|
|
||||||||


* Department of Microbiology and Immunology, College of Medicine, University of Illinois, Chicago, IL 60612;
Department of Gynecology and Obstetrics, Emory University School of Medicine, Atlanta, GA 30308; and
Division of Immunology, Beckman Research Institute of the City of Hope, Duarte, CA 91010
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The Wnt/β-catenin pathway regulates multiple functions, ranging from stem cell regeneration to the organogenesis of the kidney and reproductive systems (12). T cell factor (TCF) is the ultimate mediator of the Wnt/β-catenin signaling pathway (13). Mechanisms for β-catenin-mediated activation of TCF have been demonstrated. Without Wnt signaling, β-catenin is phosphorylated by glycogen synthase-3β, and is targeted for ubiquitination and degradation by 26S proteosome (14). In the absence of β-catenin, TCF associates with a transcriptional repressor, Groucho-related gene (GRG) in mouse (Groucho in Drosophila or transducin-like enhancer (TLE) in human), and inhibits target gene expression (15). Activation of Wnt signaling leads to the inactivation of glycogen synthase-3β and the stabilization and accumulation of β-catenin. Accumulated β-catenin, a transcriptional coactivator, then replaces GRG binding to TCF, resulting in the activation of target genes.
Previously we have shown that transgenic expression of stabilized β-catenin (β-catTg) protects CD4+CD8+ thymocytes from spontaneous apoptosis by specifically up-regulating Bcl-xL in this subset of thymocytes (16). These results were consistent with the role of TCF-1 in the survival of the CD4+CD8+ thymocytes (17, 18). Although the role of the β-catenin/TCF pathway in the regulation of developing T cells has been extensively studied (19, 20, 21, 22, 23, 24), less is known about the role of the β-catenin pathway in the regulation of peripheral T cell function. In this study, we showed that T cells from β-catTg mice were more susceptible to Fas-induced apoptosis as well as AICD, most likely via the up-regulation of Fas expression.
| Materials and Methods |
|---|
|
|
|---|
β-cattg mice used in this study have been previously described (16). Mice were housed at the specific pathogen-free animal facility of the Biological Resource Laboratory of the University of Illinois at Chicago, following university guidelines. Wild-type (WT) C57BL/6 mice were purchased from The Jackson Laboratory.
Plasmids
The Fas-luciferase reporter was a gift from Drs. Kleinerman and Koshkina (M. D. Anderson Cancer Institute, Houston, Texas). Topflash (TOP) and fopflash (FOP) reporters were gifts from Dr. P. Howe (Lerner Research Institute, Cleveland Clinic Foundation, Cleveland, OH). WT and stabilized β-catenin expression plasmids were provided by Drs. F. McCormick and O. Tetsu (University of California, San Francisco, CA). TCF-1 expression plasmid was provided by Dr. H. Clevers (Hubrecht Laboratory, Center for Biomedical Genetics, Utrecht, The Netherlands). The following primers were used to generate the potential TCF-binding site mutant Fas-luciferase reporter:
1) GGATGAACAGTGGGCTAAGTTCAGGGTTATTAATGTGTTA TTAATG.
2) CAGAGCTTGGTGGACGATGCTTCAGGAATACTGAAACCTT TAGTG.
3) AAGAGTGACACACAGGTGTTTTCAGACGCTTCTGGGGAGT GAGGGA.
4) GATTTGGCTTAAGTTGTTAGCTGAATTTTCCTCTTGAGAAA TAAAAAC.
5) CTAAGAGCTATCTACCGTTCTTCAGCAATAGTGACTGAAA ACAGTGTTCACCAGAGCA.
Isolation of CD4+ T cells
T cells were isolated from spleens of 8–12-wk-old mice as follows: single-cell suspensions were made by crushing spleen through a cell strainer, and RBCs were lysed with a RBC lysis buffer. CD4+ cells were then purified using MACS magnetic cell column with a CD4+ isolation kit (Miltenyi Biotec) following manufacturers protocol. CD4+ T cell purity was >90% determined by flow cytometry analysis.
