The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


The Journal of Immunology, 2008, 180, 6586 -6592
Copyright © 2008 by The American Association of Immunologists, Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Huang, Z.
Right arrow Articles by Sun, Z.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huang, Z.
Right arrow Articles by Sun, Z.

Stabilized β-Catenin Potentiates Fas-Mediated T Cell Apoptosis1

Zhaofeng Huang*, Ruiqing Wang*, Huimin Xie*, Weirong Shang{dagger}, Santhakumar Manicassamy* and Zuoming Sun2,{ddagger}

* Department of Microbiology and Immunology, College of Medicine, University of Illinois, Chicago, IL 60612; {dagger} Department of Gynecology and Obstetrics, Emory University School of Medicine, Atlanta, GA 30308; and {ddagger} Division of Immunology, Beckman Research Institute of the City of Hope, Duarte, CA 91010


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
In response to Ag stimulation, Ag-specific T cells proliferate and accumulate in the peripheral lymphoid tissues. To avoid excessive T cell accumulation, the immune system has developed mechanisms to delete clonally expanded T cells. Fas/FasL-mediated apoptosis plays a critical role in the deletion of activated peripheral T cells, which is clearly demonstrated by superantigen (staphylococcal enterotoxin B)-induced deletion of Vβ8+ T cells. Using transgenic mice expressing a stabilized β-catenin (β-catTg), we show here that β-catenin was able to enhance apoptosis of activated T cells by up-regulating Fas. In response to staphylococcal enterotoxin B stimulation, β-catTg mice exhibited accelerated deletion of CD4+Vβ8+ T cells compared with wild type mice. Surface Fas levels were significantly higher on activated T cells obtained from β-catTg mice than that from wild type mice. Additionally, T cells from β-catTg mice were more sensitive to apoptosis induced by crosslinking Fas, activation-induced cell death, and to apoptosis induced by cytokine withdrawal. Lastly, β-catenin bound to and stimulated the Fas promoter. Therefore, our data demonstrated that the β-catenin pathway was able to promote the apoptosis of activated T cells in part via up-regulation of Fas.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
In response to antigenic stimulation, the T cell population is significantly increased in the peripheral lymphoid tissues due to clonal expansion. To maintain homeostasis, the immune system has developed mechanisms, such as activation-induced cell death (AICD)3 (1, 2), to reduce the number of significantly expanded T cells. Fas (CD95) and Fas ligand (FasL, CD95L)-mediated apoptosis play an important role in deleting clonally expanded T cells that are no longer useful, as mice-deficient in Fas or FasL show defects in peripheral T cell deletion (3, 4) and eventually develop autoimmune disorders (5, 6, 7). In addition, FasL-induced apoptosis has been shown to protect immune privileged sites from cellular immune-mediated damage (8, 9). AICD is typically represented by the deletion of Vβ8+ T cells in mice challenged with superantigens, such as staphylococcal enterotoxin B (SEB) (10). Fas and FasL are up-regulated in response to SEB stimulation, and then interact with each other to induce T cell apoptosis. By binding to the MHC class II molecules of APCs, SEB induces the initial expansion phase of Vβ8+ T cells, which is followed by a deletion phase. The Vβ8+ T cell deletion phase, but not the expansion phase, is defective in Fas-deficient lpr or FasL-deficient gld mice (3, 11).

The Wnt/β-catenin pathway regulates multiple functions, ranging from stem cell regeneration to the organogenesis of the kidney and reproductive systems (12). T cell factor (TCF) is the ultimate mediator of the Wnt/β-catenin signaling pathway (13). Mechanisms for β-catenin-mediated activation of TCF have been demonstrated. Without Wnt signaling, β-catenin is phosphorylated by glycogen synthase-3β, and is targeted for ubiquitination and degradation by 26S proteosome (14). In the absence of β-catenin, TCF associates with a transcriptional repressor, Groucho-related gene (GRG) in mouse (Groucho in Drosophila or transducin-like enhancer (TLE) in human), and inhibits target gene expression (15). Activation of Wnt signaling leads to the inactivation of glycogen synthase-3β and the stabilization and accumulation of β-catenin. Accumulated β-catenin, a transcriptional coactivator, then replaces GRG binding to TCF, resulting in the activation of target genes.

Previously we have shown that transgenic expression of stabilized β-catenin (β-catTg) protects CD4+CD8+ thymocytes from spontaneous apoptosis by specifically up-regulating Bcl-xL in this subset of thymocytes (16). These results were consistent with the role of TCF-1 in the survival of the CD4+CD8+ thymocytes (17, 18). Although the role of the β-catenin/TCF pathway in the regulation of developing T cells has been extensively studied (19, 20, 21, 22, 23, 24), less is known about the role of the β-catenin pathway in the regulation of peripheral T cell function. In this study, we showed that T cells from β-catTg mice were more susceptible to Fas-induced apoptosis as well as AICD, most likely via the up-regulation of Fas expression.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Mice

β-cattg mice used in this study have been previously described (16). Mice were housed at the specific pathogen-free animal facility of the Biological Resource Laboratory of the University of Illinois at Chicago, following university guidelines. Wild-type (WT) C57BL/6 mice were purchased from The Jackson Laboratory.

Plasmids

The Fas-luciferase reporter was a gift from Drs. Kleinerman and Koshkina (M. D. Anderson Cancer Institute, Houston, Texas). Topflash (TOP) and fopflash (FOP) reporters were gifts from Dr. P. Howe (Lerner Research Institute, Cleveland Clinic Foundation, Cleveland, OH). WT and stabilized β-catenin expression plasmids were provided by Drs. F. McCormick and O. Tetsu (University of California, San Francisco, CA). TCF-1 expression plasmid was provided by Dr. H. Clevers (Hubrecht Laboratory, Center for Biomedical Genetics, Utrecht, The Netherlands). The following primers were used to generate the potential TCF-binding site mutant Fas-luciferase reporter:

1) GGATGAACAGTGGGCTAAGTTCAGGGTTATTAATGTGTTA TTAATG.

2) CAGAGCTTGGTGGACGATGCTTCAGGAATACTGAAACCTT TAGTG.

3) AAGAGTGACACACAGGTGTTTTCAGACGCTTCTGGGGAGT GAGGGA.

4) GATTTGGCTTAAGTTGTTAGCTGAATTTTCCTCTTGAGAAA TAAAAAC.

5) CTAAGAGCTATCTACCGTTCTTCAGCAATAGTGACTGAAA ACAGTGTTCACCAGAGCA.

Isolation of CD4+ T cells

T cells were isolated from spleens of 8–12-wk-old mice as follows: single-cell suspensions were made by crushing spleen through a cell strainer, and RBCs were lysed with a RBC lysis buffer. CD4+ cells were then purified using MACS magnetic cell column with a CD4+ isolation kit (Miltenyi Biotec) following manufacturer’s protocol. CD4+ T cell purity was >90% determined by flow cytometry analysis.

Abs and flow cytometry analysis

Cells were stained with indicated Abs in PBS supplemented with 1% FCS (30 min. on ice), then washed and analyzed on a Dako Colorado Cyan caliber with Summit V4.3 software. Abs used for flow cytometry analyses were obtained from BD Pharmingen and include: anti-CD4-FITC and -PE (GK1.3), anti-Vβ8-Biotin, anti-Vβ6-biotin (RR4–7), anti-Fas (Jo2), anti-FasL biotin (ML3), streptavidin-PE, streptavidin-PE-Cy5, and streptavidin-PE-Cy7. Anti-CD69-PE-Cy7 was from eBioscience. An isotype-matched control Ab was used as a negative control for background staining.

SEB-induced deletion of T cells in vivo

For SEB-mediated deletion experiments, SEB (100 µg; Sigma-Aldrich) was injected i.p. into 8–12-wk-old mice. Four to six mice were sacrificed at days 1, 2, 3, 6, 9, and 12, and single-cell suspensions were made by crushing spleens through a cell strainer. After lysis of RBC, cells were stained with anti-Vβ8-biotin or anti-Vβ6-biotin and anti-CD4-PE. Live CD4 cells (2 x 105) were collected, and the percentage of CD4 cells expressing Vβ8 or Vβ6 was determined by flow cytometry.

In vitro activation and apoptosis

SEB (100 µg; Sigma-Aldrich) was injected i.p. into 8–12 wk old mice, that were then sacrificed the following day. Single-cell suspensions were made as described above. Following RBC lysis, CD4+ T cells were isolated using a CD4+ isolation kit (Miltenyi Biotec). Spleen cells (3 x 106) were cultured (5 days in 6-well plates) in fresh medium containing IL-2 (5 ng/ml). Live cells were isolated with Histopaque-1077 (Sigma-Aldrich), and cells (5 x 104/well) were re-stimulated in 96-well plates containing different concentrations of plate-bound anti-CD3 or anti-Fas Ab for different time periods. Cell cultures were supplemented with IL-2 (5 ng/ml) and IL-15 (100 ng/ml) to prevent spontaneous apoptosis. Cells were then harvested and washed once with ice-cold PBS supplemented with 1% FCS. Cell pellets were stained with anti-Vβ8-PE, annexin V, and 7-AAD (BD Biosciences) following the manufacturer’s protocol. Analyses were performed on a FACS-caliber (BD Biosciences) with CELLQuest software. To analyze Fas-mediated apoptosis, purified CD4+ T cells (3 x 105) were re-stimulated with 1 or 10 µg/ml of plate-bound anti-Fas Ab. The percentage of apoptotic CD4+Vβ8+ T cells was determined as described.

Chromatin immunoprecipitation (ChIP) assays

Rabbit polyclonal anti-β-catenin Ab was purchased from Santa Cruz Biotechnology, and salmon sperm DNA and protein G-agarose from Upstate Biotechnology. The ChIP procedure was performed according to the manufacturer’s instructions (5 x 106 cells/assay). An input sample (10%) was used as a template for control PCR. Primer sequences were: GCAGAGCTTGGTGGACGATG (Fas-promoter sense strand) and TCACTATTGCTTTGGAACGGTAGA (Fas-promoter anti-sense strand).

Cell culture, transient transfection, and reporter assay

Jurkat cells were cultured in RPMI 1640 medium supplemented with 10% FBS, glutamine (2 mM), sodium pyruvate (1 mM), 2-ME (50 µM), penicillin (100 U/ml), and streptomycin (100 µg/ml). Cells (1 x 107 in 0.4 ml of serum-free RPMI 1640 medium) were transfected with the reporter plasmid (2 µg), Renilla luciferase control vector (0.5 µg, pRL-TK from Promega), and expression vector (30 µg) by electroporation (250 V, 950 uF). The total amount of transfected DNA was kept constant by adjusting the amount of the control plasmid. Following electroporation, cells were incubated (10 min at room temperature), transferred into growth medium (10 ml), incubated (37°C, 5% CO2, 40–48 h), and dual luciferase assays were performed using the Dual-Luciferase Reporter Assay system (Promega) according to the manufacturer’s instructions.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Deletion of Vβ8+CD4+ T cells was accelerated in β-catTg mice

β-catTg mice were previously generated in our laboratory by targeting a stabilized β-catenin to the T cell compartments by a CD4 promoter (16). To further elucidate the role of transgenic β-catenin in the activation-induced deletion of peripheral T cells in vivo, WT and β-catTg mice were challenged with a superantigen, SEB, a widely used reagent to study Ag-induced responses in vivo. SEB specifically stimulates T cells with TCRs containing the Vβ8 element. Indeed, compared with control nontreated mice (Fig. 1a, top panel), CD69, a T cell activation marker, was up-regulated on Vβ8+CD4+ T cells of both WT (gray area) and β-catTg mice (solid line) following the SEB challenge (Fig. 1a, bottom panel), confirming the stimulatory effects of SEB. We then monitored Vβ8+CD4+ T cells in spleens of four to six WT or β-catTg mice by flow cytometry following SEB treatment (100 µg) (Fig. 1b). As previously reported (11, 25), SEB treatment of WT mice (dashed line) resulted in a rapid increase (expansion phase) of Vβ8+CD4+ T cells from ~20 to 35% within 3 days. The expansion phase was followed by a decrease (deletion phase) in the percentage of Vβ8+CD4+ T cells, leading to the reduction of the Vβ8+CD4+ T cells to ~20%. Similar trends in the expansion phase were initially observed with β-catTg mice (solid line). However, the Vβ8+CD4+ T cell deletion phase began at an earlier time point (by the second day). Additionally, while WT and β-catTg mice had similar levels of Vβ8+CD4+ T cells before SEB treatment, β-catTg mice had consistently lower levels of Vβ8+CD4+ T cells during the deletion phase. As expected, no differences between WT (dashed line) or β-catTg mice (solid line) were noted in the levels of the negative control Vβ6+CD4+ T cells. These data confirmed the specific stimulatory effects of SEB on Vβ8+ cells, and suggested that stabilized β-catenin promoted SEB-induced T cell deletion.


Figure 1
View larger version (16K):
[in this window]
[in a new window]

 
FIGURE 1. β-catTg accelerated the deletion of Vβ8+CD4+ T cells. WT and β-catTg mice were injected i.p. with 100 µg of SEB. Vβ8+CD4+ and Vβ6+CD4+ subsets of T cells were then analyzed by flow cytometry. a, CD69 levels on Vβ8+CD4+ T cells were compared between WT (gray area) and β-catTg mice (solid black line) before (none) and 2 days after challenging the mice with SEB. b, WT (dashed line) and β-catTg (solid line) mice were challenged with 100 µg of SEB. The percentage of Vβ8+CD4+ (two top lines) and Vβ6+CD4+ (two bottom lines) T cells was determined by flow cytometry at 0, 1, 2, 3, 6, 9, and 12 days after challenging the mice.

 
β-catTg enhanced Fas up-regulation

Fas/FasL-mediated apoptosis plays a critical role in SEB-induced deletion of T cells, as SEB-mediated T cell deletion is defective in Fas- or FasL-deficient mice (3, 11). We therefore examined surface Fas and FasL expression after SEB treatment by flow cytometry (Fig. 2). In the absence of SEB stimulation (none), we observed a slight, albeit consistently higher levels of Fas on T cells from β-catTg mice (mean fluorescence intensity (MFI), 10.53, solid line) compared with WT (MFI, 9.86, gray area) (Fig. 2a, top panel). In agreement with previous reports (26, 27), SEB treatment resulted in the up-regulation of Fas levels (Fig. 2a, bottom panel), with significantly higher levels observed in T cells from β-catTg mice (MFI, 23.38) compared with WT (MFI, 16.51). Similar results were observed following T cell stimulation with anti-CD3 and CD28 Abs in vitro, with significantly higher surface Fas (MFI, 46.24) noted in β-catTg mice compared with WT T cells (MFI, 20.62) (Fig. 2b, bottom panel).


Figure 2
View larger version (24K):
[in this window]
[in a new window]

 
FIGURE 2. β-catTg promoted the up-regulation of Fas. a, Comparison of surface expression of Fas on Vβ8+CD4+ T cells between WT (gray area) and β-catTg mice (solid black line) before (none) and 2 days after challenging the mice with SEB. b, Comparison of surface expression of Fas on Vβ8+CD4+ T cells between WT (gray area) and β-catTg mice (solid black line) before (none) and after stimulating the T cells with anti-CD3 and CD28 Abs (CD3/28). c, Comparison of surface expression of FasL on Vβ8+CD4+ T cells between WT (gray area) and β-catTg mice (solid black line) before (none) and 2 days after challenge with SEB. d, Comparison of surface expression of FasL on Vβ8+CD4+ T cells between WT (gray area) and β-catTg mice (solid black line) before (none) and after stimulating T cells with anti-CD3 and CD28 Abs (CD3/28) (n = 3).

 
We further investigated surface FasL levels by flow cytometry. Our data showed that there were no significant differences between WT and β-catTg T cells prior or subsequent to SEB challenge (Fig. 2c) or CD3/28 stimulation (Fig. 2d), suggesting the specificity of stabilized β-catenin in Fas stimulation. These data further suggested that the observed enhanced deletion of Vβ8+CD4+ in the β-catTg mice was not likely due to the different FasL expression. Altogether, these results clearly demonstrated that transgenic expression of a stabilized β-catenin specifically enhanced the up-regulation of Fas.

β-catTg potentiated T cells for Fas-mediated apoptosis

Given that up-regulation of Fas is a critical step in potentiating T cells for apoptosis, we investigated the effects of β-catTg on Fas-mediated apoptosis. T cells obtained from WT and β-catTg mice were cultured in medium for different times, and the spontaneous apoptotic cells were then detected with annexin V and 7-AAD (Fig. 3a) as we described previously (28, 29). No obvious differences in spontaneous apoptosis were observed between WT and β-catTg T cells, suggesting that β-catTg did not affect spontaneous survival of T cells. We next examined Fas-mediated apoptosis as we described previously (29) (Fig. 3b). Activation of naive T cells is required to potentiate the cells for Fas-induced apoptosis. Vβ8+CD4+ T cells were activated by SEB treatment as described in Fig. 1, and activated T cells were then expanded for 5 days in medium containing IL-2. Apoptosis was then induced by crosslinking with different concentrations of anti-Fas Ab (Fig. 3b) in the presence of IL-2 and IL-15 so as to prevent cytokine withdrawal-induced apoptosis as described next. Although there was no significant difference in the apoptosis of Vβ8+CD4+ T cells between WT and β-catTg mice in untreated cells (none), there was a significantly increase in the number of apoptotic cells detected in T cells from β-catTg mice compared with WT mice, even when crosslinked with a relatively lower concentration of anti-Fas Ab (1 µg/ml). This effect was dose-dependent, as increased concentrations of anti-Fas Ab treatment (10 µg/ml) resulted in significantly greater differences in T cell apoptosis between β-catTg and the WT. These results strongly suggested that β-catTg promoted Fas-mediated apoptosis.


Figure 3
View larger version (23K):
[in this window]
[in a new window]

 
FIGURE 3. β-catTg potentiated Fas-mediated apoptosis. a, Spontaneous apoptosis. T cells from WT ({square}) and β-catTg ({blacksquare}) mice were cultured in medium for different times, and apoptotic cells were detected by annexin V and 7-AAD. b, Apoptosis-induced by crosslinking Fas. T cells obtained from SEB-challenged WT ({square}) and β-catTg ({blacksquare}) mice were expanded in IL-2 for 5 days. Apoptosis was then induced using different concentrations of anti-Fas Ab (µg/ml). Apoptotic Vβ8+CD4+ T cells were analyzed as previously described (Materials and Methods). c, Increased cytokine withdrawal-induced apoptosis in β-catTg T cells. T cells obtained from SEB-challenged WT ({square}) and β-catTg ({blacksquare}) mice were expanded in IL-2 for 5 days. T cells were then cultured in the absence or presence of different cytokines as indicated; apoptotic cells were detected after 24 h. (n = 3).

 
T cell survival is dependant on IL-2 and IL-15, as the absence of these cytokines results in apoptosis. Cytokine withdrawal-induced apoptosis is believed to contribute to SEB-induced depletion of T cells (30, 31). We thus investigated the effects of β-catTg on cytokine withdrawal-induced apoptosis (Fig. 3c). T cells activated by SEB-treatment were first expanded in IL-2, and then cultured in medium in the absence or presence of IL-2, IL-15, or IL-7. Although the absence of cytokines (none) resulted in an increased number of apoptotic β-catTg T cells compared with WT, apoptosis was inhibited by cytokines, especially with combinations of IL-2 and IL-15 or IL-7. These results suggested that cytokine withdrawal-induced apoptosis likely contributed to the enhanced depletion of T cells observed in β-catTg mice.

β-catTg potentiated T cells for AICD

Activated T cells undergo AICD upon TCR restimulation. Given that Fas/FasL-mediated apoptosis plays an essential role in AICD (2), we compared AICD in T cells obtained from WT and β-catTg mice. T cells obtained from SEB-challenged mice were stimulated, or not (none), with anti-CD3 Ab (Fig. 4b). Consistent with previous findings (Fig. 3a), no obvious differences in the apoptosis were observed between WT and β-catTg T cells in the absence of stimulation (Fig. 4a). Anti-CD3 Ab re-stimulation resulted in a significant increase in apoptosis in WT Vβ8+CD4+ T cells, in a concentration-dependent manner. Significantly more apoptotic cells were also detected in T cells from β-catTg mice compared with WT at all concentrations of anti-CD3 Ab treatment. To determine whether Fas/FasL-mediated apoptosis contributed to the differences in AICD between WT and β-catTg T cells, a blocking anti-FasL Ab (29) was used to prevent Fas-FasL interaction (Fig. 4b). The FasL blocking Ab significantly inhibited apoptosis in WT T cells as well as reduced or abrogated the differences between WT and β-catTg T cells, confirming the critical role of Fas/FasL in AICD. These data suggested that β-catTg promoted AICD via the enhancement of Fas/FasL-mediated apoptosis.


Figure 4
View larger version (24K):
[in this window]
[in a new window]

 
FIGURE 4. β-catTg potentiated AICD. a, T cells obtained from SEB-challenged WT ({square}) and β-catTg ({blacksquare}) mice were expanded in IL-2 for 5 days. Apoptosis was then induced using different concentrations of anti-CD3 Ab (µg/ml). Apoptotic Vβ8+CD4+ T cells were analyzed as described (Materials and Methods). b, Inhibition of AICD by blocking anti-FasL Ab. Apoptosis was induced by using anti-CD3 Ab (10 µg/ml) in the absence or presence of blocking anti-FasL Ab (0.05 or 1 µg/ml). c, Analysis of apoptotic proteins. T cells obtained from WT and β-catTg mice were subject to Western blot analyses with Abs against Bim, Bax, Bid, phosphorylated Bad (p-Bad), and β-catenin. Actin was used as a loading control.

 
To further elucidate the molecular mechanisms responsible for the enhanced apoptosis of β-catTg T cells, we analyzed the levels of the proapoptotic proteins, Bim, Bax, Bid, and phosphorylated Bad (Fig. 4c). β-catTg mice displayed higher β-catenin levels due to expression from the β-cat transgene. Although no differences in Bim and Bax levels were observed between WT and β-catTg mice, significantly higher levels of Bid were detected in β-catTg T cells compared with WT. In addition, increased levels of phosphorylated Bad were also observed in β-catTg T cells. Elevated levels of proapoptotic Bid and phosphorylated Bad were consistent with the observed enhanced apoptosis of β-catTg T cells.

β-catenin stimulated Fas promoter activity

One of the roles of β-catenin is to bind and activate TCF-1, a transcription factor that regulates target gene expression (13). We used a Fas-luciferase reporter (32) to determine whether β-catenin activated Fas expression by directly stimulating its promoter activity. A TOP reporter containing three TCF-binding sites was used as a positive control, whereas a FOP reporter containing three mutant TCF-binding sites was used as a negative control (Fig. 5a). The reporter, along with the expression plasmids encoding β-catenin or TCF-1, was introduced into Jurkat cells by electroporation. As expected, TCF-1, WT β-catenin and the stabilized β-catenin (similar to that used in generating the transgenic mice), greatly stimulated TOP but not FOP activity. The stabilized β-catenin, which is resistant to degradation, is more potent than the WT β-catenin in the stimulation of TOP. We next examined Fas reporter activity under the same conditions used to stimulate TOP. Our data demonstrated that WT and stabilized β-catenin, as well as TCF-1, stimulated Fas reporter (1739 bp reporter) activity, suggesting that the β-catenin/TCF pathway directly stimulated Fas promoter activity.


Figure 5
View larger version (34K):
[in this window]
[in a new window]

 
FIGURE 5. β-catenin/TCF stimulated Fas reporter. a, Jurkat cells were transfected with expression plasmids for WT β-catenin, stabilized β-catenin, or TCF-1. β-catenin-mediated transcriptional activity was monitored by a TOP reporter ({blacksquare}) (the positive control containing 3x WT TCF-binding sites) or a FOP reporter ({square}) (negative control containing 3x mutant TCF-binding sites). b, The effects of WT β-catenin, stabilized β-catenin, and TCF-1 on the Fas reporter (1739 bp) were determined by transfection (described in 5a). Luciferase activity is indicated as the fold of stimulation relative to the activity obtained from cells transfected with reporter alone. (n = 3, data presented as activity ± SD). c, Schematic representation of the Fas promoter region. Full length promoter (17393 bp) and truncated promoters, 460 bp and 240 bp, were cloned into a luciferase reporter. The potential TCF-binding sites and NF-{kappa}B-binding sites are indicated on the full length promoter. d, Deletion of the DNA fragment containing TCF-binding sites reduced Fas reporter activity. Transfection and luciferase activity was assayed with different lengths of Fas promoter reporters. e, Mutation of potential TCF-binding sites reduced Fas reporter activity. Transfection assays (see 5b) were performed, for the WT and Fas reporter, with all potential TCF-binding sites mutated. f, Fas promoter binds to β-catenin in vivo. Nuclei purified from formaldehyde-treated T cells of WT and β-catTg mice were subject to sonication. A portion of the sonicated samples was used as a positive control template (input) in PCR. Anti-β-catenin Ab (β-catenin) or control Ab (C) was then added to sonicated samples for immunoprecipitation. Targeted sequences within the Fas promoter in immunoprecipitated complexes were then identified by PCR, using specific primers (see Materials and Methods) (n = 3).

 
To further elucidate β-catenin-mediated stimulation of the Fas reporter, we searched the Fas promoter region for potential TCF-binding sites. Four TCF-binding sites were identified (Fig. 5c), one of which was very close to the transcriptional initiation site. Consequently, we obtained two truncated promoter reporters, p460 and p240, that deleted three of the most upstream TCF-binding sites. Different lengths of Fas reporters were then transfected into Jurkat cells together with expression plasmids encoding WT β-catenin, stabilized β-catenin, and TCF (Fig. 5d). Deletion of the three TCF-binding sites greatly reduced the ability of β-catenin and TCF to stimulate reporter activity. However, p460 still showed relatively high reporter activity, likely due to its two NF-{kappa}B-binding sites, as NF-{kappa}B is believed to be a positive regulator for Fas (32). Indeed, only minimal reporter activity was observed with p240, which did not contain the two NF-{kappa}B-binding sites. We further mutated all potential TCF-binding sites (1739m). A significant reduction in activity was observed in the mutant reporter, compared with the WT, following β-catenin or TCF stimulation (Fig. 5e), confirming the critical role of TCF-binding sites in the regulation of Fas promoter activity.

ChIP assays were used to further investigate whether β-catenin interacted with the Fas promoter in vivo (Fig. 5f). DNA templates not subjected to immunoprecipitation (input) were initially used to optimize PCR conditions; followed by PCR using specific anti-β-catenin or control Ab-immunoprecipitated DNA templates. In both WT and β-catTg mice, anti-β-catenin Ab (β-catenin) resulted in an enrichment band and (Fig. 5f), compared with the control Ab, strongly suggesting that β-catenin interacted with the Fas promoter in vivo.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
We have previously shown that, in contrast to WT cells, CD4+CD8+ double positive thymocytes from mice expressing a stabilized β-catenin (β-catTg) were resistant to spontaneous apoptosis as well as to glucocorticoid-induced apoptosis due to significantly increased levels of Bcl-xL (16), suggesting that β-catenin/TCF pathway can enhance thymocyte survival. In this study, we examined the effects of the stabilized β-catenin transgene on the survival of peripheral mature T cells. In the absence of stimulation, stabilized β-catenin did not affect the survival of naive T cells; however, β-catTg enhanced AICD both in vitro and in vivo. Our data demonstrated that β-catenin potentiated apoptosis in part via the promotion of Fas-mediated apoptosis, which is a critical mechanism for AICD. Fas-mediated apoptosis is largely independent of Bcl-xL, as forced expression of Bcl-xL does not prevent Fas-mediated apoptosis (33). The β-catenin pathway thus regulates the survival of both developing T cells and peripheral mature T cells, albeit by different mechanisms.

We initially observed that SEB-induced deletion of Vβ8+CD4+ T cells was accelerated in β-catTg mice, a process that was potentiated by stabilized β-catenin. Given that the deletion process is dependent on Fas/FasL-mediated apoptosis, we examined the role of transgenic β-catenin on this process. Our data support that stabilized β-catenin promotes Fas-mediated apoptosis. First, preactivated T cells from β-catTg mice were more susceptible to apoptosis-induced by crosslinking Fas. Second, T cells from β-catTg mice were more susceptible to AICD, which is dependent on Fas/FasL-mediated apoptosis. Lastly, surface Fas levels were higher on T cells from β-catTg mice. Although Fas-mediated apoptosis has been shown to play a central role in AICD, other Fas/FasL-independent mechanisms are apparently also involved in AICD, as peripheral T cell deletion is significantly reduced, but not abrogated, in mice-deficient in Fas and FasL (3, 4). Our data did not exclude the possibility that β-catenin might promote deletion of T cells via other mechanisms. Indeed, we showed that cytokine withdrawal-induced apoptosis was also enhanced in β-catTg mice. Thus, the observed differences between WT and β-catTg T cells in SEB-mediated depletion of Vβ8+ T cells likely resulted from the difference in susceptibility to Fas/FasL-mediated apoptosis, as well as to cytokine withdrawal-induced apoptosis.

Naive T cells express very low levels of Fas (34, 35). Activation of T cells results in up-regulation of Fas mRNA and protein, leading to gradual acquisition of sensitivity to Fas-mediated apoptosis (35). AICD is induced by engagement of Fas by FasL that is expressed by T cells or by nonlymphoid tissues (27). In the current study, stabilized β-catenin did not appear to have significant effects on FasL expression on T cells. However, we showed that forced expression of stabilized β-catenin promoted the up-regulation of Fas in the activated T cells, which was likely responsible for the accelerated deletion of Vβ8 T cells in β-catTg mice treated with SEB. Fas expression is regulated both at the transcriptional and post-transcriptional levels (36, 37, 38). Although we cannot exclude the possibility that β-catenin can regulate Fas expression levels by other mechanisms, our data indicated that β-catenin/TCF was able to stimulate Fas reporter activity. Furthermore, stabilized β-catenin stimulated Fas reporter more efficiently compared with that of the WT β-catenin. In addition, ChIP assays demonstrated that β-catenin was able to bind to the Fas promoter in vivo. These data strongly suggested that stabilized β-catenin up-regulated Fas, at least in part, via transcriptional activation of Fas. The β-catenin/TCF pathway is not the only pathway capable of transcriptionally stimulating the Fas promoter. Other transcription factors, such as NF-{kappa}B, have also been shown to activate Fas gene expression (36), which was confirmed, in our study, by deletion of the two potential NF-{kappa}B-binding sites. Expression of Fas was, therefore, dependent on the synergistic action of NF-{kappa}B and other trans-factors, including β-catenin/TCF.

Clonal contraction followed by clonal expansion of Ag-specific T cells is essential for preparing immune system responses against new pathogens. The Fas/FasL plays a critical role in the clonal contraction (deletion) process. In addition, Fas-mediated apoptosis of T cells also facilitates the depletion of self-reactive T cells, as mice lacking Fas or FasL not only display defective deletion of peripheral T cells (3, 4), but also develop autoimmunity (5, 6, 7). Careful control of Fas-mediated apoptosis is thus critical for normal immune system function and for the prevention of autoimmunity. Our results suggested that stimulation of the β-catenin pathway might facilitate the apoptosis of self-reactive T cell, and thus prevent T cell-mediated autoimmunity. In addition to promoting Fas-mediated apoptosis in mature T cells, the β-catenin/TCF pathway has also been shown to regulate T cell development (23, 24). Our data clearly demonstrated that β-catenin is a critical signaling molecule in the regulation of both developing and mature T cell functions.


    Acknowledgments
 
We thank Dr. Kleinerman for the Fas-Luciferase reporter, Dr. P. Howe for TOP and FOP reporters, Dr. F. McCormick and O. Tetsu for WT and stabilized β-catenin expression plasmids, and Dr. H. Clevers for TCF-1 expression plasmid.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by National Institutes of Health Grant R01-AI053147. Back

2 Address correspondence and reprint requests to Dr. Zuoming Sun, Division of Immunology, Beckman Research Institute of the City of Hope, 1500 East Duarte Road, Duarte, CA 91010. E-mail address: zsun{at}coh.org Back

3 Abbreviations used in this paper: AICD, activation-induced cell death; SEB, staphylococcal enterotoxin B; WT, wild type; TOP, Topflash; FOP, fopflash; ChIP, chromatin immunoprecipitation; MFI, mean fluorescence intensity; TCF, T cell factor. Back

Received for publication August 2, 2007. Accepted for publication March 17, 2008.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Rathmell, J. C., C. B. Thompson. 2002. Pathways of apoptosis in lymphocyte development, homeostasis, and disease. Cell 109: (Suppl.):S97-S107. [Medline]
  2. Green, D. R., N. Droin, M. Pinkoski. 2003. Activation-induced cell death in T cells. Immunol. Rev. 193: 70-81. [Medline]
  3. Singer, G. G., A. K. Abbas. 1994. The fas antigen is involved in peripheral but not thymic deletion of T lymphocytes in T cell receptor transgenic mice. Immunity 1: 365-371. [Medline]
  4. Singer, G. G., A. C. Carrera, A. Marshak-Rothstein, C. Martinez, A. K. Abbas. 1994. Apoptosis, Fas and systemic autoimmunity: the MRL-lpr/lpr model. Curr. Opin. Immunol. 6: 913-920. [Medline]
  5. Fisher, G. H., F. J. Rosenberg, S. E. Straus, J. K. Dale, L. A. Middleton, A. Y. Lin, W. Strober, M. J. Lenardo, J. M. Puck. 1995. Dominant interfering Fas gene mutations impair apoptosis in a human autoimmune lymphoproliferative syndrome. Cell 81: 935-946. [Medline]
  6. Rieux-Laucat, F., F. Le Deist, C. Hivroz, I. A. Roberts, K. M. Debatin, A. Fischer, J. P. de Villartay. 1995. Mutations in Fas associated with human lymphoproliferative syndrome and autoimmunity. Science 268: 1347-1349. [Abstract/Free Full Text]
  7. Watanabe-Fukunaga, R., C. I. Brannan, N. G. Copeland, N. A. Jenkins, S. Nagata. 1992. Lymphoproliferation disorder in mice explained by defects in Fas antigen that mediates apoptosis. Nature 356: 314-317. [Medline]
  8. Griffith, T. S., X. Yu, J. M. Herndon, D. R. Green, T. A. Ferguson. 1996. CD95-induced apoptosis of lymphocytes in an immune privileged site induces immunological tolerance. Immunity 5: 7-16. [Medline]
  9. Griffith, T. S., T. Brunner, S. M. Fletcher, D. R. Green, T. A. Ferguson. 1995. Fas ligand-induced apoptosis as a mechanism of immune privilege. Science 270: 1189-1192. [Abstract/Free Full Text]
  10. Kawabe, Y., A. Ochi. 1991. Programmed cell death and extrathymic reduction of Vβ8+ CD4+ T cells in mice tolerant to Staphylococcus aureus enterotoxin B. Nature 349: 245-248. [Medline]
  11. Scott, D. E., W. J. Kisch, A. D. Steinberg. 1993. Studies of T cell deletion and T cell anergy following in vivo administration of SEB to normal and lupus-prone mice. J. Immunol. 150: 664-672. [Abstract]
  12. Cadigan, K. M., R. Nusse. 1997. Wnt signaling: a common theme in animal development. Genes Dev. 11: 3286-3305. [Free Full Text]
  13. Hurlstone, A., H. Clevers. 2002. T-cell factors: turn-ons and turn-offs. EMBO J. 21: 2303-2311. [Medline]
  14. Aberle, H., A. Bauer, J. Stappert, A. Kispert, R. Kemler. 1997. β-catenin is a target for the ubiquitin-proteasome pathway. EMBO J. 16: 3797-3804. [Medline]
  15. Roose, J., M. Molenaar, J. Peterson, J. Hurenkamp, H. Brantjes, P. Moerer, M. van de Wetering, O. Destree, H. Clevers. 1998. The Xenopus Wnt effector XTcf-3 interacts with Groucho-related transcriptional repressors. Nature 395: 608-612. [Medline]
  16. Xie, H., Z. Huang, M. S. Sadim, Z. Sun. 2005. Stabilized β-catenin extends thymocyte survival by up-regulating Bcl-xL. J. Immunol. 175: 7981-7988. [Abstract/Free Full Text]
  17. Ioannidis, V., F. Beermann, H. Clevers, W. Held. 2001. The β-catenin–TCF-1 pathway ensures CD4+CD8+ thymocyte survival. Nat. Immunol. 2: 691-697. [Medline]
  18. Schilham, M. W., A. Wilson, P. Moerer, B. J. Benaissa-Trouw, A. Cumano, H. C. Clevers. 1998. Critical involvement of Tcf-1 in expansion of thymocytes. J. Immunol. 161: 3984-3991. [Abstract/Free Full Text]
  19. Verbeek, S., D. Izon, F. Hofhuis, E. Robanus-Maandag, H. te Riele, M. van de Wetering, M. Oosterwegel, A. Wilson, H. R. MacDonald, H. Clevers. 1995. An HMG-box-containing T-cell factor required for thymocyte differentiation. Nature 374: 70-74. [Medline]
  20. Gounari, F., I. Aifantis, K. Khazaie, S. Hoeflinger, N. Harada, M. M. Taketo, H. von Boehmer. 2001. Somatic activation of β-catenin bypasses pre-TCR signaling and TCR selection in thymocyte development. Nat. Immunol. 2: 863-869. [Medline]
  21. Xu, Y., D. Banerjee, J. Huelsken, W. Birchmeier, J. M. Sen. 2003. Deletion of β-catenin impairs T cell development. Nat. Immunol. 4: 1177-1182. [Medline]
  22. Cobas, M., A. Wilson, B. Ernst, S. J. Mancini, H. R. MacDonald, R. Kemler, F. Radtke. 2004. β-catenin is dispensable for hematopoiesis and lymphopoiesis. J. Exp. Med. 199: 221-229. [Abstract/Free Full Text]
  23. Huang, Z., H. Xie, V. Ioannidis, W. Held, H. Clevers, M. S. Sadim, Z. Sun. 2006. Transcriptional regulation of CD4 gene expression by T cell factor-1/β-catenin pathway. J. Immunol. 176: 4880-4887. [Abstract/Free Full Text]
  24. Xie, H., Z. Huang, R. Wang, Z. Sun. 2006. Regulation of thymocyte survival by transcriptional coactivators. Crit. Rev. Immunol. 26: 475-486. [Medline]
  25. Zhou, T., H. Bluethmann, J. Zhang, C. K. Edwards, III, J. D. Mountz. 1992. Defective maintenance of T cell tolerance to a superantigen in MRL-lpr/lpr mice. J. Exp. Med. 176: 1063-1072. [Abstract/Free Full Text]
  26. Ettinger, R., D. J. Panka, J. K. Wang, B. Z. Stanger, S. T. Ju, A. Marshak-Rothstein. 1995. Fas ligand-mediated cytotoxicity is directly responsible for apoptosis of normal CD4+ T cells responding to a bacterial superantigen. J. Immunol. 154: 4302-4308. [Abstract]
  27. Bonfoco, E., P. M. Stuart, T. Brunner, T. Lin, T. S. Griffith, Y. Gao, H. Nakajima, P. A. Henkart, T. A. Ferguson, D. R. Green. 1998. Inducible nonlymphoid expression of Fas ligand is responsible for superantigen-induced peripheral deletion of T cells. Immunity 9: 711-720. [Medline]
  28. Manicassamy, S., S. Gupta, Z. Huang, Z. Sun. 2006. Protein kinase C-{theta}-mediated signals enhance CD4+ T cell survival by up-regulating Bcl-xL. J. Immunol. 176: 6709-6716. [Abstract/Free Full Text]
  29. Manicassamy, S., Z. Sun. 2006. The critical role of PKC-{theta} in Fas/FasL-mediated apoptosis. J. Immunol. 178: 312-319.
  30. Hildeman, D. A., Y. Zhu, T. C. Mitchell, P. Bouillet, A. Strasser, J. Kappler, P. Marrack. 2002. Activated T cell death in vivo mediated by proapoptotic bcl-2 family member bim. Immunity 16: 759-767. [Medline]
  31. Hildeman, D. A., Y. Zhu, T. C. Mitchell, J. Kappler, P. Marrack. 2002. Molecular mechanisms of activated T cell death in vivo. Curr. Opin. Immunol. 14: 354-359. [Medline]
  32. Zhou, Z., E. A. Lafleur, N. V. Koshkina, L. L. Worth, M. S. Lester, E. S. Kleinerman. 2005. Interleukin-12 up-regulates Fas expression in human osteosarcoma and Ewing’s sarcoma cells by enhancing its promoter activity. Mol. Cancer Res. 3: 685-691. [Abstract/Free Full Text]
  33. Van Parijs, L., A. Ibraghimov, A. K. Abbas. 1996. The roles of costimulation and Fas in T cell apoptosis and peripheral tolerance. Immunity 4: 321-328. [Medline]
  34. Ju, S. T., D. J. Panka, H. Cui, R. Ettinger, M. el-Khatib, D. H. Sherr, B. Z. Stanger, A. Marshak-Rothstein. 1995. Fas(CD95)/FasL interactions required for programmed cell death after T-cell activation. Nature 373: 444-448. [Medline]
  35. Miyawaki, T., T. Uehara, R. Nibu, T. Tsuji, A. Yachie, S. Yonehara, N. Taniguchi. 1992. Differential expression of apoptosis-related Fas antigen on lymphocyte subpopulations in human peripheral blood. J. Immunol. 149: 3753-3758. [Abstract]
  36. Ouaaz, F., M. Li, A. A. Beg. 1999. A critical role for the RelA subunit of nuclear factor {kappa}B in regulation of multiple immune-response genes and in Fas-induced cell death. J. Exp. Med. 189: 999-1004. [Abstract/Free Full Text]
  37. Chan, H., D. P. Bartos, L. B. Owen-Schaub. 1999. Activation-dependent transcriptional regulation of the human Fas promoter requires NF-{kappa}B p50–p65 recruitment. Mol. Cell. Biol. 19: 2098-2108. [Abstract/Free Full Text]
  38. Aratake, K., M. Kamachi, N. Iwanaga, E. Kawasaki, Y. Izumi, H. Ida, F. Tanaka, M. Tamai, K. Arima, H. Nakamura, et al 2005. A cross-talk between RNA splicing and signaling pathway alters Fas gene expression at post-transcriptional level: alternative splicing of Fas mRNA in the leukemic U937 cells. J. Lab. Clin. Med. 146: 184-191. [Medline]



This article has been cited by other articles:


Home page
Am. J. Pathol.Home page
T. Yuasa, N. Kondo, R. Yasuhara, K. Shimono, S. Mackem, M. Pacifici, M. Iwamoto, and M. Enomoto-Iwamoto
Transient Activation of Wnt/{beta}-Catenin Signaling Induces Abnormal Growth Plate Closure and Articular Cartilage Thickening in Postnatal Mice
Am. J. Pathol., November 1, 2009; 175(5): 1993 - 2003.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Huang, Z.
Right arrow Articles by Sun, Z.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huang, Z.
Right arrow Articles by Sun, Z.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS