing a deletion of the nuclear matrix association region exhibits spontaneous hyper- recombination in pre-B cells. Mol. Immunol. 35: 609-620. [Medline]
25. Xu, Y., L. Davidson, F. W. Alt, D. Baltimore. 1996. Deletion of the Ig light chain intronic enhancer/matrix attachment region impairs but does not abolish V-J rearrangement. Immunity 4: 377-385. [Medline]
26. Gorman, J. R., N. Van der Stoep, R. Monroe, M. Cogne, L. Davidson, F. W. Alt. 1996. The Ig 3' enhancer influences the ratio of Ig versus Ig B lymphocytes. Immunity 5: 241-252. [Medline]
27. Inlay, M., F. W. Alt, D. Baltimore, Y. Xu. 2002. Essential roles of the light chain intronic enhancer and 3' enhancer in rearrangement and demethylation. Nat. Immunol. 3: 463-468. [Medline]
28. Inlay, M. A., H. H. Gao, V. H. Odegard, T. Lin, D. G. Schatz, Y. Xu. 2006. Roles of the Ig light chain intronic and 3' enhancers in Ig somatic hypermutation. J. Immunol. 177: 1146-1151. [Abstract/Free Full Text]
29. Van der Stoep, N., J. R. Gorman, F. W. Alt. 1998. Reevaluation of 3' E function in stage- and lineage-specific rearrangement and somatic hypermutation. Immunity 8: 743-750. [Medline]
30. Lee, G., I. Saito. 1998. Role of nucleotide sequences of loxP spacer region in Cre-mediated recombination. Gene 216: 55-65. [Medline]
31. Tallquist, M. D., P. Soriano. 2000. Epiblast-restricted Cre expression in MORE mice: a tool to distinguish embryonic vs. extra-embryonic gene function. Genesis 26: 113-115. [Medline]
32. Bondada, S., D. A. Robertson. 2003. Purification of resting B cells by Percoll gradient centrifugation. Current Protocols in Immunology 3.8.15-3.8.17. John Wiley and Sons, Inc., New York.
33. Schlissel, M. S., D. Baltimore. 1989. Activation of immunoglobulin gene rearrangement correlates with induction of germline gene-transcription. Cell 58: 1001-1007. [Medline]
34. Shapiro-Shelef, M., K. I. Lin, L. J. McHeyzer-Williams, J. Liao, M. G. McHeyzer-Williams, K. Calame. 2003. Blimp-1 is required for the formation of immunoglobulin secreting plasma cells and pre-plasma memory B cells. Immunity 19: 607-620. [Medline]
35. Zou, Y. R., S. Takeda, K. Rajewsky. 1993. Gene targeting in the Ig kappa locus: efficient generation of chain-expressing B cells, independent of gene rearrangements in Ig . EMBO J. 12: 811-820. [Medline]
36. Michael, N., H. M. Shen, S. Longerich, N. Kim, A. Longacre, U. Storb. 2003. The E box motif CAGGTG enhances somatic hypermutation without enhancing transcription. Immunity 19: 235-242. [Medline]
37. Schoetz, U., M. Cervelli, Y. D. Wang, P. Fiedler, J. M. Buerstedde. 2006. E2A expression stimulates Ig hypermutation. J. Immunol. 177: 395-400. [Abstract/Free Full Text]
38. Fagarasan, S., T. Honjo. 2000. T-independent immune response: new aspects of B cell biology. Science 290: 89-92. [Abstract/Free Full Text]
39. Sharpe, M. J., M. Neuberger, R. Pannell, M. A. Surani, C. Milstein. 1990. Lack of somatic mutation in a light chain transgene. Eur. J. Immunol. 20: 1379-1385. [Medline]
40. Betz, A. G., C. Milstein, A. Gonzalez-Fernandez, R. Pannell, T. Larson, M. Neuberger. 1994. Elements regulating somatic mutation of an immunoglobulin gene: critical role for the intron enhancer/matrix attachment region. Cell 77: 239-248. [Medline]

Related articles in The JI:

IN THIS ISSUE

The JI 2008 180: 6435-6436. [Full Text]  

This article has been cited by other articles:

				Z. Liu, Z. Ma, L. S. Terada, and W. T. Garrard Divergent Roles of RelA and c-Rel in Establishing Chromosomal Loops upon Activation of the Ig{kappa} Gene J. Immunol., September 15, 2009; 183(6): 3819 - 3830. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Related articles in The JI Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Xiang, Y. Articles by Garrard, W. T. Search for Related Content PubMed PubMed Citation Articles by Xiang, Y. Articles by Garrard, W. T.