Abs and flow cytometry analysis
Cells were stained with indicated Abs in PBS supplemented with 1% FCS (30 min. on ice), then washed and analyzed on a Dako Colorado Cyan caliber with Summit V4.3 software. Abs used for flow cytometry analyses were obtained from BD Pharmingen and include: anti-CD4-FITC and -PE (GK1.3), anti-Vβ8-Biotin, anti-Vβ6-biotin (RR4–7), anti-Fas (Jo2), anti-FasL biotin (ML3), streptavidin-PE, streptavidin-PE-Cy5, and streptavidin-PE-Cy7. Anti-CD69-PE-Cy7 was from eBioscience. An isotype-matched control Ab was used as a negative control for background staining.
SEB-induced deletion of T cells in vivo
For SEB-mediated deletion experiments, SEB (100 µg; Sigma-Aldrich) was injected i.p. into 8–12-wk-old mice. Four to six mice were sacrificed at days 1, 2, 3, 6, 9, and 12, and single-cell suspensions were made by crushing spleens through a cell strainer. After lysis of RBC, cells were stained with anti-Vβ8-biotin or anti-Vβ6-biotin and anti-CD4-PE. Live CD4 cells (2 x 105) were collected, and the percentage of CD4 cells expressing Vβ8 or Vβ6 was determined by flow cytometry.
In vitro activation and apoptosis
SEB (100 µg; Sigma-Aldrich) was injected i.p. into 8–12 wk old mice, that were then sacrificed the following day. Single-cell suspensions were made as described above. Following RBC lysis, CD4+ T cells were isolated using a CD4+ isolation kit (Miltenyi Biotec). Spleen cells (3 x 106) were cultured (5 days in 6-well plates) in fresh medium containing IL-2 (5 ng/ml). Live cells were isolated with Histopaque-1077 (Sigma-Aldrich), and cells (5 x 104/well) were re-stimulated in 96-well plates containing different concentrations of plate-bound anti-CD3 or anti-Fas Ab for different time periods. Cell cultures were supplemented with IL-2 (5 ng/ml) and IL-15 (100 ng/ml) to prevent spontaneous apoptosis. Cells were then harvested and washed once with ice-cold PBS supplemented with 1% FCS. Cell pellets were stained with anti-Vβ8-PE, annexin V, and 7-AAD (BD Biosciences) following the manufacturers protocol. Analyses were performed on a FACS-caliber (BD Biosciences) with CELLQuest software. To analyze Fas-mediated apoptosis, purified CD4+ T cells (3 x 105) were re-stimulated with 1 or 10 µg/ml of plate-bound anti-Fas Ab. The percentage of apoptotic CD4+Vβ8+ T cells was determined as described.
Chromatin immunoprecipitation (ChIP) assays
Rabbit polyclonal anti-β-catenin Ab was purchased from Santa Cruz Biotechnology, and salmon sperm DNA and protein G-agarose from Upstate Biotechnology. The ChIP procedure was performed according to the manufacturers instructions (5 x 106 cells/assay). An input sample (10%) was used as a template for control PCR. Primer sequences were: GCAGAGCTTGGTGGACGATG (Fas-promoter sense strand) and TCACTATTGCTTTGGAACGGTAGA (Fas-promoter anti-sense strand).
Cell culture, transient transfection, and reporter assay
Jurkat cells were cultured in RPMI 1640 medium supplemented with 10% FBS, glutamine (2 mM), sodium pyruvate (1 mM), 2-ME (50 µM), penicillin (100 U/ml), and streptomycin (100 µg/ml). Cells (1 x 107 in 0.4 ml of serum-free RPMI 1640 medium) were transfected with the reporter plasmid (2 µg), Renilla luciferase control vector (0.5 µg, pRL-TK from Promega), and expression vector (30 µg) by electroporation (250 V, 950 uF). The total amount of transfected DNA was kept constant by adjusting the amount of the control plasmid. Following electroporation, cells were incubated (10 min at room temperature), transferred into growth medium (10 ml), incubated (37°C, 5% CO2, 40–48 h), and dual luciferase assays were performed using the Dual-Luciferase Reporter Assay system (Promega) according to the manufacturers instructions.
| Results |
|---|
|
|
|---|
β-catTg mice were previously generated in our laboratory by targeting a stabilized β-catenin to the T cell compartments by a CD4 promoter (16). To further elucidate the role of transgenic β-catenin in the activation-induced deletion of peripheral T cells in vivo, WT and β-catTg mice were challenged with a superantigen, SEB, a widely used reagent to study Ag-induced responses in vivo. SEB specifically stimulates T cells with TCRs containing the Vβ8 element. Indeed, compared with control nontreated mice (Fig. 1a, top panel), CD69, a T cell activation marker, was up-regulated on Vβ8+CD4+ T cells of both WT (gray area) and β-catTg mice (solid line) following the SEB challenge (Fig. 1a, bottom panel), confirming the stimulatory effects of SEB. We then monitored Vβ8+CD4+ T cells in spleens of four to six WT or β-catTg mice by flow cytometry following SEB treatment (100 µg) (Fig. 1b). As previously reported (11, 25), SEB treatment of WT mice (dashed line) resulted in a rapid increase (expansion phase) of Vβ8+CD4+ T cells from
20 to 35% within 3 days. The expansion phase was followed by a decrease (deletion phase) in the percentage of Vβ8+CD4+ T cells, leading to the reduction of the Vβ8+CD4+ T cells to
20%. Similar trends in the expansion phase were initially observed with β-catTg mice (solid line). However, the Vβ8+CD4+ T cell deletion phase began at an earlier time point (by the second day). Additionally, while WT and β-catTg mice had similar levels of Vβ8+CD4+ T cells before SEB treatment, β-catTg mice had consistently lower levels of Vβ8+CD4+ T cells during the deletion phase. As expected, no differences between WT (dashed line) or β-catTg mice (solid line) were noted in the levels of the negative control Vβ6+CD4+ T cells. These data confirmed the specific stimulatory effects of SEB on Vβ8+ cells, and suggested that stabilized β-catenin promoted SEB-induced T cell deletion.
|
Fas/FasL-mediated apoptosis plays a critical role in SEB-induced deletion of T cells, as SEB-mediated T cell deletion is defective in Fas- or FasL-deficient mice (3, 11). We therefore examined surface Fas and FasL expression after SEB treatment by flow cytometry (Fig. 2). In the absence of SEB stimulation (none), we observed a slight, albeit consistently higher levels of Fas on T cells from β-catTg mice (mean fluorescence intensity (MFI), 10.53, solid line) compared with WT (MFI, 9.86, gray area) (Fig. 2a, top panel). In agreement with previous reports (26, 27), SEB treatment resulted in the up-regulation of Fas levels (Fig. 2a, bottom panel), with significantly higher levels observed in T cells from β-catTg mice (MFI, 23.38) compared with WT (MFI, 16.51). Similar results were observed following T cell stimulation with anti-CD3 and CD28 Abs in vitro, with significantly higher surface Fas (MFI, 46.24) noted in β-catTg mice compared with WT T cells (MFI, 20.62) (Fig. 2b, bottom panel).
|
β-catTg potentiated T cells for Fas-mediated apoptosis
Given that up-regulation of Fas is a critical step in potentiating T cells for apoptosis, we investigated the effects of β-catTg on Fas-mediated apoptosis. T cells obtained from WT and β-catTg mice were cultured in medium for different times, and the spontaneous apoptotic cells were then detected with annexin V and 7-AAD (Fig. 3a) as we described previously (28, 29). No obvious differences in spontaneous apoptosis were observed between WT and β-catTg T cells, suggesting that β-catTg did not affect spontaneous survival of T cells. We next examined Fas-mediated apoptosis as we described previously (29) (Fig. 3b). Activation of naive T cells is required to potentiate the cells for Fas-induced apoptosis. Vβ8+CD4+ T cells were activated by SEB treatment as described in Fig. 1, and activated T cells were then expanded for 5 days in medium containing IL-2. Apoptosis was then induced by crosslinking with different concentrations of anti-Fas Ab (Fig. 3b) in the presence of IL-2 and IL-15 so as to prevent cytokine withdrawal-induced apoptosis as described next. Although there was no significant difference in the apoptosis of Vβ8+CD4+ T cells between WT and β-catTg mice in untreated cells (none), there was a significantly increase in the number of apoptotic cells detected in T cells from β-catTg mice compared with WT mice, even when crosslinked with a relatively lower concentration of anti-Fas Ab (1 µg/ml). This effect was dose-dependent, as increased concentrations of anti-Fas Ab treatment (10 µg/ml) resulted in significantly greater differences in T cell apoptosis between β-catTg and the WT. These results strongly suggested that β-catTg promoted Fas-mediated apoptosis.
|
β-catTg potentiated T cells for AICD
Activated T cells undergo AICD upon TCR restimulation. Given that Fas/FasL-mediated apoptosis plays an essential role in AICD (2), we compared AICD in T cells obtained from WT and β-catTg mice. T cells obtained from SEB-challenged mice were stimulated, or not (none), with anti-CD3 Ab (Fig. 4b). Consistent with previous findings (Fig. 3a), no obvious differences in the apoptosis were observed between WT and β-catTg T cells in the absence of stimulation (Fig. 4a). Anti-CD3 Ab re-stimulation resulted in a significant increase in apoptosis in WT Vβ8+CD4+ T cells, in a concentration-dependent manner. Significantly more apoptotic cells were also detected in T cells from β-catTg mice compared with WT at all concentrations of anti-CD3 Ab treatment. To determine whether Fas/FasL-mediated apoptosis contributed to the differences in AICD between WT and β-catTg T cells, a blocking anti-FasL Ab (29) was used to prevent Fas-FasL interaction (Fig. 4b). The FasL blocking Ab significantly inhibited apoptosis in WT T cells as well as reduced or abrogated the differences between WT and β-catTg T cells, confirming the critical role of Fas/FasL in AICD. These data suggested that β-catTg promoted AICD via the enhancement of Fas/FasL-mediated apoptosis.
|
β-catenin stimulated Fas promoter activity
One of the roles of β-catenin is to bind and activate TCF-1, a transcription factor that regulates target gene expression (13). We used a Fas-luciferase reporter (32) to determine whether β-catenin activated Fas expression by directly stimulating its promoter activity. A TOP reporter containing three TCF-binding sites was used as a positive control, whereas a FOP reporter containing three mutant TCF-binding sites was used as a negative control (Fig. 5a). The reporter, along with the expression plasmids encoding β-catenin or TCF-1, was introduced into Jurkat cells by electroporation. As expected, TCF-1, WT β-catenin and the stabilized β-catenin (similar to that used in generating the transgenic mice), greatly stimulated TOP but not FOP activity. The stabilized β-catenin, which is resistant to degradation, is more potent than the WT β-catenin in the stimulation of TOP. We next examined Fas reporter activity under the same conditions used to stimulate TOP. Our data demonstrated that WT and stabilized β-catenin, as well as TCF-1, stimulated Fas reporter (1739 bp reporter) activity, suggesting that the β-catenin/TCF pathway directly stimulated Fas promoter activity.
|
B-binding sites, as NF-
B is believed to be a positive regulator for Fas (32). Indeed, only minimal reporter activity was observed with p240, which did not contain the two NF-
B-binding sites. We further mutated all potential TCF-binding sites (1739m). A significant reduction in activity was observed in the mutant reporter, compared with the WT, following β-catenin or TCF stimulation (Fig. 5e), confirming the critical role of TCF-binding sites in the regulation of Fas promoter activity. ChIP assays were used to further investigate whether β-catenin interacted with the Fas promoter in vivo (Fig. 5f). DNA templates not subjected to immunoprecipitation (input) were initially used to optimize PCR conditions; followed by PCR using specific anti-β-catenin or control Ab-immunoprecipitated DNA templates. In both WT and β-catTg mice, anti-β-catenin Ab (β-catenin) resulted in an enrichment band and (Fig. 5f), compared with the control Ab, strongly suggesting that β-catenin interacted with the Fas promoter in vivo.
| Discussion |
|---|
|
|
|---|
We initially observed that SEB-induced deletion of Vβ8+CD4+ T cells was accelerated in β-catTg mice, a process that was potentiated by stabilized β-catenin. Given that the deletion process is dependent on Fas/FasL-mediated apoptosis, we examined the role of transgenic β-catenin on this process. Our data support that stabilized β-catenin promotes Fas-mediated apoptosis. First, preactivated T cells from β-catTg mice were more susceptible to apoptosis-induced by crosslinking Fas. Second, T cells from β-catTg mice were more susceptible to AICD, which is dependent on Fas/FasL-mediated apoptosis. Lastly, surface Fas levels were higher on T cells from β-catTg mice. Although Fas-mediated apoptosis has been shown to play a central role in AICD, other Fas/FasL-independent mechanisms are apparently also involved in AICD, as peripheral T cell deletion is significantly reduced, but not abrogated, in mice-deficient in Fas and FasL (3, 4). Our data did not exclude the possibility that β-catenin might promote deletion of T cells via other mechanisms. Indeed, we showed that cytokine withdrawal-induced apoptosis was also enhanced in β-catTg mice. Thus, the observed differences between WT and β-catTg T cells in SEB-mediated depletion of Vβ8+ T cells likely resulted from the difference in susceptibility to Fas/FasL-mediated apoptosis, as well as to cytokine withdrawal-induced apoptosis.
Naive T cells express very low levels of Fas (34, 35). Activation of T cells results in up-regulation of Fas mRNA and protein, leading to gradual acquisition of sensitivity to Fas-mediated apoptosis (35). AICD is induced by engagement of Fas by FasL that is expressed by T cells or by nonlymphoid tissues (27). In the current study, stabilized β-catenin did not appear to have significant effects on FasL expression on T cells. However, we showed that forced expression of stabilized β-catenin promoted the up-regulation of Fas in the activated T cells, which was likely responsible for the accelerated deletion of Vβ8 T cells in β-catTg mice treated with SEB. Fas expression is regulated both at the transcriptional and post-transcriptional levels (36, 37, 38). Although we cannot exclude the possibility that β-catenin can regulate Fas expression levels by other mechanisms, our data indicated that β-catenin/TCF was able to stimulate Fas reporter activity. Furthermore, stabilized β-catenin stimulated Fas reporter more efficiently compared with that of the WT β-catenin. In addition, ChIP assays demonstrated that β-catenin was able to bind to the Fas promoter in vivo. These data strongly suggested that stabilized β-catenin up-regulated Fas, at least in part, via transcriptional activation of Fas. The β-catenin/TCF pathway is not the only pathway capable of transcriptionally stimulating the Fas promoter. Other transcription factors, such as NF-
B, have also been shown to activate Fas gene expression (36), which was confirmed, in our study, by deletion of the two potential NF-
B-binding sites. Expression of Fas was, therefore, dependent on the synergistic action of NF-
B and other trans-factors, including β-catenin/TCF.
Clonal contraction followed by clonal expansion of Ag-specific T cells is essential for preparing immune system responses against new pathogens. The Fas/FasL plays a critical role in the clonal contraction (deletion) process. In addition, Fas-mediated apoptosis of T cells also facilitates the depletion of self-reactive T cells, as mice lacking Fas or FasL not only display defective deletion of peripheral T cells (3, 4), but also develop autoimmunity (5, 6, 7). Careful control of Fas-mediated apoptosis is thus critical for normal immune system function and for the prevention of autoimmunity. Our results suggested that stimulation of the β-catenin pathway might facilitate the apoptosis of self-reactive T cell, and thus prevent T cell-mediated autoimmunity. In addition to promoting Fas-mediated apoptosis in mature T cells, the β-catenin/TCF pathway has also been shown to regulate T cell development (23, 24). Our data clearly demonstrated that β-catenin is a critical signaling molecule in the regulation of both developing and mature T cell functions.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by National Institutes of Health Grant R01-AI053147. ![]()
2 Address correspondence and reprint requests to Dr. Zuoming Sun, Division of Immunology, Beckman Research Institute of the City of Hope, 1500 East Duarte Road, Duarte, CA 91010. E-mail address: zsun{at}coh.org ![]()
3 Abbreviations used in this paper: AICD, activation-induced cell death; SEB, staphylococcal enterotoxin B; WT, wild type; TOP, Topflash; FOP, fopflash; ChIP, chromatin immunoprecipitation; MFI, mean fluorescence intensity; TCF, T cell factor. ![]()
Received for publication August 2, 2007. Accepted for publication March 17, 2008.
| References |
|---|
|
|
|---|
-mediated signals enhance CD4+ T cell survival by up-regulating Bcl-xL. J. Immunol. 176: 6709-6716.
in Fas/FasL-mediated apoptosis. J. Immunol. 178: 312-319.
B in regulation of multiple immune-response genes and in Fas-induced cell death. J. Exp. Med. 189: 999-1004.
B p50–p65 recruitment. Mol. Cell. Biol. 19: 2098-2108.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |