HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Penitente, R. Articles by Ria, F. Search for Related Content PubMed PubMed Citation Articles by Penitente, R. Articles by Ria, F.

Administration of PLP_139–151 Primes T Cells Distinct from Those Spontaneously Responsive In Vitro to This Antigen¹

Romina Penitente^*, Chiara Nicolò^*, Peter Van den Elzen, Gabriele Di Sante^*, Chiara Agrati, Francesca Aloisi, Eli E. Sercarz^¶ and Francesco Ria^2,*

^* Institute of General Pathology, Catholic University, Rome; National Institute for Infectious Diseases "Lazzaro Spallanzani" Istituto Di Ricovero e Cura a Carattere Scientifico, Rome; Department of Cell Biology and Neuroscience, Istituto Superiore di Sanità, Rome, Italy; Department of Pathology and Laboratory Medicine, University of British Columbia, British Columbia Children and Women’s Hospital, Vancouver, British Columbia, Canada; and ^¶ Torrey Pines Institute for Molecular Studies, San Diego, CA 92121

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
We examined the TCR repertoire used by naive SJL mice in their in vitro spontaneous response to proteolipid protein (PLP) 139–151 by Vβ-Jβ spectratyping and compared it to that used after immunization with the peptide. T cells from immunized mice use the public rearrangement Vβ10-Jβ1.1, but naive mice do not; in contrast, TCR CDR3-β rearrangements of Vβ18-Jβ1.2 and Vβ19-Jβ1.2 consistently are associated with the spontaneous response. T cells involved in spontaneous and induced responses can each recognize PLP_139–151 presented in vivo, but its s.c. administration has different consequences for the two repertoires. Four days after immunization, T cells associated with spontaneous responsiveness appear in the draining lymph nodes but disappear by day 10 and never appear elsewhere. Simultaneously, Vβ10-Jβ1.1 T cells are likewise activated in the lymph nodes by day 4 and spread to the spleen by day 10. Eight- to 10-wk-old naive mice use a narrower repertoire of TCRs than do immunized age-matched mice. Induced Vβ10-Jβ1.1 T cells home to the CNS during experimental autoimmune encephalomyelitis, whereas we failed to detect Vβ18-Jβ1.2 and Vβ19-Jβ1.2 TCR rearrangements in the CNS. Thus, we observe that administration of PLP_139–151 primes a T cell repertoire distinct from the one responsible for spontaneous responsiveness. This "immunized" repertoire substitutes for the naive one and becomes dominant at the time of disease onset.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Relapsing experimental autoimmune encephalomyelitis (R-EAE)³ that arises upon immunization of SJL mice with proteolipid protein (PLP)-derived peptide(s) is a particularly attractive model for human self-reactive diseases. In this model, an "environment dependent event" (represented by challenge with a peptide containing a single encephalitogenic epitope in an appropriate adjuvant) allows the development of a self-sustaining autoreactive immune response through the use of several sequential self-reactive T cell repertoires (1, 2).

It was observed several years ago, and repeatedly confirmed, that self-specific T cells can evade tolerance induction (3, 4, 5, 6, 7). Their presence in the periphery provides the cellular basis for autoimmune pathology (8, 9, 10). Although the availability of these cells represents a common substrate for all self-reactive responses, naive SJL mice display an unusually high frequency of PLP_139–151 (p139)-specific T cells (11, 12). Such a high frequency is achieved through two distinct mechanisms. First, central tolerance fails to deplete p139-specific T cells from the peripheral repertoire, due to alternative splicing of PLP-encoding mRNA, which results in the absence of the p139 region from the thymic medullary epithelium (5, 9). The extension of central tolerance to this epitope prevented the induction of EAE. Escaped T cells specific for the p139 epitope expand spontaneously in vivo in naive mice, reaching a concentration of up to 1/20,000 p139-specific precursors. This expansion appears driven by self-Ags, because it also occurs in mice housed under specific pathogen-free conditions; these cells are CD44^high, indicating that they have acquired a memory phenotype (9). Immunization of adult mice with p139 induces a further expansion of the T cells specific for this peptide, in our experience to a frequency of 1/1000 lymph node cells (LNC) (13), which also become encephalitogenic, promoting EAE. It has been proposed that the presence of a large T cell repertoire in adult naive SJL mice provides the basis for the dominance of response to this epitope within whole myelin (14, 15), suggesting that the same repertoire spontaneously expanded in vivo is further activated by Ag challenge, although direct evidence is lacking.

Mirroring this observation in the experimental model, a high frequency of T cells specific for myelin basic protein (MBP) 85–99 can also be observed in healthy subjects sharing the DR2 element (16, 17, 18). The qualitative similarity of MBP_85–99-specific responses between normal DR2⁺ subjects and multiple sclerosis patients has prompted several groups to study the differences in the responses to lesser epitopes as a discriminator between health and disease (19, 20). Nevertheless, the quest for yes/no differences in epitope recognition appears to be elusive at the moment. Thus, it is not clear what transforms "non-pathogenic" self-recognition into a pathogenic immune response.

In addition to its implication for the pathogenesis of autoimmune diseases, the presence of a response to p139 carried by activated T cells in otherwise naive mice offers a unique model of the long-term effect of the interaction of an Ag with a preexisting polyclonal and spontaneous T cell-mediated immune response. Memory T cells can be divided into a pool of effector memory cells, fully differentiated into type 1 or type 2 cells, that represent a front-line defense in the periphery, and a pool of central memory cells, which are supposed to be recruited to lymph nodes where the Ag is presented and where they expand and differentiate (21). These central memory T cells represent the reservoir of the immune response that prevents the depletion of the memory pool at each encounter with the Ag (22). The precise surface asset that distinguishes the two pools is still an open issue, as is the question of their repertoire usage (23). Competition between the larger number of memory T cells compared with naive T cells for access to APC (24, 25, 26) should favor the clonal domination of the memory repertoire to Ags with respect to that of the primary response.

Thus, the study of the clonal composition of the challenge response to p139 may offer information to address the evolution of secondary responses within a natural immune system, avoiding the theoretical problems that may weaken the relevance of data obtained by cloning or by experiments involving the transfer of large numbers of Ag-specific cells.

Using Vβ-Jβ spectratyping (27), we were able to show that the T cell repertoire that sustains the p139-specific response in immunized SJL mice is characterized by a public TCR-β-chain (Vβ10-Jβ1.1) found in a large majority of SJL mice immunized with p139 (13), despite a fairly broad usage of different TCRs. Approximately 5% of the total p139-specific Th1 cells carry this CDR-3 β rearrangement. It would be interesting to establish whether the high frequency of usage of this public rearrangement is due to the fact that it belongs to the same pool of cells that was expanded before immunization.

In the present report we extend the immunoscope approach to study the response of naive mice to p139. We show that the public Vβ10-Jβ1.1 rearrangement contributes poorly to the p139-specific proliferation of spleen cells of naive mice, while its detection by Vβ-Jβ spectratyping in the Ag-induced repertoire indicates that its activation is dependent on immunization. We also identify shared (semiprivate) CDR3-β regions associated with the in vitro response specific for p139 of naive mice. By comparing the usage of rearrangements marking spontaneous and induced repertoires, we show that immunization with p139 resulted in a major shift of T cell usage from the spontaneous to the induced repertoire. T cells of similar avidity for p139/MHC complexes belonging to each repertoire recognize an epitope derived from p139 presented by dendritic cells (DC) loaded in vivo. BV18/19 T cells, usually found in the spontaneous repertoire, are found in the lymph node (LN) at day 4 after immunization, as are the BV10 T cells. However, the latter dominate in the LN and spleen by 10 days, which precedes disease onset. Although T cells belonging to the induced BV10 repertoire home to the CNS during clinical presentation of EAE, we consistently failed to detect TCR rearrangements belonging to the spontaneous BV18/BV19 repertoire in the CNS during EAE.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Mice and Ags

Female SJL mice (2 mo old; Charles River Laboratories Italia) were used in the experiments reported. p139 (Ser¹⁴⁰ (14) NH₂-HSLGKWLGHPDKF-COOH) and p178 (NH₂-NTWTTCQSIAFPSK-COOH) were purchased from Primm and were >95% pure, as determined by HPLC and mass spectroscopy.

Immunization of mice

Mice were immunized subcutaneously with 50–100 µg/mouse of p139 or p178 in PBS, emulsified 1/1 with CFA (which is IFA containing 1 mg/ml killed and heat-dried Mycobacterium tuberculosis H37RA, whereas "enriched CFA" is IFA containing 4 mg/ml killed and heat-dried Mycobacterium Tuberculosis H37RA) (Sigma-Aldrich).

EAE induction and extraction of infiltrating cells from CNS

Mice were immunized subcutaneously in the back at two sites with 75 µg/mouse of p139 or 100 µg/mouse of p178 emulsified 1/1 with enriched CFA (100 µl/mouse). Mice immunized with p178 also received pertussis toxin twice (List Biological Laboratories) (0.4 µg/400 µl/mouse) i.p. on days 0 and 3. Mice were scored for clinical signs of disease according to the following scale: 0, no clinical score; 1, loss of tail tonicity; 2, weak hindleg paresis; 3, hindleg paresis; 4, complete paraplegia; 5, death. Intermediate values were given for incomplete symptoms.

CNS was collected from mice and reduced to a pulp by crushing. A Percoll gradient was performed and mononuclear cells were extracted at the 30–70% interface. Collected cells were washed twice, mixed with 10^{6 –}β^– BW cells (as previously described for analysis of low numbers of T cells (13)) and resuspended in RLT buffer of the RNeasy Mini Kit (Qiagen) for RNA extraction. For visualization of inflammatory infiltrates, CNS tissue collection and immunostaining for CD4 on snap frozen tissue were performed as described (28); CNS tissue was obtained from a mouse challenged in parallel with p139, at onset of EAE (disease score 3).

Ex vivo APC population enrichment

Four 8-wk-old SJL female mice were immunized with p139 in IFA s.c. Four days later, DC populations were enriched from draining lymph nodes following the protocol previously described (29). Briefly, LNC depleted of T cells were separated into low- and high-buoyant density cells by centrifugation over a discontinuous Percoll (Phamacia Biotech) gradient containing a 55% layer. Low-buoyant cells were separated by MiniMACS separation columns (Miltenyi Biotec) using B220-specific microbeads. The negatively separated fraction was enriched in N418⁺ DC (29). The APC population enrichment was checked by analysis on a FACScan flow cytometer (BD Biosciences) equipped with Lysis II software. B220 negatively sorted cells were between 60 and 65% N418⁺ cells.

TCR repertoire analysis

Repertoire analysis was performed using a modification of a described protocol (30). LNC/well (5 x 10⁶) or spleen-derived cells/well (1 x 10⁷) were cultured in the presence or absence of 10 µg/ml p139 or p178 for 3 days in RPMI 1640 medium (Sigma-Aldrich) supplemented with 2 mM L-glutamine, 50 µM 2-ME, 50 µg/ml gentamicin (Sigma-Aldrich), and 10% FCS (Invitrogen). Three days later, cells were collected, washed in PBS, and resuspended in RLT buffer. Total RNA was isolated from cell suspensions using a RNeasy Mini kit according to the manufacturer’s instructions. cDNA was synthesized using an oligo(dT) primer (dT15) (Invitrogen). For complete "immunoscope" analysis, cDNA was subjected to PCR amplification using a common constant Cβ primer (CACTGATGTTCTGTGTGACA) in combination with Vβ-specific primers (for a detailed list, see Ref. 31). Using 2 µl of this product as a template, runoff reactions were performed with a single internal fluorescent primer for each J-β tested. These products were then denatured in formamide and analyzed on an Applied Biosystems 3100 Prism using GeneScan 2.0 software. Results are also reported as RSI (relative stimulation index = normalized peak area obtained from cells stimulated with Ag/normalized peak area of nonstimulated cells). T cells carrying a TCR rearrangement are considered expanded in a peptide-driven manner when the RSI is 2.

Lineage markers and CD62L detection

Four days after immunization of SJL mice with p139, cells from draining lymph nodes were obtained. To establish the expression of CD4 and CD8 on T cells carrying the shared TCR rearrangements, 5 x 10⁶ LNC were cultured in the presence of p139 as described above. Three days later, cells were collected and separated in CD4⁺ or CD8⁺ cells by immunoaffinity using magnetic MACS beads coated with the respective Abs (Miltenyi Biotec). Immunoscope analysis of positively and negatively sorted fractions was performed for BV10, BV18, and BV19 rearrangements, as described above.

To examine the expression of the CD62L activation marker on T cells carrying the shared TCR rearrangements, a total of 8 SJL mice in two independent experiments were immunized s.c. with P139 in CFA. Four days later, cells from draining lymph nodes were obtained and pooled. CD62L⁺ and CD62L^– cells were enriched by labeling with an anti-CD62L biotin-conjugated mAb (BD Biosciences) followed by selection with streptavidin-conjugated MACS beads. Positively and negatively selected cells (2.5 x 10⁶) were cocultured in vitro with 10⁶ B220⁺ cells selected from the spleens of naive SJL mice, in the presence of 10 µg/ml p139 for 3 days. Immunoscope analysis for BV10⁺, BV18⁺, and BV19⁺ T cells in each sample was performed as described above.

Staining and enrichment of IFN--, IL-4-, and IL-10-secreting T cells

p139-specific T cells secreting IFN-, IL-4, or IL-10 were stained and enriched from lymph nodes of SJL mice (immunized as described above) using a MACS secretion kit (Miltenyi Biotec) according to the manufacturer’s instruction, and following the protocols for enrichment of low-frequency-secreting cells, as described previously (13). Briefly, 1–3 x 10⁷ cells obtained from draining lymph nodes were stimulated in the absence (background) or in the presence of 50 µg/ml PLP_139–151, in a 6-well plate at a concentration of 0.5 x 10⁷ cells/ml. Three hours later, cells were harvested and submitted to the staining procedure for each cytokine. Positively selected cells were collected and prepared for mRNA isolation. To prevent uncontrolled loss of mRNA due to scarcity of cells in the positively selected fraction (usually 10⁴ total cells were recovered in the cytokine-positive fraction), 10^{6 –}β^– BW cells were added to the positively selected cells before proceeding with mRNA isolation for the TCR repertoire analysis.

Sorting of CD4⁺ T cells proliferating in response to p139

Cells from LN or spleen obtained from mice that had been immunized with p139 or p178 or from naive mice (as described above) were stained with CFSE using the CellTrace CFSE Cell Proliferation Kit (Invitrogen), following the protocol provided by the manufacturer. Labeled cells were then cultured in vitro in the absence or presence of p139 as described above. Three days later, cells were harvested and stained with PE-conjugated anti-CD4 mAb (BD Biosciences). Cells that were CFSE^low and CD4⁺ were sorted using a Vantage SE cell sorter equipped with CellQuest software (BD Biosciences) from a total of 5 x 10⁶ LNC from mice immunized with p139, 10⁷ spleen cells from mice immunized with p139, or 2 x 10⁷ spleen cells from mice immunized with p178 after culture of each cell population in the presence of p139 (see Fig. 3). 10^{6 –}β^– BW cells were added to the sorted cells before proceeding with mRNA isolation for TCR repertoire analysis.

CDR3 sequencing

cDNAs were obtained from Ag-stimulated LNC or from immunoaffinity-selected cells as described above. Two microliters of each sample were submitted to a first PCR using the above-mentioned Vβ-specific forward primers and the common Cβ-specific reverse primer. A second, nested PCR was then performed using 2 µl of the product of the former reaction as template, the same Vβ-specific primer, and Jβ1.1 specific reverse primers. PCR fragments were then cloned by using the TOPO TA Cloning kit (Invitrogen) according to the manufacturer’s instructions, and plasmids were purified by QIAprep Miniprep columns (Qiagen) and checked for the presence of the expected inserts by PCR amplification using Vβ-Jβ paired primers. Inserts were sequenced by M-Medical using an M13 forward primer. DNA sequences were translated into protein sequences through the ExPASy Proteomics Server (http://au.expasy.org/).

	Results

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Spontaneous response to p139 is carried by a TCR repertoire smaller than and distinct from the repertoire induced by immunization

We had previously shown that immunization of SJL mice with p139 results in a number of T cells responding to the peptide approximately equal to 1/1000 LNC (13). This would represent a 20-fold expansion of the specific repertoire with respect to the already expanded spontaneous repertoire (9). We asked whether this increase in the number of p139-specific T cells was achieved by means of proliferation of a T cell repertoire similar to that involved in spontaneous responsiveness, or through broadening of its clonal composition, or both.

We performed a complete immunoscope analysis of the spontaneous repertoire, following the method previously described (13), using mRNA that was prepared from the spleen cells of 8–10-wk-old naive SJL mice, stimulated in vitro with p139. Using this technique, each CDR3-β profile can be depicted as a function of the CDR3 length. Each peak represents a 3 base (b) difference in the product of recombination corresponding to one amino acid residue. After in vitro coculture with peptide Ag, Ag-driven perturbations of this distribution can be observed. As a cut-off value for Ag dependency, a RSI 2 was considered significant for a peptide-associated CDR3 expansion, according to the protocol used for the analysis of the repertoire induced by immunization with the same peptide (13, 31).

As is shown in Fig. 1A, the "spontaneous" p139-specific repertoire makes use of 10 Vβ-Jβ rearrangements. Because we reported that the induced repertoire contains 30 TCR rearrangements (13), the clonal composition of the repertoire responding spontaneously to the peptide appears to be smaller than the one involved in the induced response.

View larger version (22K): [in this window] [in a new window]   FIGURE 1. The spontaneous TCR-β repertoire specific for p139 is smaller than the induced repertoire and uses distinct Vβ-Jβ shared rearrangements. A, Complete CDR3-β immunoscope analysis of the spontaneous response to p139. Immunoscope analysis was performed on cDNA obtained from spleen cells of one representative naive SJL mouse stimulated in vitro with 10 µg/ml p139. , Vβ-Jβ rearrangements showing p139-specific expansion. B, Vβ-Jβ spectra obtained from spleen cells of 4 naive SJL mice with or without stimulation with p139. PCR was performed with primers specific for BV10 (column 1), BV18 (column 2), and BV19 (column 3) and a common Cβ primer as described in Materials and Methods. Runoff reactions were performed with FAM-labeled primers specific for Jβ1.1 (column 1) or Jβ1.2 (columns 2 and 3). The x-axis reports the base length of the products and the y-axis indicates the relative fluorescence. Red spectra are obtained from nonstimulated (control) samples and black lines show the spectra obtained from the same samples following Ag stimulation. Shaded peaks indicate Ag-driven expansions, and dashed lines indicate the peaks corresponding to a length of 97 (Vβ10-Jβ1.1), 132 (Vβ18-Jβ1.2), and 121 b (Vβ19-Jβ1.2).

In the sample reported in Fig. 1A, seven out of nine unique CDR3s from sample are adjacent to Vβ18 and Vβ19 genes, while showing little apparent bias in Jβ usage. When we compared the TCR usage of the same four naive SJL mice previously tested for usage of the public rearrangement, we found that two of them use a TCR-β rearrangement of the same length (132 b) involving the recombination of Vβ18 and Jβ1.2 (Fig. 1B, column 2). Additionally, 3 mice use rearrangements of different lengths (121, 124, and 127 b) of Vβ19 and Jβ1.2 (Fig. 1B, column 3). These rearrangements together appear to identify a shared portion of the p139-specific T cell repertoire that proliferates spontaneously in naive mice and can be assessed by in vitro stimulation with the peptide.

Summing up these observations, the data show that the diversity of the repertoire responding spontaneously to p139 is smaller than that primed by s.c. challenge with the peptide in adjuvant and that it uses a distinct set of shared TCR-β rearrangements.

Immunization with p139 determines a shift of T cell usage from the spontaneous to the induced repertoire

The observations reported above lead to a question about the role of the spontaneous repertoire in the final composition of the response to p139 after immunization.

To examine the behavior of the spontaneous repertoire after challenge with p139 in adjuvant, two groups of SJL mice were immunized s.c. with p139 or with p178 emulsified in enriched CFA. Mice from both groups had developed clincal EAE and were in remission or relapse of disease when sacrificed on day 22 or later after immunization. In all of the spleens obtained from these two groups of mice, we tested the usage of the rearrangements marking the spontaneous (Vβ18-Jβ1.2 (132 b) and Vβ19-Jβ1.2 (121, 124 and 127 b)) and the induced responses (Vβ10-Jβ1.1 (97 b)). Spleen cells from each mouse were cultured in vitro for 3 days in the absence (control) or presence (test) of 10 µg/ml p139. mRNA and cDNA were then prepared, and immunoscope analysis was performed as described.

Results (reported in Fig. 2) show that spleen cells obtained from 6 out of 9 mice immunized with p139 use the Vβ10-Jβ1.1 rearrangement (filled columns). In contrast, only 1 out of 12 mice immunized with p178 use this rearrangement, confirming that usage of rearrangement Vβ10-Jβ1.1 in the response to p139 requires immunization with this peptide (p < 0.00001). Mice immunized with p178 use the TCRs that characterize the spontaneous response to p139 with a frequency consistent with that of naive mice (8/12) (see also Table I for detailed data). Intriguingly, usage of the spontaneous repertoire to p139 appears reduced in mice immunized with p139 with respect to control mice immunized with p178. In fact, only 3 out of 9 mice tested displayed usage of either Vβ18-Jβ1.2 or Vβ19-Jβ1.2 rearrangements (Fig. 2, open columns, p = 0.046). Therefore, immunization with p139 results in a modification of the T cell populations of the spleen that proliferate upon stimulation in vitro with the peptide. We observed a shift from cells belonging to the spontaneous repertoire (no longer detected) toward those that describe the induced repertoire. This shift is specifically connected to immunization with p139.

View larger version (19K): [in this window] [in a new window]   FIGURE 2. Immunization with p139 specifically determines a shift of TCR usage from the spontaneous to the induced repertoire. Two groups of SJL mice were immunized with 75 µg of p139/mouse (9 mice) or 100 µg of p178/mouse (12 mice). Mice that were immunized with p178 also received pertussis toxin on days 0 and 3 after immunization. All mice were allowed to undergo acute EAE and to recover. They were sacrificed between days 22 and 45 after immunization during remission, relapse, or the chronic phase of disease. Immunoscope analysis for Vβ10-Jβ1.1, Vβ18-Jβ1.2, and Vβ19-Jβ1.2 was performed as described. Open bars indicate the percentage of mice using T cells that express the Vβ18-Jβ1.2 and/or Vβ19-Jβ1.2 rearrangements that mark the spontaneous repertoire. Filled bars indicate the percentage of mice using T cells that use the Vβ10-Jβ1.1 rearrangement that marks the induced repertoire. In both groups of animals, TCRs belonging to the spontaneous and to the induced repertoires occur in the same mice. Reduction in usage of the spontaneous repertoire and appearance of the induced repertoire are specifically associated with immunization with p139 (*, p = 0.046 and **, p < 0.0001, respectively).

We have observed that immunization with p139 results in priming of "naive" T cells while shutting down or diverting the "spontaneous" repertoire. Part of this phenomenon can be due to special processing of the peptide occurring in vivo by activated DC. This processing could result in a peptide/MHC complex minimally different from the one displayed (mostly by splenic B cells) during culture in vitro. The unique antigenic determinant may not be recognized by T cells belonging to the spontaneous repertoire and would probably prime a distinct set of specific T cells. To test this hypothesis, we asked whether the epitope derived from p139 (presented in vivo by DC in lymph nodes draining the immunization site) stimulates T cells belonging to the spontaneously activated repertoire.

As a source of DC that had taken up p139 in vivo, female SJL mice were immunized with p139 in IFA. Four days later, DC from the draining lymph nodes were enriched by depletion of T cells, followed by Percoll gradient and immunoaffinity depletion of the large B cell population. This method results in a population of cells containing 60% of N418⁺ MHC class II⁺ cells that are able to stimulate Ag-specific T cells without the need for addition of Ag in vitro (29). T cells belonging to the induced or spontaneous repertoire were obtained from SJL mice immunized with p139 or from SJL mice immunized with p178, respectively, emulsified in enriched CFA. Fifteen days later, spleen cells from individual mice of both groups were obtained and seeded at 10⁷ cells/well in 24-well plates in complete medium at a final volume of 1 ml/well, in the absence of Ag (background) but in the presence of p139 (10 µg/ml) (positive control), or of 7.5 x 10⁴ DC enriched from the lymph nodes of SJL mice that had received p139 in vivo, without added in vitro Ag (test). The results of this experiment are shown in Fig. 3 and in Table II. As expected, p139 added in vitro stimulated the expansion of peaks corresponding to CDR3-β of T cells from both repertoires. The expansion of the same peaks was also achieved when DC loaded in vivo were used as the source of antigenic complexes, both for rearrangements belonging to the induced repertoire and for those characterizing the spontaneous repertoire. The only TCR belonging to the spontaneous repertoire that failed to expand was the Vβ19-Jβ1.2 of 127 b length (Table II). Thus, it appears that the epitope(s) on p139 presented in vivo by DC are recognized by T cells belonging to the spontaneous repertoire, and failure to reactivate these cells cannot be hypothesized as the reason for the priming in vivo of a new, independent repertoire.

View larger version (26K): [in this window] [in a new window]   FIGURE 3. DC, which have acquired p139 in vivo, stimulate expansion of T cells that belong to the induced and the spontaneous repertoires. Four SJL mice were challenged s.c. with 100 µg/mouse of p139 in IFA. DC were enriched as described (29 ) from draining lymph nodes and used as a source of antigenic complexes. Spleen cells from mice that had been immunized s.c. 15 days earlier with p139 (as a source of T cells belonging to the induced repertoire Vβ10-Jβ1.1) or with p178 (as a source of T cells belonging to the spontaneous repertoire Vβ19-Jβ1.2) were cultured in the absence of added Ag, in the presence of 10 µg/ml p139 added in vitro, or of DC obtained from mice injected with p139 in the absence of peptide added in vitro. Immunoscope analysis was performed 3 days later as described in Materials and Methods. The spectra obtained from one individual mouse immunized with p139 (upper row) and from one individual mouse immunized with p178 (lower row) are shown. Shaded peaks represent the Ag-driven expansion of Vβ10-Jβ1.1 (97 b) peak (upper row) or Vβ19-Jβ1.2 (124 b) peak (lower row). RSI of the Ag-specific rearrangements are displayed for each condition.

Failure of immunoscope analysis to detect the spontaneous repertoire in mice immunized with p139 may also be attributed to a higher avidity of the TCRs belonging to the induced repertoire. To examine this possibility, we tested the ability of graded concentrations of p139 to sustain the expansion of T cells belonging to the spontaneous repertoire (32). Results, which are reported in Table II, are compared with what we previously observed for the several T cells belonging to the induced repertoire (13). Within the repertoire responsible for the induced response, BV10⁺ receptor-bearing T cells display an avidity for the p139/MHC complexes that is higher than average. They in fact expand optimally at 0.5 µg/ml peptide in vitro, a concentration that induces <50% of maximal proliferation, as measured by [³H]thymidine incorporation in a standard proliferation assay (not shown). Two TCRs used by the spontaneous repertoire (Vβ19-Jβ1.2 of 121 and 124 b length) can expand optimally even at this low concentration of 0.5 µg/ml p139, equivalent to the level observed in seven of eight samples of the dominant induced rearrangement Vβ10-Jβ1.1 (97 b). Most T cells carrying the Vβ18-Jβ1.2 (132 b) are expanded optimally at 5 µg/ml p139, resembling most T cells carrying the semiprivate rearrangement Vβ4-Jβ1.6 (162 b). The T cells carrying the Vβ19-Jβ1.2 127b rearrangement need 50 µg/ml p139 to expand optimally. This latter observation can explain the failure of DC loaded in vivo to sustain their proliferation in in vitro coculture.

The data reported above indicate that a difference in avidity between the two repertoires does not explain the reduction of usage or detection of the spontaneous repertoire and the priming of the newly induced one. Accordingly, p139 added in vitro can expand T cells carrying rearrangements that belong to both repertoires in spleen cells from a single mouse.

p139 delivered s.c. interacts with T cells from both spontaneous and induced repertoires but with different outcomes

We examined the variation of the clonal composition of the T cell response to p139 in lymph nodes and spleen over time after immunization with the peptide. SJL mice were immunized s.c. with p139 in enriched CFA, and 4, 14, and 28 days later, splenic and draining LNC from 4 mice/group were cocultured with p139. Three days later, immunoscope analysis for rearrangements belonging to the induced (Vβ10-Jβ1.1) and spontaneous (Vβ18-Jβ1.2 and Vβ19-Jβ1.2) repertoires was performed. The percentages of mice using each repertoire at each time point are summarized in Fig. 4.

View larger version (16K): [in this window] [in a new window]   FIGURE 4. The shift of TCR repertoire usage occurs in draining lymph nodes and in the spleen following immunization with p139. Groups of 4 SJL mice were immunized s.c. with p139 and sacrificed at days 4, 14, and 28 after immunization. Cells from spleen (squares) and draining lymph nodes (triangles) were stimulated in vitro with p139, and the Ag-driven expansion of TCR belonging to spontaneous (, ) or induced repertoire (, ) were examined as described in the legend to Fig. 2. The figure reports the percentage of mice using each repertoire at each time point.

BV10⁺ cells and BV18/BV19⁺ cells are enriched among sorted T cells that have proliferated in response to p139 in mice immunized with p139 or p178, respectively

Labeling of cells with CFSE allows tracking of cells that have proliferated in response to stimulation as CFSE^low cells. We used this technique to examine directly the contribution of BV18/19⁺ or BV10⁺ TCR repertoires to the proliferation in vitro of spleen cells obtained from mice that had been immunized with this peptide or with the control peptide p178.

Two groups of SJL mice received p139 or p178 resuspended 1/1 in enriched CFA s.c., as detailed in Materials and Methods. Fifteen days later, mice were sacrificed and spleen cells were labeled with CFSE. After 3 days of culture in the presence of p139, cells were stained with PE-labeled anti-CD4 Ab, and CD4⁺CFSE^low cells were sorted by FACS and examined for the presence of BV10, BV18, and BV19 rearrangements by immunoscope. Results are reported in Fig. 5 and Table III.

View larger version (34K): [in this window] [in a new window]   FIGURE 5. BV10+ cells contribute differently to p139-specific proliferation in vitro of spleen cells from mice immunized with this peptide or with control p178. Groups of 4 SJL mice were immunized s.c. with p139 or with p178 and sacrificed 15 days later. Cells from draining lymph nodes (A and B) of mice immunized with p139 and from spleens of both groups (C and D) were stained with CFSE as described in Materials and Methods and stimulated in vitro with p139. A, FACS analysis of cells obtained from LN of mice immunized with p139 and stimulated in vitro with the same peptide. Cells that had proliferated are gated as CD4+CFSElow cells. B, FACS analysis of sorted CD4+CFSElow cells from the same sample reported in A. C, Representative Vβ10-Jβ1.1 spectra obtained from CD4+CFSElow spleen cells sorted as described above. Spectra obtained from one SJL mouse immunized with p139 and one control mouse immunized with p178 are shown. The total number of sorted cells that were analyzed for each sample is indicated above the corresponding spectrum. The 97-b peaks are shaded. D, , Average and SD of the ratio between the area under the BV10 (97 b) peak and the total number of analyzed CD4+CFSElow cells obtained from mice immunized with p139 or control p178 (**, p = 0.002). , Number of mice from each group whose sorted CD4+CFSElow spleen cells showed the presence of peaks corresponding to the BV18/BV19 repertoire.

Fig. 5C shows two spectra for the BV10 rearrangement obtained from comparable numbers of CD4⁺CFSE^low cells sorted from the spleen of one mouse immunized with p139 and one immunized with control p178 peptide (the peak corresponding to 97 b length is filled). As shown also in Table III in detail, the peak corresponding to 97 b could be detected in both groups of samples, but it appeared markedly more represented in the samples obtained from mice immunized with p139. To compare the contribution of cells carrying the BV10 rearrangement, we normalized the area under the peak with the number of sorted CD4⁺CFSE^low cells for each sample. Fig. 5D shows the average and SD of the ratio between the area under the 97-b peak and the number of CD4⁺CFSE^low sorted cells (filled bars) in the two groups of mice. The difference between the two groups was significant (p = 0.002). This observation supports the hypothesis that BV10⁺ cells contribute poorly to the proliferation in vitro of spleen cells in mice that have not been immunized with the p139, because of low precursor frequency or low ability to proliferate. Immunization with p139 specifically expands this population within the responsive T cells. Conversely, as previously shown by Vβ-Jβ spectratyping, immunization with p139 decreases the number of T cells that use the BV18/19 spontaneous repertoire.

BV18/BV19⁺ cells and BV10⁺ cells display different activation markers and cytokine profile

The simultaneous presence of BV18/BV19⁺ cells and BV10⁺ cells in the lymph nodes early after immunization with the peptide provides the opportunity to compare cell lineage, cytokine secretion profile, and activation markers of T cells carrying the several TCRs characteristic of the spontaneous and induced repertoires in the same sample. Thus, after immunization, LNC cultured for 3 days in the presence of p139 were sorted into CD4⁺, CD4^–, CD8⁺, and CD8^– cells by using MACS beads labeled with the corresponding Abs. In a second group of experiments, LNC were stimulated with the peptide and 3 h later enriched for IFN--, IL-10-, or IL-4-secreting cells using the MACS secretion kit, as previously described.

CD45 isoforms and CD62L in parallel describe distinct subsets of T cells. Effector and effector memory T cells are CD62L^low, CD45RA^–, and CD45R0⁺, while naive and central memory T cells are CD62L⁺, CD45RA⁺, and CD45R0^–. Both types of cells are present in lymphoid organs during immune responses (33). We therefore enriched cells from draining lymph nodes by magnetic immunoaffinity sorting into CD62L⁺ and CD62L^– populations. Each population was stimulated in vitro in the presence of p139 and B220⁺ cells obtained from the spleens of naive SJL mice. The TCR gene usage was examined in all samples: results are reported in Table IV.

BV10⁺ cells show a profile that overlaps with that expected for effector or effector memory cells. They are enriched among CD62L^– cells (and also CD45RA^–, not shown) and, as previously reported, secrete IFN- and are CD4⁺. BV18⁺ cells are enriched in CD4⁺ and CD62L⁺ cell populations. BV19⁺ cells carrying rearrangements of 121 and 124 b length coelute with CD4⁺ cells, while those carrying the rearrangement of 127 b length are enriched among CD8⁺ cells. Possibly because of the low frequency of each of these populations, it has not been possible to assess the enrichment of each type (121, 124, and 127 b) of BV19⁺ T cells selected on the basis of expression of CD62L.

The shift of repertoire usage in the spleen precedes onset of EAE

In a separate group of experiments, we tested whether the shift of repertoire usage in the spleen occurs before or after the onset of EAE. Nineteen SJL mice were immunized s.c. in the region flanking the spinal cord with 75 µg/mouse of p139 suspended in enriched CFA to induce EAE. Five mice were sacrificed before disease onset (10 days after immunization) and 5 more were sacrificed at the onset of EAE (first day with score of disease 1), at about day 16 (see below). The 9 remaining mice were allowed to develop EAE and were sacrificed during remission or relapse (data reported in Fig. 2). The presence of the public rearrangement Vβ10-Jβ1.1 and of Vβ18-Jβ1.2/Vβ19-Jβ1.2⁺ cells was tested in the spleens from all mice and in the CNS infiltrating cells from 3 mice at day 10 and from all of the mice sacrificed at onset of EAE. Results are reported in Fig. 5.

The average onset of EAE (established with 14 mice) occurred at 16.5 ± 1.5 days, when the average disease score was 1.7 ± 0.5 (Fig. 6A, open circles). Mice that were sacrificed at day 10 after immunization showed an average disease score of 0.3 ± 0.3 (p < 0,001) (Fig. 6A, filled circles). Results of the immunoscope analysis of spleen show that the shift from usage of the spontaneous to the induced repertoire had already occurred in the spleens obtained at day 10 (Fig. 6B). Thus, appearance of the T cells belonging to the induced repertoire in the spleen precedes onset of disease. T cells carrying the public Vβ10-Jβ1.1 rearrangement are not detected within the CNS at day 10 after immunization, while they have infiltrated the CNS by the onset of EAE (Fig. 6C, filled symbols). Fig. 6D shows the Vβ10-Jβ1.1 CDR3-β spectra of spleen cells in the absence or presence of p139 and of CNS infiltrating cells directly ex vivo in an individual mouse during clinical EAE. The presence of T cells carrying the public Vβ10-Jβ1.1 rearrangement was also confirmed by cDNA sequencing. We analyzed the cDNA obtained from two CNS samples obtained at the onset of disease. A total of 16 plasmids were obtained that included Vβ10-Jβ1.1 CDR3 sequences. Eleven of the 16 plasmids had CDR3 sequences fitting with those previously described as candidate sequences for the public rearrangement (13). All of the samples obtained from CNS-infiltrating cells were negative for the spontaneous rearrangements (Fig. 6C, open squares), although we cannot exclude that the number of infiltrating cells carrying these rearrangements falls below the detection limit of our immunoscope analysis.

View larger version (21K): [in this window] [in a new window]   FIGURE 6. T cells belonging to the induced repertoire appear in the spleen before the onset of EAE and home to the CNS during acute presentation of the disease. Nineteen SJL mice were immunized with 75 µg/mouse of p139 following the protocol for EAE induction as described in the legend to Fig. 2. Five mice were sacrificed at day 10 after immunization, before signs of EAE developed. Fourteen mice were allowed to develop EAE, and five of them were sacrificed at onset of disease. A, Disease score and time of onset of EAE in SJL mice. Mice sacrificed at day 10 after immunization did not show clinical signs of EAE (average score 0.3 ± 0.3) (filled symbol). Open symbols show the mean day of onset (first day with disease score 1) and mean disease score at onset observed for the other 14 mice allowed to develop EAE. Bars indicate 1 SD. In the inset, a representative cervical spinal cord section from a SJL mouse at the first peak of EAE (grade 3) is shown. Immunostaining for CD4 shows abundant T cell infiltration in the meninges and white matter. Original magnification of x250. B and C, Presence of the TCRs characterizing the spontaneous and induced repertoires in the spleen and CNS infiltrating mononuclear cells at day 10 after immunization and at onset of EAE. B, Presence (upper row) or absence (lower row) of spontaneous (open symbols) or induced (filled symbols) repertoires in the spleen. Spleen cells from mice sacrificed at day 10 after immunization or at onset of EAE (5 mice/group) were tested for usage of TCR rearrangements characterizing spontaneous (open symbols) and induced (filled symbols) repertoires, as described in the legend to Fig. 1. C, Presence (upper row) or absence (lower row) of spontaneous (open symbols) and induced (filled symbols) repertoires in the CNS. Infiltrating mononuclear cells were enriched from the CNS of three out of the five mice sacrificed 10 days after immunization and of the five mice sacrificed at onset of disease, and directly tested for TCR rearrangements by Vβ-Jβ spectratyping, without in vitro stimulation with the Ag. D, Representative spectra of the Vβ10-Jβ1.1 rearrangement obtained in spleen cells cultured in the absence or presence of p139, or directly from CNS infiltrating cells. The peak corresponding to the public rearrangement (97 b) is shaded in the Ag-positive and CNS samples.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
In the present study, we used Vβ-Jβ spectratyping to study the spontaneous response in the SJL mouse to p139; we define this as the response elicited in vitro by the addition of the peptide to the uninjected animal’s LN or spleen cells. The public rearrangement Vβ10-Jβ1.1 that was previously characterized (13) is not used in the spontaneous response, but rather identifies the repertoire specifically activated by immunization. We also detected shared (semiprivate) CDR3-β regions associated with T cells specific for p139 belonging to the spontaneous repertoire. Comparing the usage of rearrangements marking induced and spontaneous repertoires, we showed that immunization with p139 results in a shift of T cell usage from the spontaneous to the induced repertoire. T cells associated with the spontaneous and induced response both recognize the epitope derived from p139 presented by DC loaded in vivo, and there is no significant difference in the avidity of these two groups of cells for p139/MHC complexes. T cells belonging to the spontaneous and induced repertoires are recruited to the draining lymph nodes early after immunization, while the members of the induced repertoire become established and prevail in lymph nodes and spleen preceding disease onset. The spontaneous response does not achieve the level of the induced response in terms of the number of T cell clones involved. Although T cells belonging to the induced repertoire home to the CNS during the acute phase of EAE, we consistently failed to detect TCR rearrangements belonging to the spontaneous repertoire in the CNS during EAE induced by either p139 or p178.

Peripheral lymphoid organs of naive SJL mice display a high frequency (up to 1/20,000 LNC (9)) of self-reactive p139-specific T cells. These T cells are supposed to play a central role in the dominance of this determinant in the response to whole myelin in this strain, because the T cell repertoire against this determinant has not been purged of any of its high-affinity T cells. The detectable self-specific, activated, spontaneous response provides a unique model to address two issues. First, what changes are needed to transform nonpathogenic self-recognition into a pathogenic immune response? Second, what is the effect of an extrinsic encounter with a self-Ag on the clonal composition of a preexisting T cell response? We show herein that the first in vivo encounter with the Ag has a distinct effect on T cells depending on their activated or naive status.

A large number of studies have demonstrated that self-reactive T cells can escape tolerance induction both in mouse models and in humans. Several mechanisms underlie this escape: low avidity for self peptide (7), low concentration or absence of the self epitopes within the thymus (9, 34), and stochastic events (35). This degree of self-reactivity may even provide some antimicrobial activity (36). Nevertheless, the presence of these cells permits the activation of autoimmune diseases, and control mechanisms in the periphery prevent this occurrence (37, 38, 39, 40). Escape from these control mechanisms and appropriate activation and polarization of self-reactive cells are needed to provoke the insurgence of autoimmune diseases.

In the SJL/p139 model, the response to p139 appears to have already escaped from control mechanisms, as evidenced by the appearance of CD44^high-specific cells that expand during the life of the mouse (9). However, rather than simply a triggering of previously primed T cells, we show that induction of EAE includes three distinct events: the preactivated repertoire must compete with, and is substituted by, a newly primed one; the newly dominant repertoire expands greatly in the peripheral lymph nodes and the spleen; and at least some of these primed T cells acquire a "trafficking" phenotype appropriate for causing disease, and appear in the spinal cord. The relative contribution of each of these three events to disease development is still under debate.

Few data are available to establish the minimal size of self-reactive T cell populations that can yield an autoimmune disease. In human multiple sclerosis, a variety of determinants of myelin-derived proteins are recognized at different times during the course of the disease. As we show herein, the size of the clonal composition of the response to p139 after immunization appears somewhat larger than that responsible for the non-pathogenic spontaneous response. This difference may be due to the failure of immunoscope analysis to detect that part of the repertoire that does not expand sufficiently upon in vitro culture. This may occur either because a part of the specific repertoire in the uninjected mice still comprises naive T cells, or because it includes cells that are undetectable due to their low frequency. However, when we examined by immunoscope the size of the clonal response to p178 involved in the EAE that follows immunization with this peptide, we observe that it is relatively small, in the range of that involved in the spontaneous response to p139 (G. Di Sante, unpublished observations). Thus, the overall clonal size of the immune response measurable by immunoscope may be less relevant than acquisition of an appropriate phenotype by the responding T cells in determining disease occurrence.

T cells have to display a proinflammatory phenotype to trigger the tissue damage that ultimately leads to disease. Type 1 T cells that secrete IFN- and TNF-, as well as Th17 cells, are thought to play the dominant role in determining induction of organ-specific autoimmune disease (41, 42, 43, 44), and blockade of proinflammatory circuits usually results in amelioration or prevention of disease (45). The development of an autoimmune disease requires that the appropriate phenotype of the immune response is displayed not only in lymphoid organs, but also in the target tissue. In addition to polarization, the environment in which priming occurs also influences the trafficking properties of the T cells (46), possibly through regulation of integrin expression by Ag-presenting DC (47, 48). Although memory T cells appear amenable to some degree of reeducation by DC (49), exploitation of this role of the environment occurs more efficiently during priming of naive cells (46).

We observe that the shift from the spontaneous to the induced repertoire is detectable in the spleen before disease onset. This observation suggests that migration through the spleen or the lymph nodes after priming precedes the homing of potentially pathogenic cells into target organs (50). The course of this complex sequence of events (expansion and contraction of BV18/19⁺ cells, their replacement by BV10⁺ cells, and disease onset thereafter) is completed within a short period following immunization with p139.

The individual’s immunological history shapes the T cell repertoire that will be involved in the response to a new pathogen (51). In analogy with the spontaneous expansion and activation of p139-specific T cells in SJL mice, heterologous priming of CD8⁺ T cells by cross-reactive pathogen(s) can generate a population of memory cells directed against a virus before exposure to the virus itself occurs (52). This heterologous immune response influences the outcome of infections (53) and can modify the hierarchy of epitope recognition (54). Memory T cells display large precursor frequencies and a low requirement for costimulation to activate and secrete cytokines (55, 56). These characteristics may favor memory over naive cells of similar affinity in the competition for access to MHC/peptide complexes (24, 25, 26). This model also suggests that the memory clones generated after primary immunization expand upon secondary encounter with the Ag (22, 52), while homeostasis is preserved by pathogen-dependent apoptosis of non-cross-reactive T cells (57).

The cells that proliferate spontaneously in the SJL strain in response to p139 were shown to be CD44^high, thus belonging to an effector/memory population. We could not demonstrate directly whether T cells with the shared rearrangements, Vβ19-Jβ1.2 and Vβ18-Jβ1.2, also bear the CD44^high marker. Nevertheless, cells carrying BV18 rearrangements are enriched within CD62L⁺ cells, and BV18 and BV19 expressing T cells expand within 3 days of coculture with the Ag and are found in spleen and lymph nodes while showing an apparent deficiency of homing into the CNS. Therefore, T cells carrying BV18 (and to some extent also BV19) rearrangements share the characteristics of activated/central memory cells (33). Our observations show that this preactivated Ag-specific repertoire has already been recruited to draining lymph nodes at the time that Ag is newly encountered, either in vitro or in vivo. However, during the first 2 wk following Ag challenge, these cells start to disappear and become replaced by newly arising cells of similar Ag specificity.

Although several mechanisms (such as homeostatic- or growth factor-mediated expansion and survival in niches) can support the survival of memory cells in the absence of Ag stimulation (58, 59, 60, 61), reencounters with the Ag can change the clonal composition of the T cell response. Thus, chronic persistence of the stimulus can cause Ag-induced cell death; central memory cells may also concomitantly be activated, so that the resulting composition of the CD4⁺ T cell repertoire can be thereby modified (62, 63).

The p139-specific repertoire elicited by immunization in the SJL strain comprises T cells that are distinct in their functional properties and ligand recognition. Th1 and Th2 clones/lines specific for p139 recognize different residues within the sequence of the peptide, with W144 and L141 being the dominant contact residues for Th1 and Th2 cells, respectively (64). An analogous difference can occur between the repertoire involved in the spontaneous response in vitro to the peptide and the repertoire primed by immunization, and may determine the ability or failure of self-epitope(s) to drive their spontaneous activation in naive SJL. The part of the p139-specific repertoire that is not activated spontaneously would then be available for priming under disease-promoting conditions, as happens following immunization with Ag in adjuvant. The adjuvant itself may promote the activation of DC, thereby unveiling determinants that are not available as immunogens in naive mice. This is a somewhat parallel situation to that seen in the type I diabetes development in the NOD mouse. The repertoire displayed spontaneously in the very young mouse (3–6 wk) to a protein such as glutamic acid decarboxylase (GAD) is entirely distinct from the repertoire engaged by immunizing the NOD with the whole protein in adjuvant. In this case, the two classes of determinants are not on the same peptide but are widely scattered throughout the large GAD65 protein (K. P. Jensen, F. Ria, S. Gregori, L. Adorini, L.C. Harrison, A. Quinn, and E. E. Sercarz, submitted).

The presence of an enlarged (spontaneous) repertoire may play a fundamental role in the generation of the "new" response, providing large amounts of IL-2, readily available help for Ag-specific B cells, and an environment driving polarization. The transfer of information about Th polarization can occur through regulation of IL-12 secretion, or other directive cytokines (65, 66, 67, 68). Thus, in this case, the T cell-mediated response that follows Ag challenge is not characterized by further proliferation of the preexisting repertoire, but the preexisting repertoire may facilitate expansion and polarization of the new induced repertoire.

Clonal variability during the secondary response may offer some advantages to the immune system. A response that changes its clonal composition, perhaps focusing on different residues within the determinant region of the pathogen, thereby adapts to Ags (pathogens) that are reencountered after having undergone limited diversification and that display recurrent epidemic distribution. The immune system will thus exploit the advantage of a preexisting specific population to initially control the pathogen and to facilitate expansion and polarization of new T cells, which permits a round of selection of more effective cells for fighting the pathogen. Alternatively, in the case of a stable clonal composition of memory responses, the presence of cross-reactive memory cells would not favor and could even hamper priming of a more rare but more specific naive T cell repertoire. Repeated cycles of activation and depletion of Ag-specific repertoires (such as in chronic infectious diseases), however, may lead to exhaustion of immune responsiveness (69, 70, 71), as occurs in tropical countries where the high incidence of largely cross-reactive environmental Mycobacteria not only fails to protect from tuberculosis, but severely limits the efficacy of bacillus Calmette-Guérin vaccination (72).

If one considers the progress toward memory within the T repertoire of an individual, T cells directed against self-Ag experience an extra step in their development. The self-Ag encountered during earliest development can perform endogenous priming. Thus, the initial extrinsic administration of the self-Ag to the supposedly naive animal actually represents a type of secondary stimulus for the spontaneously raised endogenous memory in the animal. Whether this restimulated response goes on to provide a continued source of memory in the injected animal or whether a newly raised primary repertoire arises from the extrinsic Ag to replace it completely has been a subject of our studies.

	Acknowledgments

 
We thank E. Maverakis and G. Forni for helpful discussion, and B. Serafini for performing the immunohistochemical experiments.

	Disclosures

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
The authors have no financial conflicts of interest.

	Footnotes

 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ This work was supported by grants from the Italian Foundation for Multiple Sclerosis (2003/R/46) and from the Italian Ministry for University and Research (FIRB RBNEO14BML) to F.R., and by grants from the Multiple Sclerosis National Research Institute and National Institutes of Health (AI-42396) to E.E.S. C.N. is supported by a research fellowship from the Italian Foundation for Multiple Sclerosis.

² Address correspondence and reprint requests to Dr. Francesco Ria, Catholic University, Largo Francesco Vito 1, 00168 Rome, Italy. E-mail address: fria{at}rm.unicatt.it

³ Abbreviations used in this paper: R-EAE, relapsing experimental autoimmune encephalomyelitis; b, base; DC, dendritic cell; LN, lymph node; LNC, lymph node cells; p139, proteolipid protein peptide 139–151; p178, proteolipid protein peptide 178–191; PLP, proteolipid protein; RSI, relative stimulation index.

Received for publication June 14, 2007. Accepted for publication March 6, 2008.

	References

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 

1. Lehmann, P. V., T. Forsthuber, A. Miller, E. E. Sercarz. 1992. Spreading of T-cell autoimmunity to cryptic determinants of an autoantigen. Nature 358: 155-157. [Medline]
2. Vanderlugt, C. L., K. L. Neville, K. M. Nikcevich, T. N. Eagar, J. A. Bluestone, S. D. Miller. 2000. Pathologic role and temporal appearance of newly emerging autoepitopes in relapsing experimental autoimmune encephalomyelitis. J. Immunol. 164: 670-678. [Abstract/Free Full Text]
3. Gammon, G., E. Sercarz. 1989. How some T cells escape tolerance induction. Nature 342: 183-185. [Medline]
4. Ria, F., B. M. Chan, M. T. Scherer, J. A. Smith, M. L. Gefter. 1990. Immunological activity of covalently linked T-cell epitopes. Nature 343: 381-383. [Medline]
5. Klein, L., M. Klugmann, K. A. Nave, V. K. Tuohy, B. Kyewski. 2000. Shaping of the autoreactive T-cell repertoire by a splice variant of self protein expressed in thymic epithelial cells. Nat. Med. 6: 56-61. [Medline]
6. Oldstone, M. B., M. Nerenberg, P. Southern, J. Price, H. Lewicki. 1991. Virus infection triggers insulin-dependent diabetes mellitus in a transgenic model: role of anti-self (virus) immune response. Cell 65: 319-331. [Medline]
7. Zehn, D., M. J. Bevan. 2006. T cells with low avidity for a tissue-restricted antigen routinely evade central and peripheral tolerance and cause autoimmunity. Immunity 25: 261-270. [Medline]
8. Oldstone, M. B.. 1998. Molecular mimicry and immune-mediated diseases. FASEB J. 12: 1255-1265. [Abstract/Free Full Text]
9. Anderson, A. C., L. B. Nicholson, K. L. Legge, V. Turchin, H. Zaghouani, V. K. Kuchroo. 2000. High frequency of autoreactive myelin proteolipid protein-specific T cells in the periphery of naive mice: mechanisms of selection of the self-reactive repertoire. J. Exp. Med. 191: 761-770. [Abstract/Free Full Text]
10. Anderton, S. M.. 2006. Avoiding autoimmune disease: T cells know their limits. Trends Immunol. 27: 208-214. [Medline]
11. Miller, S. D., B. L. McRae, C. L. Vanderlugt, K. M. Nikcevich, J. G. Pope, L. Pope, W. J. Karpus. 1995. Evolution of the T-cell repertoire during the course of experimental immune-mediated demyelinating diseases. Immunol. Rev. 144: 225-244. [Medline]
12. Takacs, K., P. Chandler, D. M. Altmann. 1997. Relapsing and remitting experimental allergic encephalomyelitis: a focused response to the encephalitogenic peptide rather than epitope spread. Eur. J. Immunol. 27: 2927-2934. [Medline]
13. Nicolò, C., G. Di Sante, M. Orsini, S. Rolla, S. Columba-Cabezas, V. Romano Spica, G. Ricciardi, B. M. C. Chan, F. Ria. 2006. Mycobacterium tuberculosis in the adjuvant modulates the balance of Th immune response to self-antigen of the CNS without influencing a "core" repertoire of specific T cells. Int. Immunol. 18: 363-374. [Abstract/Free Full Text]
14. Tuohy, V. K., Z. Lu, R. A. Sobel, R. A. Laursen, M. B. Lees. 1989. Identification of an encephalitogenic determinant of myelin proteolipid protein for SJL mice. J. Immunol. 142: 1523-1527. [Abstract]
15. Whitham, R. H., D. N. Bourdette, G. A. Hashim, R. M. Herndon, R. C. Ilg, A. A. Vandenbark, H. Offner. 1991. Lymphocytes from SJL/J mice immunized with spinal cord respond selectively to a peptide of proteolipid protein and transfer relapsing demyelinating experimental autoimmune encephalomyelitis. J. Immunol. 146: 101-107. [Abstract]
16. Ota, K., M. Matsui, E. L. Milford, G. A. Mackin, H. L. Weiner, D. A. Hafler. 1990. T-cell recognition of an immunodominant myelin basic protein epitope in multiple sclerosis. Nature 346: 183-187. [Medline]
17. Zhang, J., S. Markovic-Plese, B. Lacet, J. Raus, H. L. Weiner, D. A. Hafler. 1994. Increased frequency of interleukin 2-responsive T cells specific for myelin basic protein and proteolipid protein in peripheral blood and cerebrospinal fluid of patients with multiple sclerosis. J. Exp. Med. 179: 973-984. [Abstract/Free Full Text]
18. Hong, J., Y. C. Zang, S. Li, V. M. Rivera, J. Z. Zhang. 2004. Ex vivo detection of myelin basic protein-reactive T cells in multiple sclerosis and controls using specific TCR oligonucleotide probes. Eur. J. Immunol. 34: 870-881. [Medline]
19. Lunemann, J. D., S. Ruckert, F. Kern, U. Wendling, R. van der Zee, H. D. Volk, F. Zipp. 2004. Cross-sectional and longitudinal analysis of myelin-reactive T cells in patients with multiple sclerosis. J. Neurol. 251: 1111-1120. [Medline]
20. Tejada-Simon, M. V., Y. C. Zang, D. Yang, J. Hong, S. Li, R. A. Singh, E. Van den Berg-Loonen, J. M. Killian, V. M. Rivera, J. Z. Zhang. 2000. Aberrant T cell responses to myelin antigens during clinical exacerbation in patients with multiple sclerosis. Int. Immunol. 12: 1641-1650. [Abstract/Free Full Text]
21. Sallusto, F., J. Geginat, A. Lanzavecchia. 2004. Central memory and effector memory T cell subsets: function, generation, and maintenance. Annu. Rev. Immunol. 22: 745-763. [Medline]
22. Blander, J. M., D. B. Sant'Angelo, D. Metz, S. W. Kim, R. A. Flavell, K. Bottomly, C. A. Janeway, Jr. 2003. A pool of central memory-like CD4 T cells contains effector memory precursors. J. Immunol. 170: 2940-2948. [Abstract/Free Full Text]
23. Baron, V., C. Bouneaud, A. Cumano, A. Lim, T. P. Arstila, P. Kourilsky, L. Ferradini, C. Pannetier. 2003. The repertoires of circulating human CD8⁺ central and effector memory T cell subsets are largely distinct. Immunity 18: 193-204. [Medline]
24. Kedl, R. M., W. A. Rees, D. A. Hildeman, B. Schaefer, T. Mitchell, J. Kappler, P. Marrack. 2000. T cells compete for access to antigen-bearing antigen-presenting cells. J. Exp. Med. 192: 1105-1113. [Abstract/Free Full Text]
25. Block, M. S., M. J. Hansen, V. P. Van Keulen, L. R. Pease. 2003. MHC class I gene conversion mutations alter the CD8 T cell repertoire. J. Immunol. 171: 4006-4010. [Abstract/Free Full Text]
26. Lanzavecchia, A.. 2002. Lack of fair play in the T cell response. Nat. Immunol. 3: 9-10. [Medline]
27. Pannetier, C., M. Cochet, S. Darche, A. Casrouge, M. Zoller, P. Kourilsky. 1993. The sizes of the CDR3 hypervariable regions of the murine T-cell receptor β chains vary as a function of the recombined germ-line segments. Proc. Natl. Acad. Sci. USA 90: 4319-4323. [Abstract/Free Full Text]
28. Serafini, B., S. Columba-Cabezas, F. Di Rosa, F. Aloisi. 2000. Intracerebral recruitment and maturation of dendritic cells in the onset and progression of experimental autoimmune encephalomyelitis. Am. J. Pathol. 157: 1991-2002. [Abstract/Free Full Text]
29. Guery, J. C., F. Ria, L. Adorini. 1996. Dendritic cells but not B cells present antigenic complexes to class II-restricted T cells after administration of protein in adjuvant. J. Exp. Med. 183: 751-757. [Abstract/Free Full Text]
30. Ria, F., A. Gallard, C. R. Gabaglia, J. C. Guery, E. E. Sercarz, L. Adorini. 2004. Selection of similar naive T cell repertoires but induction of distinct T cell responses by native and modified antigen. J. Immunol. 172: 3447-3453. [Abstract/Free Full Text]
31. Rolla, S., C. Nicolo, S. Malinarich, M. Orsini, G. Forni, F. Cavallo, F. Ria. 2006. Distinct and non-overlapping T cell receptor repertoires expanded by DNA vaccination in wild-type and HER-2 transgenic BALB/c mice. J. Immunol. 177: 7626-7633. [Abstract/Free Full Text]
32. Fasso, M., N. Anandasabapathy, F. Crawford, J. Kappler, C. G. Fathman, W. M. Ridgway. 2000. T cell receptor (TCR)-mediated repertoire selection and loss of TCR Vβ diversity during the initiation of a CD4⁺ T cell response in vivo. J. Exp. Med. 192: 1719-1730. [Abstract/Free Full Text]
33. Bingaman, A. W., D. S. Patke, V. R. Mane, M. Ahmadzadeh, M. Ndejembi, S. T. Bartlett, D. L. Farber. 2005. Novel phenotypes and migratory properties distinguish memory CD4 T cell subsets in lymphoid and lung tissue. Eur. J. Immunol. 35: 3173-3186. [Medline]
34. Maverakis, E., J. Beech, D. B. Stevens, A. Ametani, L. Brossay, P. van den Elzen, R. Mendoza, Q. Thai, L. H. Macias, D. Ethell, et al 2003. Autoreactive T cells can be protected from tolerance induction through competition by flanking determinants for access to class II MHC. Proc. Natl. Acad. Sci. USA 100: 5342-5347. [Abstract/Free Full Text]
35. Liston, A., D. H. Gray, S. Lesage, A. L. Fletcher, J. Wilson, K. E. Webster, H. S. Scott, R. L. Boyd, L. Peltonen, C. C. Goodnow. 2004. Gene dosage: limiting role of Aire in thymic expression, clonal deletion, and organ-specific autoimmunity. J. Exp. Med. 200: 1015-1026. [Abstract/Free Full Text]
36. Gronski, M. A., J. M. Boulter, D. Moskophidis, L. T. Nguyen, K. Holmberg, A. R. Elford, E. K. Deenick, H. O. Kim, J. M. Penninger, B. Odermatt, et al 2004. TCR affinity and negative regulation limit autoimmunity. Nat. Med. 10: 1234-1239. [Medline]
37. Sakaguchi, S.. 2004. Naturally arising CD4⁺ regulatory T cells for immunologic self-tolerance and negative control of immune responses. Annu. Rev. Immunol. 22: 531-562. [Medline]
38. Lerman, M. A., J. Larkin, III, C. Cozzo, M. S. Jordan, A. J. Caton. 2004. CD4⁺CD25⁺ regulatory T cell repertoire formation in response to varying expression of a neo-self-antigen. J. Immunol. 173: 236-244. [Abstract/Free Full Text]
39. Bacchetta, R., S. Gregori, M. G. Roncarolo. 2005. CD4⁺ regulatory T cells: mechanisms of induction and effector function. Autoimmun. Rev. 4: 491-496. [Medline]
40. Levings, M. K., M. G. Roncarolo. 2005. Phenotypic and functional differences between human CD4⁺CD25⁺ and type 1 regulatory T cells. Curr. Top. Microbiol. Immunol. 293: 303-326. [Medline]
41. Sospedra, M., R. Martin. 2005. Immunology of multiple sclerosis. Annu. Rev. Immunol. 23: 683-747. [Medline]
42. Nakajima, H., K. Fukuda, Y. Doi, M. Sugino, F. Kimura, T. Hanafusa, T. Ikemoto, A. Shimizu. 2004. Expression of TH1/TH2-related chemokine receptors on peripheral T cells and correlation with clinical disease activity in patients with multiple sclerosis. Eur. Neurol. 52: 162-168. [Medline]
43. Harrington, L. E., R. D. Hatton, P. R. Mangan, H. Turner, T. L. Murphy, K. M. Murphy, C. T. Weaver. 2005. Interleukin 17-producing CD4⁺ effector T cells develop via a lineage distinct from the T helper type 1 and 2 lineages. Nat. Immunol. 6: 1123-1132. [Medline]
44. Park, H., Z. Li, X. O. Yang, S. H. Chang, R. Nurieva, Y. H. Wang, Y. Wang, L. Hood, Z. Zhu, Q. Tian, C. Dong. 2005. A distinct lineage of CD4 T cells regulates tissue inflammation by producing interleukin 17. Nat. Immunol. 6: 1133-1141. [Medline]
45. Adorini, L.. 2004. Immunotherapeutic approaches in multiple sclerosis. J. Neurol. Sci. 223: 13-24. [Medline]
46. Mora, J. R., U. H. von Andrian. 2006. T-cell homing specificity and plasticity: new concepts and future challenges. Trends Immunol. 27: 235-243. [Medline]
47. Stagg, A. J., M. A. Kamm, S. C. Knight. 2002. Intestinal dendritic cells increase T cell expression of 4β7 integrin. Eur. J. Immunol. 32: 1445-1454. [Medline]
48. Dudda, J. C., J. C. Simon, S. Martin. 2004. Dendritic cell immunization route determines CD8⁺ T cell trafficking to inflamed skin: role for tissue microenvironment and dendritic cells in establishment of T cell-homing subsets. J. Immunol. 172: 857-863. [Abstract/Free Full Text]
49. Mora, J. R., G. Cheng, D. Picarella, M. Briskin, N. Buchanan, U. H. von Andrian. 2005. Reciprocal and dynamic control of CD8 T cell homing by dendritic cells from skin- and gut-associated lymphoid tissues. J. Exp. Med. 201: 303-316. [Abstract/Free Full Text]
50. Flugel, A., T. Berkowicz, T. Ritter, M. Labeur, D. E. Jenne, Z. Li, J. W. Ellwart, M. Willem, H. Lassmann, H. Wekerle. 2001. Migratory activity and functional changes of green fluorescent effector cells before and during experimental autoimmune encephalomyelitis. Immunity 14: 547-560. [Medline]
51. Yewdell, J. W., J. R. Bennink. 1999. Immunodominance in major histocompatibility complex class I-restricted T lymphocyte responses. Annu. Rev. Immunol. 17: 51-88. [Medline]
52. Selin, L. K., M. A. Brehm, Y. N. Naumov, M. Cornberg, S. K. Kim, S. C. Clute, R. M. Welsh. 2006. Memory of mice and men: CD8⁺ T-cell cross-reactivity and heterologous immunity. Immunol. Rev. 211: 164-181. [Medline]
53. Chen, H. D., A. E. Fraire, I. Joris, M. A. Brehm, R. M. Welsh, L. K. Selin. 2001. Memory CD8⁺ T cells in heterologous antiviral immunity and immunopathology in the lung. Nat. Immunol. 2: 1067-1076. [Medline]
54. Brehm, M. A., A. K. Pinto, K. A. Daniels, J. P. Schneck, R. M. Welsh, L. K. Selin. 2002. T cell immunodominance and maintenance of memory regulated by unexpectedly cross-reactive pathogens. Nat. Immunol. 3: 627-634. [Medline]
55. Fahmy, T. M., J. G. Bieler, M. Edidin, J. P. Schneck. 2001. Increased TCR avidity after T cell activation: a mechanism for sensing low-density antigen. Immunity 14: 135-143. [Medline]
56. Trautmann, A., S. Valitutti. 2003. The diversity of immunological synapses. Curr. Opin. Immunol. 15: 249-254. [Medline]
57. Welsh, R. M., K. Bahl, X. Z. Wang. 2004. Apoptosis and loss of virus-specific CD8⁺ T-cell memory. Curr. Opin. Immunol. 16: 271-276. [Medline]
58. Murali-Krishna, K., L. L. Lau, S. Sambhara, F. Lemonnier, J. Altman, R. Ahmed. 1999. Persistence of memory CD8 T cells in MHC class I-deficient mice. Science 286: 1377-1381. [Abstract/Free Full Text]
59. Swain, S. L., H. Hu, G. Huston. 1999. Class II-independent generation of CD4 memory T cells from effectors. Science 286: 1381-1383. [Abstract/Free Full Text]
60. Di Rosa, F., R. Pabst. 2005. The bone marrow: a nest for migratory memory T cells. Trends Immunol. 26: 360-366. [Medline]
61. Di Rosa, F., A. Santoni. 2002. Bone marrow CD8 T cells are in a different activation state than those in lymphoid periphery. Eur. J. Immunol. 32: 1873-1880. [Medline]
62. Vezys, V., D. Masopust, C. C. Kemball, D. L. Barber, L. A. O'Mara, C. P. Larsen, T. C. Pearson, R. Ahmed, A. E. Lukacher. 2006. Continuous recruitment of naive T cells contributes to heterogeneity of antiviral CD8 T cells during persistent infection. J. Exp. Med. 203: 2263-2269. [Abstract/Free Full Text]
63. Jelley-Gibbs, D. M., D. M. Brown, J. P. Dibble, L. Haynes, S. M. Eaton, S. L. Swain. 2005. Unexpected prolonged presentation of influenza antigens promotes CD4 T cell memory generation. J. Exp. Med. 202: 697-706. [Abstract/Free Full Text]
64. Das, M. P., L. B. Nicholson, J. M. Greer, V. K. Kuchroo. 1997. Autopathogenic T helper cell type 1 (Th1) and protective Th2 clones differ in their recognition of the autoantigenic peptide of myelin proteolipid protein. J. Exp. Med. 186: 867-876. [Abstract/Free Full Text]
65. Ria, F., G. Penna, L. Adorini. 1998. Th1 cells induce and Th2 inhibit antigen-dependent IL-12 secretion by dendritic cells. Eur. J. Immunol. 28: 2003-2016. [Medline]
66. Langrish, C. L., Y. Chen, W. M. Blumenschein, J. Mattson, B. Basham, J. D. Sedgwick, T. McClanahan, R. A. Kastelein, D. J. Cua. 2005. IL-23 drives a pathogenic T cell population that induces autoimmune inflammation. J. Exp. Med. 201: 233-240. [Abstract/Free Full Text]
67. Bettelli, E., Y. Carrier, W. Gao, T. Korn, T. B. Strom, M. Oukka, H. L. Weiner, V. K. Kuchroo. 2006. Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells. Nature 441: 235-238. [Medline]
68. Mangan, P. R., L. E. Harrington, D. B. O'Quinn, W. S. Helms, D. C. Bullard, C. O. Elson, R. D. Hatton, S. M. Wahl, T. R. Schoeb, C. T. Weaver. 2006. Transforming growth factor-β induces development of the T(H)17 lineage. Nature 441: 231-234. [Medline]
69. Byers, V. S., E. E. Sercarz. 1968. The X-Y-Z scheme of immunocyte maturation: IV. The exhaustion of memory cells. J. Exp. Med. 127: 307-325. [Abstract/Free Full Text]
70. Wherry, E. J., J. N. Blattman, K. Murali-Krishna, R. van der Most, R. Ahmed. 2003. Viral persistence alters CD8 T-cell immunodominance and tissue distribution and results in distinct stages of functional impairment. J. Virol. 77: 4911-4927. [Abstract/Free Full Text]
71. Jelley-Gibbs, D. M., J. P. Dibble, S. Filipson, L. Haynes, R. A. Kemp, S. L. Swain. 2005. Repeated stimulation of CD4 effector T cells can limit their protective function. J. Exp. Med. 201: 1101-1112. [Abstract/Free Full Text]
72. Andersen, P., T. M. Doherty. 2005. The success and failure of BCG: implications for a novel tuberculosis vaccine. Nat. Rev. Microbiol. 3: 656-662. [Medline]

This article has been cited by other articles:

				R. L. Warren, B. H. Nelson, and R. A. Holt Profiling model T-cell metagenomes with short reads Bioinformatics, February 15, 2009; 25(4): 458 - 464. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Penitente, R. Articles by Ria, F. Search for Related Content PubMed PubMed Citation Articles by Penitente, R. Articles by Ria, F.