The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

The Journal of Immunology, 2007, 179, 6064 -6071
Copyright © 2007 by The American Association of Immunologists, Inc.
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow A correction has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schrader, C. E.
Right arrow Articles by Stavnezer, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schrader, C. E.
Right arrow Articles by Stavnezer, J.

Activation-Induced Cytidine Deaminase-Dependent DNA Breaks in Class Switch Recombination Occur during G1 Phase of the Cell Cycle and Depend upon Mismatch Repair1

Carol E. Schrader2,*, Jeroen E. J. Guikema*, Erin K. Linehan*, Erik Selsing{dagger} and Janet Stavnezer2,*

* Department of Molecular Genetics and Microbiology, Program in Immunology and Virology, University of Massachusetts Medical School, Worcester, MA 01655; and {dagger} Genetics Program and the Department of Pathology, Tufts University School of Medicine, Boston, MA 02111


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Ab class switching occurs by an intrachromosomal recombination and requires generation of double-strand breaks (DSBs) in Ig switch (S) regions. Activation-induced cytidine deaminase (AID) converts cytosines in S regions to uracils, which are excised by uracil DNA glycosylase (UNG). Repair of the resulting abasic sites would yield single-strand breaks (SSBs), but how these SSBs are converted to DSBs is unclear. In mouse splenic B cells, we find that AID-dependent DSBs occur in Sµ mainly in the G1 phase of the cell cycle, indicating they are not created by replication across SSBs. Also, G1 phase cells express AID, UNG, and mismatch repair (MMR) proteins and possess UNG activity. We find fewer S region DSBs in MMR-deficient B cells than in wild-type B cells, and still fewer in MMR-deficient/SµTR–/– B cells, where targets for AID are sparse. These DSBs occur predominantly at AID targets. We also show that nucleotide excision repair does not contribute to class switching. Our data support the hypothesis that MMR is required to convert SSBs into DSBs when SSBs on opposite strands are too distal to form DSBs spontaneously.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Antibody class switch recombination (CSR)3 involves the replacement of the IgM C region gene (Cµ) by a downstream C region gene, e.g., C{gamma}, C{alpha}, or C{epsilon}, and can improve the efficacy of the immune response. The recombination occurs via the formation of double-strand breaks (DSBs) in switch (S) region DNA located upstream of the C region genes, and the joining of two different S regions by an end-joining mechanism, resulting in deletion of the intervening DNA from the genome (1). CSR requires activation induced cytidine deaminase (AID), which converts cytosines in DNA to uracils (2, 3, 4, 5, 6, 7). The target for AID is ssDNA, which can be generated during transcription, and only transcriptionally active S regions undergo CSR (1, 4, 8, 9, 10). S regions consist of tandem repeats (TR) that are unique to each isotype, although all contain numerous targets for AID: the hot-spot motif WRC/GYW, where W = A or T, R = G or A, and Y = C or T (6, 11, 12). The underlined C is determinated by AID.

Repair of the dU residues resulting from AID activity leads to DNA breaks necessary for recombination. Uracil in DNA is removed by uracil DNA glycosylase (UNG) and CSR is severely reduced in mice that lack UNG and in patients with mutations in UNG (13, 14). UNG activity generates abasic sites that could be recognized and cleaved by AP endonucleases (APE) to create single-strand breaks (SSBs), and recent data indicate that APE is important for CSR (53). AID- and UNG-dependent DSBs have been detected in S regions, and the breaks occur preferentially at G:C bp in AID hot-spot motifs, which is consistent with cleavage by APE at the nucleotide deaminated by AID (14, 15, 16, 17). The current data support the conclusion that repair of the dU residues generates SSBs, but SSBs must be converted to DSBs to excise the DNA segment intervening between Sµ and the downstream S region.

Currently, nothing is known about the mechanism by which SSBs in S regions become DSBs. In this study, we test three hypotheses regarding how DSBs are created during CSR. SSBs initiated by AID activity could be converted into DSBs during replication, when the elongating DNA strand reaches a nick on the template strand. However, {gamma}H2AX and Nbs-1, two proteins involved in CSR, are found associated with the IgH locus during G1/early S phase, but not during S/G2M phase in splenic B cells undergoing CSR (18). To address this issue, we analyzed the cell cycle regulation of DSBs in S regions, with emphasis on separation of G1 phase from S phase cells.

Nucleotide excision repair (NER) could recognize a variety of damage intermediates resulting from AID activity and could introduce DNA breaks with its associated endonucleases Ercc1-Xeroderma pigmentosum F (XPF) and XPG (19). A minor role for Ercc1 in CSR has been described (20), but it is not known whether Ercc1-XPF acts during CSR in conjunction with the NER pathway or independently as a structure-specific endonuclease. We tested whether XPA, which is essential for NER, is involved in CSR.

Nicks sufficiently close (<5 bp apart) on opposite strands can form DSBs spontaneously, as shown by experiments in which the restriction enzyme I-Sce1 can produce a chromosomal DSB (21). However, distal SSBs will not lead to DSBs, due to stability of the DNA duplex, unless the DNA ends are processed. AID is known to deaminate dC nucleotides on both the transcribed and nontranscribed strands (22, 23), and the density of AID hot spots occurring in the S region TRs could lead to nicks on opposite strands in close proximity to each other. However, deletion of the SµTR region results in only a modest (2-fold) reduction in CSR (24). CSR can occur upstream of, as well as within, the SµTR region (25, 26), although recombination outside of the SµTRs requires the DNA mismatch repair (MMR) pathway (26, 27). In fact, CSR is nearly ablated in SµTR–/– B cells that also lack the MMR proteins Msh2 or Mlh1 (28) (J. Eccleston, C. E. Schrader, J. Stavnezer, and E. Selsing, manuscript in preparation). Because MMR is required for recombination outside the SµTR region where AID hot spots are relatively infrequent, we have proposed that MMR is needed to convert SSBs into DSBs when the single-strand nicks are too far apart to form spontaneous DSBs (29). This hypothesis is consistent with the finding that CSR does not require MMR, but is reduced 2- to 5-fold in MMR-deficient B cells, i.e., at least 50% of CSR events require MMR, depending on the isotype (27, 30, 31, 32, 33, 34). To test this hypothesis, we analyzed Sµ DSBs in B cells from mice deficient in MMR proteins that have the WT Sµ region or the SµTR deletion. Altogether, the data support the hypothesis that distal SSBs are converted by MMR into DSBs, constituting an important step in CSR.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Mice

AID-deficient mice were obtained from T. Honjo (Kyoto University, Kyoto, Japan). Msh2-deficient mice were obtained from T. Mak (University of Toronto, Toronto, Canada). Mlh1- and Pms2-deficient mice were obtained from R. M. Liskay (Oregon Health Sciences University, Portland, OR). XPA-deficient mice were obtained from H. van Steeg (National Institute of Health, Bilthoven, The Netherlands) (35). These lines have all been extensively backcrossed to C57BL/6. xpa+/– mice were bred to ung+/– mice (obtained from D. Barnes and T. Lindahl, London Research Institute, London, U.K.) to generate doubly heterozygous mice, the breeding of which generated wild-type (WT), xpa–/–, ung–/–, and xpa–/– ung–/– littermates used for the experiment shown in Fig. 3. SµTR+/– mice were bred to mlh1+/– and to msh2+/– mice to generate double knockouts. WT (+/+) littermates from MMR-deficient mice were used as controls for all experiments (except that shown in Fig. 3) and the results were identical for all WT littermates. All mice were housed in the same room of the Institutional Animal Care and Use Committee-approved specific pathogen-free facility at University of Massachusetts Medical School and were bred and used under guidelines formulated by the University of Massachusetts Animal Care and Use Committee.


Figure 3
View larger version (37K):
[in this window]
[in a new window]

  		FIGURE 3. CSR is not reduced in XPA-deficient B cells. A and B, Cells from xpa–/– mice were cultured for 4 days with LPS and cytokines to induce switching to the indicated isotypes and cells were analyzed by flow cytometry for surface Ig. Data from four experiments were normalized to the percent of switching by B cells from WT littermates (shown as 100%) and the average ± SEM is shown. B and C, Examples of flow cytometric analyses for CSR to IgG1 (B) and IgG2a (C). Switching to all four IgG isotypes and IgA were also analyzed with similar results. All mice used were littermates with the exception of aid–/–.

 
B cell isolation and culture

Spleen cells were dispersed and RBCs lysed in Gey’s solution followed by T cell depletion with a mixture of anti-T cell Abs, as described previously (30). Cells were cultured at 1 x 105/ml in 6-well plates and activated to induce CSR. All cultures contained LPS (50 µg/ml; Sigma-Aldrich) and human BLyS (100 ng/ml), Human Genome Sciences. IL-4 (800 U/ml) was added to induce switching to IgG1; IFN-{gamma} (10 U/ml) for IgG2a; dextran sulfate (30 µg/ml; Amersham Biosciences) for IgG2b; anti-{delta}-dextran (0.3 ng/ml) for IgG3, and to induce IgA switching, TGF-beta (2 ng/ml), IL-4 (800 U/ml), IL-5 (1.5 ng/ml; BD Biosciences), and anti-{delta}-dextran (0.3 ng/ml) were added. Fixing of cells and staining of cell surface Abs were performed as described previously (30), except the results were analyzed by FlowJo software.

Cell cycle sorting

Splenic B cells were cultured for 2 days as described above, after which cell density was adjusted to 1 x 106 cells/ml and stimulated B cells were incubated for 90 min at 37°C with 3.5 µg/ml Hoechst 33342 (Invitrogen Life Technologies) in HBSS containing 1% FCS. Cells were finally resuspended in 1 ml of HBSS with 1% FCS; 7-aminoactinomycin D was added (0.6 µg/ml) and cells were sorted by flow cytometry based on DNA content using a UV laser-equipped FACSVantage SE (BD Biosciences).

Western blotting

To prepare nuclear extracts, cells were resuspended in hypotonic buffer (10 mM HEPES (pH 8), 1 mM EDTA, 10 mM KCl, 0.1 mM EGTA, 1 mM DTT, 2 µM pepstatin, and complete protease inhibitor mixture); after a 15-min incubation on ice, cells were lysed by addition of Nonidet P-40 to a final concentration of 0.625%. After centrifugation at 12,000 rpm in a microfuge for 10 min, the pelleted nuclei were washed once with hypotonic buffer and resuspended in hypertonic buffer (20 mM HEPES (pH 8), 1 mM EDTA, 400 mM NaCl, 1 mM EGTA, 1 mM DTT, 2 µM pepstatin, and complete protease inhibitor mixture). Protein content of nuclear extracts was determined using the Bradford assay (Bio-Rad). Proteins were electrophoresed on 10% SDS-polyacrylamide gels or 4–20% gradient SDS-polyacrylamide gels (Bio-Rad), and blotted onto Immobilon-P polyvinylidene fluoride membranes (Millipore). Immunoblotting was performed using rabbit polyclonal Abs against AID and UNG (rabbit anti-peptide amino acids 280–295 from mouse UNG), APE1 (36), MSH2 (sc-494), MSH6 (sc-10798), MLH1(sc-582), and GAPDH (Santa Cruz Biotechnology), and monoclonal mouse anti-TBP1 (Abcam) followed by goat-anti-rabbit or donkey anti-mouse-HRP (Santa Cruz Biotechnology) and ECL substrate (Pierce).

UNG assay

Whole cell extracts were prepared from splenic B cells activated for 2 days, washed in ice-cold PBS, and lysed in buffer I (10 mM Tris-HCl (pH 7.8), 200 mM KCl with Complete protease inhibitors (Roche)). An equal volume of buffer II was added (buffer I with 2 mM EDTA, 40% glycerol, 0.2% Nonidet P-40, and 2 mM DTT added) before tumbling for 1 h at 4°C. Supernatants were stored at –80°C. Nuclear extracts were made from sorted cells by lysis in buffer A (10 mM HEPES (pH 8), 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, 0.5 mM PMSF, 2 µM pepstatin, and Complete protease inhibitor) with 0.625% Nonidet P-40. Nuclei were pelleted and extracted with buffer C (20 mM HEPES (pH 8), 400 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 40% glycerol, 0.5 µM pepstatin, and Complete protease inhibitor). Extracts were incubated with a [32P]5' end-labeled uracil-containing oligonucleotide (5'-GATTCCCCATCTCCTCAGTTTCACT/ideoxyU/CTGCACCGCATG-3'; IDT) in BER buffer (40 mM HEPES-KOH (pH 7.8), 5 mM MgCl2, 0.5 mM DTT, 0.1 mM EDTA, 2 mM NaVO4, 50 mM NaF, 25 mM beta-glycerophosphate, 2 mM sodium pyrophosphate) at 37°C. After 1 h, NaOH was added to 0.1 M and reactions were heated to 95°C for 7 min and electrophoresed on an 8 M urea, 15% polyacrylamide bis (19:1) gel.

Genomic DNA preparation and linker ligation-mediated PCR (LM-PCR)

After culture for 2 days, viable cells were isolated by flotation on Ficoll/Hypaque gradients ({rho} = 1.09), or lympholyte (Cedarlane Laboratories), cells were imbedded in low-melt agarose, and DNA was isolated and used for LM-PCR as described (15). Briefly, DNA was ligated overnight to linker, which was prepared by annealing 5 nM each of LMPCR.1 (5'-GCGGTGACCCGGGAGATCTGAATTC-3') and LMPCR.2 (5'-GAATTCAGATC-3') in 300 µl of 1x ligase buffer, resulting in a double-stranded oligo with a 14-nt single-strand overhang that ligates unidirectionally. Ligated DNA samples were assayed for GAPDH by PCR to adjust DNA input before LM-PCR. The primer 5' Sµ (5'-GCAGAAAATTTAGATAAAATGGATACCTCAGTGG-3') was then used in conjunction with linker primer (LMPCR.1) to amplify DNA breaks. Three-fold dilutions of input DNA were amplified by HotStar Taq (Qiagen). PCR products were run on 1.25% agarose gels and vacuum blotted (VacuGene XL; Pharmacia) onto nylon membranes (GeneScreen Plus; PerkinElmer). Blots were hybridized at 37°C overnight with an Sµ -specific oligonucleotide probe (µ probe, 5': AGGGACCCAGGCTAAGAAGGCAAT) end labeled with [{gamma}-32P]ATP and washed at 55°C with 2x SSC/0.1% SDS.

Cloning, identification, and sequence analysis of PCR products

LM-PCR products were cloned into the vector pCR4-TOPO (Invitrogen Life Technologies) and sequenced by Macrogen using T3 and T7 primers. Cloned breaks in Sµ were aligned with germline Sµ sequenced from C57BL/6 chromosome 12 (GenBank Accession number AC073553) with numbering starting at nt 136,645. This is the 5' Sµ primer-binding site and ~800 nt upstream of the beginning of the TRs.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
AID-dependent DSBs are predominantly detected in the G1 phase of the cell cycle

A possible mechanism for conversion of SSBs into DSBs is DNA replication, and many of the proteins involved in CSR are associated with DNA surveillance and repair during replication, e.g., MMR proteins and UNG (37). To determine when AID-dependent DSBs are made, we examined the cell cycle regulation of Sµ DSBs. DSBs dependent on AID and UNG are induced in the S regions of B cells activated in vitro to undergo CSR and can be detected by linker LM-PCR (15). We activated splenic B cells for 2 days with LPS and IL-4 to induce IgG1 CSR or LPS and anti-{delta}-dextran (a-{delta}-dex) to induce IgG3 CSR, stained with Hoechst 33342, and then sorted cells into G1 and S/G2/M fractions on the basis of DNA content (Fig. 1A). Dead cells were excluded by 7-aminoactinomycin D staining. At 48 h, there are no undivided cells in these cultures, as determined by CFSE staining (our unpublished data). As shown in Fig. 1B, AID-dependent DSBs are detected almost exclusively in the G1 fraction in cells activated under either condition. There are a few breaks detected in S/G2/M phase, but there are about as many in AID-deficient B cells. These data are therefore inconsistent with the hypothesis that DSBs detected in Sµ in switching B cells are due to replication across SSBs. Although a few DSBs are detected in aid–/– cells, they do not specifically occur at the G:C base pair in the AID target hot spots, unlike DSBs in WT cells (15). They might be due to mechanically induced breaks or apoptosis occurring during the procedure, or perhaps due to replication.


Figure 1
View larger version (43K):
[in this window]
[in a new window]

  		FIGURE 1. AID-dependent Sµ DSBs are detected in G1-, but not in S/G2/M-phase, cells. A, Splenic B cells were activated for 2 days, stained with Hoechst 33342, and sorted into G1 and S/G2/M populations. A representative sorting profile is shown. B, LM-PCR was performed on DNA from viable sorted cells activated as indicated. Three-fold dilutions of 7200 cell equivalents were amplified. PCR amplification of the GAPDH gene (except for the highest input) is shown below the blots as an internal control for template input. The figure shown is representative of two experiments.

 
Proteins important for CSR are expressed in G1-phase cells

We then asked whether the levels of AID, UNG, APE1, and MMR proteins are regulated by the cell cycle. B cells activated with LPS and a-{delta}-dex were sorted into G1, S, and G2/M fractions (Fig. 2A) and extracts were prepared for Western blotting (Fig. 2, B–D). AID protein is difficult to detect in nuclear extracts, but is expressed in the cytosol in all phases of the cell cycle (Fig. 2C). UNG is abundant both in the nucleus (Fig. 2B) and cytoplasm (Fig. 2C) of G1- and S-phase cells. The multiple UNG bands observed in nuclear extracts represent differently phosphorylated species (38). The Ab should also detect the mitochondrial form of UNG in the cytosol. We observed a decrease in UNG in the cytosol as the cells progress through cell cycle, consistent with a report that UNG is down-regulated in late S phase (39). APE1 and the MMR proteins Msh2, Msh6, and Mlh1 are all expressed in the nucleus throughout the cell cycle (Fig. 2D). We conclude that proteins important for CSR are present in all phases of the cell cycle, and specifically in G1 phase when AID-dependent DSBs are detectable.


Figure 2
View larger version (72K):
[in this window]
[in a new window]

  		FIGURE 2. The proteins important for CSR are present in all phases of the cell cycle in activated B cells. A, Splenic B cells were activated for 2 days, stained with Hoechst 33342, and sorted into G1, S, and G2/M populations. B–D, Western blots of extracts from sorted cells. B and C, A total of 35 µg of nuclear or cytoplasmic extract, as indicated, electrophoresed on a gradient gel. ung–/– and aid–/– control extracts are from unsorted B cells. D, Five micrograms of nuclear extract electrophoresed on a 10% polyacrylamide gel. E, UNG assay. Five-fold dilutions (10, 50, and 250 ng) of whole cell extracts from unsorted cells or nuclear extracts from cells sorted as in A were added to a [32P]end-labeled uracil-containing oligonucleotide. Upper band, Uncleaved oligo; lower band, cleaved product.

 
G1-phase cells have UNG activity

UNG is not present in resting (G0) cells (14) and has been proposed to act in S phase at replication forks during CSR and somatic hypermutation (40). G1-phase B cells have not been examined for UNG activity. We prepared nuclear extracts from G1- and S-phase B cells activated for 2 days and assayed UNG activity by an oligonucleotide cleavage assay (Fig. 2E). Activity is clearly detectable in as little as 10 ng of nuclear extract from G1-phase cells, which has as much activity as extracts from S-phase cells. As this substrate is single stranded, the predominant activity detected here is likely to be due to UNG and not SMUG-1, as SMUG-1 has 800-fold lower activity on ssDNA than UNG (kcat/Km) (41). From these combined results, we conclude that AID-dependent DSBs in Sµ are made and resolved in Sµ in G1 phase and are not due to replication across SSBs.

The role of Ercc1 in CSR does not involve the NER pathway

We next asked whether NER might contribute to the generation of DSBs during CSR. We have previously shown a minor role for Ercc1 in CSR (20). The heterodimer Ercc1-XPF is an essential component of the NER pathway, but Ercc1-XPF can also act as a structure-specific endonuclease in the absence of the rest of the NER pathway, cutting at the junction of ssDNA and dsDNA (19). Here, we analyzed CSR in vitro in B cells from mice lacking XPA, a protein essential for NER. We found no reduction in CSR in xpa–/– B cells relative to cells from WT littermates (Fig. 3A). In the absence of UNG, it seemed possible that the accumulation of uracils might result in distortion of the DNA helix sufficient to create a substrate for NER, so we also analyzed CSR in ung–/–xpa–/– B cells CSR is severely reduced in B cells deficient in UNG, as reported by others (13, 14), but still detectable relative to AID-deficient B cells. However, CSR is not further reduced in ung–/–xpa–/– B cells relative to B cells from ung–/– littermates (Fig. 3, B and C). In this experiment, there was a reduction in IgG1 and IgG2a CSR in xpa–/– cells, but this was not typical as can be seen from the compiled data in Fig. 3A. We conclude that the minor role played by Ercc1-XPF in CSR most likely involves its ability to cut at the junction of ssDNA and dsDNA (discussed below and in Ref. 29), and does not involve other components of the NER pathway.

S-region DSBs are reduced in MMR-deficient B cells

The hypothesis that SSBs are converted to DSBs in S regions by MMR predicts fewer DSBs in Sµ in MMR-deficient B cells relative to WT cells. To test this prediction, LM-PCR was performed on genomic DNA isolated from B cells 2 days after induction of CSR. A representative Southern blot of LM-PCR fragments amplified with a 5' Sµ-specific primer from WT, msh2–/–, mlh1–/–, and pms2–/– B cells is shown in Fig. 4A. Blunt DSBs in MMR-deficient cells are reduced compared with WT cells analyzed in parallel. Quantitation by densitometry scanning of the autoradiographs from several experiments demonstrates that MMR deficiency results in ~20–50% of the number of Sµ DSBs in WT cells (Fig. 4B). Thus, blunt DSBs induced in Sµ during CSR are reduced in MMR-deficient cells to a degree consistent with the reduction observed in CSR.


Figure 4
View larger version (46K):
[in this window]
[in a new window]

  		FIGURE 4. DSBs in Sµ are reduced in MMR-deficient splenic B cells. A, A representative Southern blot of Sµ LM-PCR products from B cells lacking the indicated protein, induced with LPS and IL-4. PCR amplification of the GAPDH gene is shown below the blots as an internal control for template input: 3-fold dilutions of 2400 cell equivalents. B, Quantification of DSBs in B cells lacking MMR or AID relative to DSBs in WT cells. Autoradiographs were scanned to measure total density in all three lanes for each sample, and results were normalized relative to density of WT bands in each experimental set. Error bars indicate SEM. The apparent discrepancy between the numbers and intensities of breaks in the pms2–/– and aid–/– samples between the blot shown in A and the compiled results in B is because in the other pms2–/– experiment there were more DSBs (data not shown).

 
As described in the introduction, CSR in B cells lacking the Ig Sµ TR region (SµTR–/–) is severely reduced (90–95%) in the absence of Msh2 or Mlh1. We used LM-PCR to determine whether this might be due to a decrease in DSBs. As shown in Fig. 5, DSBs in SµTR–/– B cells are detected at only a slightly lower frequency than in WT cells (65% of WT), consistent with the 2-fold reduction in CSR in these B cells (24), but when the cells also lack Msh2 or Mlh1, DSBs are reduced to only 20% of that seen in WT cells. The number of DSBs detected in Msh2/SµTR and Mlh1/SµTR double knockout cells is almost as low as in AID-deficient cells.


Figure 5
View larger version (45K):
[in this window]
[in a new window]

  		FIGURE 5. Sµ DSBs are greatly reduced in B cells lacking both SµTRs and Msh2. Sµ LM-PCR products (A and B) amplified as in Fig. 4 from cells with the indicated deficiencies activated as indicated. C, Quantification of DSBs by densitometry (as in Fig. 4B) of the indicated number of experiments. Error bars represent SEM. The aid–/– histogram presents the same data shown in Fig. 4B.

 
Sites of DSBs in SµTR-deficient cells

Relative to the WT Sµ region, the SµTR–/– intron has a 2-fold lower incidence of AID hot spots (WRC/GYW, where the underlined nucleotide is the target site), and the strongly preferred hot-spot GCT (11, 33) is 3.6-fold less frequent than in WT Sµ (Fig. 6). We asked whether the DSBs in SµTR–/– cells occur preferentially at these remaining hot spots by cloning and sequencing LM-PCR products from WT and SµTR–/– B cells. Table I presents the percent of DSBs occurring at the G:C or A:T base pair, at all AID hot spots (GYW), and at the four different GYW motifs (GCT, GCA, GTT, and GTA), as well as the frequency of occurrence of these motifs in the Sµ-region sequence in WT and SµTR–/– cells. The percentage of DSBs located at GYW sequences is increased in SµTR–/– B cells (51.6% compared with 40.5% in WT), supporting the importance of this sequence for AID targeting.


Figure 6
View larger version (37K):
[in this window]
[in a new window]

  		FIGURE 6. Sµ (left) and SµTR–/– (right) sequences. The section in Sµ shown in black (and red) is deleted from the SµTR–/– intron. The blue (and red) section is present in both Sµ and SµTR–/– sequences. The black segment in the SµTR–/– intron represents the loxP insertion. All GYW/WRC AID hot spots are underlined and GCT motifs are shown in red. Arrows indicate the sites of DSBs from cloned LM-PCR products. Bracketed nucleotides roughly indicate the TR region of Sµ.

 

View this table:
[in this window]
[in a new window]

  		Table I. DSBs occur preferentially at AID hot spots in WT and SµTR–/– B cells

 
Further analysis of the breakpoints used in the SµTR–/– intron support previous conclusions that GCT/AGC is the strongest AID hot spot. The preference for breaks at GCT in WT Sµ is 3.3-fold over random (35.4% of DSBs at GCT vs 10.6% frequency of GCT in the sequence, p < 0.001). However, GCT occurs in the WT Sµ sequence at a much higher frequency than the other GYW hot spots (Table I). In the SµTR–/– intron, the frequency at which GCT occurs relative to the other GYW motifs is lower; interestingly, DSBs at GCT occur 10-fold more often than predicted by the sequence (29% of DSBs are at GCT compared with 2.9% frequency in the sequence, p < 0.001). These results confirm that the preference of AID for GCT hot spots previously found in vitro with purified AID and from analyses of somatic hypermutation (6, 11, 12, 42, 43) is also true during CSR, and is even more apparent when these motifs are less abundant. We hypothesize that the reduction in AID hot spots in SµTR–/– B cells results in SSBs that are farther apart, and thus less likely to be sufficiently close to form a DSB spontaneously. DSB formation and CSR are therefore more dependent on MMR in these mice.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
The results from our studies support the hypothesis that distal SSBs are converted into DSBs by MMR recognition and repair of dU:dG mismatches introduced by AID. We obtained data arguing against an alternative model for conversion of SSBs to DSBs, i.e., replication across a SSB, as we detected very few DSBs in S/G2/M phase cells. Instead, the AID-dependent DSBs occur in the G1 phase. These results are in agreement with previous reports showing that AID-dependent {gamma}H2AX/Nbs1 foci colocalize with IgH loci during the G1/early S phase in splenic B cells activated to switch (18). They are also consistent with the finding that switch recombination is not accompanied by sister-chromatid exchange (44), and that a specific protein complex binds near the transcriptional initiation site for germline {gamma}1 transcription during G1/early S phase, but not during G2/M phase in splenic B cells activated to undergo CSR (45). We also found that AID, UNG, and MMR proteins are present in the G1 phase of the cell cycle, and that extracts from G1-phase B cells possess UNG activity.

MMR proteins could convert SSBs into DSBs in the course of normal MMR activity if nicks are present on both strands. Both AID and UNG prefer ssDNA substrates and appear to act on both DNA strands during transcription (1, 12, 22, 46). We hypothesize that the DNA duplex reforms before all of the dUs can be removed by UNG, and MMR would then compete more effectively than UNG for repair of dUs in duplex DNA. AID is a highly processive enzyme and although UNG has a very high catalytic rate, it appears to be unable to remove all the dUs introduced by AID into S regions (6, 12, 22, 23, 41). UNG is likely, however, to create numerous abasic sites, which could then be nicked by APE to generate entry sites for excision by Exo1 in the 5' to 3' direction. If excision continued until a SSB on the opposite strand is reached, a DSB would be formed. A similar model has been proposed for Escherichia coli dam cells exposed to the methylating agent MNNG, in which DSBs arise when MMR excision on one strand encounters a nick generated by APE on the other (47). Depending on the orientation of the SSBs relative to each other, some DSBs created by MMR activity will be blunt and some will have 5' or 3' overhangs. 5' overhangs can be filled in by polymerase to become blunt, and we have proposed that Ercc1-XPF can remove 3' overhangs (20, 29). Ercc1-XPF cuts 3' overhangs at the junction of ssDNA and dsDNA without requiring additional NER proteins (48). Consistent with Ercc1-XPF acting independently of NER in CSR, we found that XPA, an essential NER protein, is not involved in CSR even in the absence of UNG, where helix-distorting lesions recognizable by NER might form.

If the SSBs are the results of AID-instigated lesions, the resulting blunt DSBs would occur preferentially at the G:C base pair in AID hot spots, which is consistent with the location of DSBs in Sµ determined by LM-PCR (Table I) (15, 29). No significant differences were observed between the sites of Sµ DSBs in WT and MMR-deficient B cells (Table II). In the absence of MMR, we predict that the only DSBs formed would do so spontaneously from closely spaced nicks. The staggered DSBs produced in the absence of MMR could then be end processed as described above to form the blunt DSBs at the G:C base pair in AID hot spots detected by LM-PCR. The staggered ends can be detected by LM-PCR by pretreatment with T4 DNA polymerase before ligation (15, 17). We find a 3-fold increase in DSBs after T4 treatment of DNA from both WT and MMR-deficient cells (data not shown).


View this table:
[in this window]
[in a new window]

  		Table II. Sites of DSBs in Sµ do not differ between WT and MMR-deficient B cells during CSRa

 
It has been reported that 94% of Sµ-S{gamma}3 junctions in Msh2-deficient cells occur within the Sµ TRs, which contain numerous closely spaced GAGCT sequences, and only 5% occur 5' to the TRs, whereas in WT cells a greater proportion (17%) of the junctions occur 5' to the repeats (26, 27). These results predict that blunt DSBs in MMR-deficient B cells would localize preferentially to the Sµ TRs. However, we found a similar fraction of DSBs occur 5' to the Sµ TRs in WT and msh2–/– cells, 42 and 40%, respectively. This difference from the previous reports might be due to differences in the analysis methods. We used a PCR primer located at the 5' side of Sµ, and extension would terminate at the first break, favoring detection of breaks located upstream of Sµ.

We consistently find fewer blunt DSBs in B cells from mice lacking Mlh1 or Pms2 than in those lacking Msh2. This might be explained by the recent finding that Mlh1 decreases Exo1 processivity (49). If Exo1 excises farther in the absence of Mlh1-Pms2, perhaps past the nick on the opposite strand, long single-strand tails and fewer blunt DSBs would be generated. Long single-strand overhangs might also explain the increase in microhomology found at CSR junctions from mlh1–/– and pms2–/– mice. In addition, it has recently been shown that the Mlh1-Pms2 heterodimer has endonuclease activity that introduces nicks on either side of the mismatch (50). This activity appears to be restricted to the previously nicked strand (50), and so by itself would not result in DSBs during CSR. Furthermore, as the Mlh1-Pms2 endonuclease does not appear to be restricted to a specific DNA sequence, and Sµ DSBs strongly favor the G:C base pair, this activity is unlikely to contribute significantly to S-region breaks.

Our results are consistent with the model that MMR is more important for CSR in situations when SSBs are limiting, as when AID targets are scarce. Thus, loss of both MMR and the SµTR region results in a dramatic reduction in switching and a reduction in Sµ DSBs. Although we cannot determine the sites of the SSBs that gave rise to any given DSB, we were able to confirm that DSBs occur preferentially at AID hot spots even when the frequency of hot spots is low. We propose that only SSBs on opposite strands within a few nucleotides of each other can form a DSB in the absence of MMR. It is possible that MMR may play a significant role in DSB formation at other loci at which AID might initiate DSB formation, such as bcl6 and c-myc (51, 52). AID targets in these genes are infrequent and therefore, DSB formation, which can lead to translocation and tumor development, might be more dependent on MMR.


   Acknowledgments
 
We thank Dr. Xiaoming Wu for unpublished data and the University of Massachusetts Flow Cytometry Facility for cell sorting and FACS analysis.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by National Institutes of Health Grants AI065639 (to C.E.S.), AI23283 and AI632026 (to J.S.), and by the Cancer Research Institute (to J.E.J.G.). Back

2 Address correspondence and reprint requests to Dr. Carol E. Schrader and Dr Janet Stavnezer, Department of Molecular Genetics and Microbiology, Program in Immunology and Virology, University of Massachusetts Medical School, 55 Lake Avenue North, Worcester, MA 01655; E-mail addresses: Carol.Schrader{at}umassmed.edu or Janet.Stavnezer{at}umassmed.edu Back

3 Abbreviations used in this paper: CSR, class switch recombination; DSB, double-strand break; AID, activation-induced cytidine deaminase; TR, tandem repeat; UNG, uracil DNA glycosylase; APE, AP endonuclease; SSB, single-strand break; NER, nucleotide excision repair; MMR, mismatch repair; WT, wild type; LM-PCR, ligation-mediated PCR; XPF, Xeroderma pigmentosum F. Back

Received for publication June 30, 2007. Accepted for publication August 22, 2007.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Chaudhuri, J., F. W. Alt. 2004. Class-switch recombination: interplay of transcription, DNA deamination and DNA repair. Nat. Rev. Immunol. 4: 541-552. [Medline]
  2. Muramatsu, M., K. Kinoshita, S. Fagarasan, S. Yamada, Y. Shinkai, T. Honjo. 2000. Class switch recombination and hypermutation require activation-induced cytidine deaminase (AID), a potential RNA editing enzyme. Cell 102: 553-563. [Medline]
  3. Petersen-Mahrt, S. K., R. S. Harris, M. S. Neuberger. 2002. AID mutates E. coli suggesting a DNA deamination mechanism for antibody diversification. Nature 418: 99-104. [Medline]
  4. Chaudhuri, J., M. Tian, C. Khuong, K. Chua, E. Pinaud, F. W. Alt. 2003. Transcription-targeted DNA deamination by the AID antibody diversification enzyme. Nature 422: 726-730. [Medline]
  5. Dickerson, S. K., E. Market, E. Besmer, F. N. Papavasiliou. 2003. AID mediates hypermutation by deaminating single stranded DNA. J. Exp. Med. 197: 1291-1296. [Abstract/Free Full Text]
  6. Pham, P., R. Bransteitter, J. Petruska, M. F. Goodman. 2003. Processive AID-catalysed cytosine deamination on single-stranded DNA simulates somatic hypermutation. Nature 424: 103-107. [Medline]
  7. Bransteitter, R., P. Pham, M. D. Scharff, M. F. Goodman. 2003. Activation-induced cytidine deaminase deaminates deoxycytidine on single-stranded DNA but requires the action of RNase. Proc. Natl. Acad. Sci. USA 100: 4102-4107. [Abstract/Free Full Text]
  8. Ramiro, A. R., P. Stavropoulos, M. Jankovic, M. C. Nussenzweig. 2003. Transcription enhances AID-mediated cytidine deamination by exposing single-stranded DNA on the nontemplate strand. Nat. Immunol. 4: 452-456. [Medline]
  9. Yu, K., F. Chedin, C. L. Hsieh, T. E. Wilson, M. R. Lieber. 2003. R-loops at immunoglobulin class switch regions in the chromosomes of stimulated B cells. Nat. Immunol. 4: 442-451. [Medline]
  10. Stavnezer, J.. 1996. Immunoglobulin class switching. Curr. Opin. Immunol. 8: 199-205. [Medline]
  11. Yu, K., F. T. Huang, M. R. Lieber. 2004. DNA substrate length and surrounding sequence affect the activation-induced deaminase activity at cytidine. J. Biol. Chem. 279: 6496-6500. [Abstract/Free Full Text]
  12. Bransteitter, R., P. Pham, P. Calabrese, M. F. Goodman. 2004. Biochemical analysis of hypermutational targeting by wild type and mutant activation-induced cytidine deaminase. J. Biol. Chem. 279: 51612-51621. [Abstract/Free Full Text]
  13. Rada, C., G. T. Williams, H. Nilsen, D. E. Barnes, T. Lindahl, M. S. Neuberger. 2002. Immunoglobulin isotype switching is inhibited and somatic hypermutation perturbed in UNG-deficient mice. Curr. Biol. 12: 1748-1755. [Medline]
  14. Imai, K., G. Slupphaug, W. I. Lee, P. Revy, S. Nonoyama, N. Catalan, L. Yel, M. Forveille, B. Kavli, H. E. Krokan, et al 2003. Human uracil-DNA glycosylase deficiency associated with profoundly impaired immunoglobulin class-switch recombination. Nat. Immunol. 4: 1023-1028. [Medline]
  15. Schrader, C. E., E. K. Linehan, S. N. Mochegova, R. T. Woodland, J. Stavnezer. 2005. Inducible DNA breaks in Ig S regions are dependent upon AID and UNG. J. Exp. Med. 202: 561-568. [Abstract/Free Full Text]
  16. Catalan, N., F. Selz, K. Imai, P. Revy, A. Fischer, A. Durandy. 2003. The block in immunoglobulin class switch recombination caused by activation-induced cytidine deaminase deficiency occurs prior to the generation of DNA double strand breaks in switch mu region. J. Immunol. 171: 2504-2509. [Abstract/Free Full Text]
  17. Rush, J. S., S. D. Fugmann, D. G. Schatz. 2004. Staggered AID-dependent DNA double strand breaks are the predominant DNA lesions targeted to S µ in Ig class switch recombination. Int. Immunol. 16: 549-557. [Abstract/Free Full Text]
  18. Petersen, S., R. Casellas, B. Reina-San-Martin, H. T. Chen, M. J. Difilippantonio, P. C. Wilson, L. Hanitsch, A. Celeste, M. Muramatsu, D. R. Pilch, et al 2001. AID is required to initiate Nbs1/{gamma}-H2AX focus formation and mutations at sites of class switching. Nature 414: 660-665. [Medline]
  19. Hoeijmakers, J. H.. 2001. Genome maintenance mechanisms for preventing cancer. Nature 411: 366-374. [Medline]
  20. Schrader, C. E., J. Vardo, E. Linehan, M. Z. Twarog, L. J. Niedernhofer, J. H. Hoeijmakers, J. Stavnezer. 2004. Deletion of the nucleotide excision repair gene Ercc1 reduces Ig class switching and alters mutations near switch recombination junctions. J. Exp. Med. 200: 321-330. [Abstract/Free Full Text]
  21. Pierce, A. J., P. Hu, M. Han, N. Ellis, M. Jasin. 2001. Ku DNA end-binding protein modulates homologous repair of double-strand breaks in mammalian cells. Genes Dev. 15: 3237-3242. [Abstract/Free Full Text]
  22. Shen, H. M., U. Storb. 2004. Activation-induced cytidine deaminase (AID) can target both DNA strands when the DNA is supercoiled. Proc. Natl. Acad. Sci. USA 101: 12997-13002. [Abstract/Free Full Text]
  23. Xue, K., C. Rada, M. S. Neuberger. 2006. The in vivo pattern of AID targeting to immunoglobulin switch regions deduced from mutation spectra in msh2–/– ung–/– mice. J. Exp. Med. 203: 2085-2094. [Abstract/Free Full Text]
  24. Luby, T. M., C. E. Schrader, J. Stavnezer, E. Selsing. 2001. The mu switch region tandem repeats are important, but not required, for antibody class switch recombination. J. Exp. Med. 193: 159-168. [Abstract/Free Full Text]
  25. Dunnick, W., G. Z. Hertz, L. Scappino, C. Gritzmacher. 1993. DNA sequences at immunoglobulin switch region recombination sites. Nucleic Acids Res. 21: 365-372. [Abstract/Free Full Text]
  26. Min, I., L. Rothlein, C. Schrader, J. Stavnezer, E. Selsing. 2005. Shifts in targeting of class switch recombination sites in mice that lack µ switch region tandem repeats or Msh2. J. Exp. Med. 201: 1885-1890. [Abstract/Free Full Text]
  27. Ehrenstein, M. R., M. S. Neuberger. 1999. Deficiency in Msh2 affects the efficiency and local sequence specificity of immunoglobulin class-switch recombination: parallels with somatic hypermutation. EMBO J. 18: 3484-3490. [Medline]
  28. Min, I., C. Schrader, J. Vardo, N. D’Avirro, T. Luby, J. Stavnezer, E. Selsing. 2003. Sµ tandem repeat region is required for isotype switching in the absence of Msh2. Immunity 19: 515-524. [Medline]
  29. Stavnezer, J., C. E. Schrader. 2006. Mismatch repair converts AID-instigated nicks to double-strand breaks for antibody class-switch recombination. Trends Genet. 22: 23-28. [Medline]
  30. Schrader, C. E., W. Edelmann, R. Kucherlapati, J. Stavnezer. 1999. Reduced isotype switching in splenic B cells from mice deficient in mismatch repair enzymes. J. Exp. Med. 190: 323-330. [Abstract/Free Full Text]
  31. Ehrenstein, M. R., C. Rada, A. M. Jones, C. Milstein, M. S. Neuberger. 2001. Switch junction sequences in PMS2-deficient mice reveal a microhomology-mediated mechanism of Ig class switch recombination. Proc. Natl. Acad. Sci. USA 98: 14553-14558. [Abstract/Free Full Text]
  32. Li, Z., S. J. Scherer, D. Ronai, M. D. Iglesias-Ussel, J. U. Peled, P. D. Bardwell, M. Zhuang, K. Lee, A. Martin, W. Edelmann, M. D. Scharff. 2004. Examination of Msh6- and Msh3-deficient mice in class switching reveals overlapping and distinct roles of MutS homologues in antibody diversification. J. Exp. Med. 200: 47-59. [Abstract/Free Full Text]
  33. Martomo, S. A., W. W. Yang, P. J. Gearhart. 2004. A role for Msh6 but not Msh3 in somatic hypermutation and class switch recombination. J. Exp. Med. 200: 61-68. [Abstract/Free Full Text]
  34. Bardwell, P. D., C. J. Woo, K. Wei, Z. Li, A. Martin, S. Z. Sack, T. Parris, W. Edelmann, M. D. Scharff. 2004. Altered somatic hypermutation and reduced class-switch recombination in exonuclease 1-mutant mice. Nat. Immunol. 5: 224-229. [Medline]
  35. de Vries, A., C. T. van Oostrom, F. M. Hofhuis, P. M. Dortant, R. J. Berg, F. R. de Gruijl, P. W. Wester, C. F. van Kreijl, P. J. Capel, H. van Steeg, et al 1995. Increased susceptibility to ultraviolet-B and carcinogens of mice lacking the DNA excision repair gene XPA. Nature 377: 169-173. [Medline]
  36. Cistulli, C., O. I. Lavrik, R. Prasad, E. Hou, S. H. Wilson. 2004. AP endonuclease and poly(ADP-ribose) polymerase-1 interact with the same base excision repair intermediate. DNA Repair (Amst.). 3: 581-591. [Medline]
  37. Barnes, D. E., T. Lindahl. 2004. Repair and genetic consequences of endogenous DNA base damage in mammalian cells. Annu. Rev. Genet. 38: 445-476. [Medline]
  38. Caradonna, S., S. Muller-Weeks. 2001. The nature of enzymes involved in uracil-DNA repair: isoform characteristics of proteins responsible for nuclear and mitochondrial genomic integrity. Curr. Protein Pept. Sci. 2: 335-347. [Medline]
  39. Fischer, J. A., S. Muller-Weeks, S. Caradonna. 2004. Proteolytic degradation of the nuclear isoform of uracil-DNA glycosylase occurs during the S phase of the cell cycle. DNA Repair (Amst.). 3: 505-513. [Medline]
  40. Di Noia, J. M., C. Rada, M. S. Neuberger. 2006. SMUG1 is able to excise uracil from immunoglobulin genes: insight into mutation versus repair. EMBO J. 25: 585-595. [Medline]
  41. Kavli, B., O. Sundheim, M. Akbari, M. Otterlei, H. Nilsen, F. Skorpen, P. A. Aas, L. Hagen, H. E. Krokan, G. Slupphaug. 2002. hUNG2 is the major repair enzyme for removal of uracil from U:A matches, U:G mismatches and U in single stranded DNA, with hSMUG1 as a broad specificity backup. J. Biol. Chem. 277: 39926-39936. [Abstract/Free Full Text]
  42. Rogozin, I. B., N. A. Kolchanov. 1992. Somatic hypermutagenesis in immunoglobulin genes. II. Influence of neighbouring base sequences on mutagenesis. Biochim. Biophys. Acta 1171: 11-18. [Medline]
  43. Foster, S. J., T. Dorner, P. E. Lipsky. 1999. Somatic hypermutation of V{kappa}J{kappa} rearrangements: targeting of RGYW motifs on both DNA strands and preferential selection of mutated codons within RGYW motifs. Eur. J. Immunol. 29: 4011-4021. [Medline]
  44. Wabl, M., J. Meyer, G. Beck-Engeser, M. Tenkhoff, P. D. Burrows. 1985. Critical test of a sister chromatid exchange model for the immunoglobulin heavy-chain class switch. Nature 313: 687-689. [Medline]
  45. Lundgren, M., L. Strom, L. O. Bergqvist, S. Skog, T. Heiden, J. Stavnezer, E. Severinson. 1995. Cell cycle regulation of germline immunoglobulin transcription: potential role of Ets family members. Eur. J. Immunol. 25: 2042-2051. [Medline]
  46. Shen, H. M., S. Ratnam, U. Storb. 2005. Targeting of the activation-induced cytosine deaminase is strongly influenced by the sequence and structure of the targeted DNA. Mol. Cell. Biol. 25: 10815-10821. [Abstract/Free Full Text]
  47. Nowosielska, A., and M. Marinus. 2007. DNA mismatch repair-induced double-strand breaks. DNA Repair (Amst.). In press.
  48. de Laat, W. L., E. Appeldoorn, N. G. Jaspers, J. H. Hoeijmakers. 1998. DNA structural elements required for ERCC1-XPF endonuclease activity. J. Biol. Chem. 273: 7835-7842. [Abstract/Free Full Text]
  49. Zhang, Y., F. Yuan, S. R. Presnell, K. Tian, Y. Gao, A. E. Tomkinson, L. Gu, G. M. Li. 2005. Reconstitution of 5'-directed human mismatch repair in a purified system. Cell 122: 693-705. [Medline]
  50. Kadyrov, F. A., L. Dzantiev, N. Constantin, P. Modrich. 2006. Endonucleolytic function of MutL{alpha} in human mismatch repair. Cell 126: 297-308. [Medline]
  51. Shen, H. M., A. Peters, B. Baron, X. Zhu, U. Storb. 1998. Mutation of BCL-6 gene in normal B cells by the process of somatic hypermutation of Ig genes. Science 280: 1750-1752. [Abstract/Free Full Text]
  52. Pasqualucci, L., P. Neumeister, T. Goossens, G. Nanjangud, R. S. Chaganti, R. Kuppers, R. Dalla-Favera. 2001. Hypermutation of multiple proto-oncogenes in B-cell diffuse large-cell lymphomas. Nature 412: 341-346. [Medline]
  53. Guikema, J. E. J., E. K. Linehan, D. Tsuchimoto, Y. Nakabeppu, P. R. Strauss, J. Stavenzer and C. E. Schrader. 2007. APE1 and APE2 dependent DNA breaks in immunoglobulin class switch recombination. J. Exp. Med. 204. In press.



This article has been cited by other articles:


Home page
 BloodHome page
P. Rivera-Munoz, P. Soulas-Sprauel, G. Le Guyader, V. Abramowski, S. Bruneau, A. Fischer, F. Paques, and J.-P. de Villartay
Reduced immunoglobulin class switch recombination in the absence of Artemis
Blood, October 22, 2009; 114(17): 3601 - 3609.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
D. Frieder, M. Larijani, C. Collins, M. Shulman, and A. Martin
The Concerted Action of Msh2 and UNG Stimulates Somatic Hypermutation at A {middle dot} T Base Pairs
Mol. Cell. Biol., September 15, 2009; 29(18): 5148 - 5157.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. Eccleston, C. E. Schrader, K. Yuan, J. Stavnezer, and E. Selsing
Class Switch Recombination Efficiency and Junction Microhomology Patterns in Msh2-, Mlh1-, and Exo1-Deficient Mice Depend on the Presence of {micro} Switch Region Tandem Repeats
J. Immunol., July 15, 2009; 183(2): 1222 - 1228.
[Abstract] [Full Text] [PDF]

Home page
 Phil Trans R Soc BHome page
A. Durandy
Immunoglobulin class switch recombination: study through human natural mutants
Phil Trans R Soc B, March 12, 2009; 364(1517): 577 - 582.
[Abstract] [Full Text] [PDF]

Home page
 Phil Trans R Soc BHome page
C. E Schrader, J. E.J Guikema, X. Wu, and J. Stavnezer
The roles of APE1, APE2, DNA polymerase {beta} and mismatch repair in creating S region DNA breaks during antibody class switch
Phil Trans R Soc B, March 12, 2009; 364(1517): 645 - 652.
[Abstract] [Full Text] [PDF]

Home page
 Phil Trans R Soc BHome page
A. Kotnis, L. Du, C. Liu, S. W Popov, and Q. Pan-Hammarstrom
Non-homologous end joining in class switch recombination: the beginning of the end
Phil Trans R Soc B, March 12, 2009; 364(1517): 653 - 665.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
D. Schenten, S. Kracker, G. Esposito, S. Franco, U. Klein, M. Murphy, F. W. Alt, and K. Rajewsky
Pol{zeta} ablation in B cells impairs the germinal center reaction, class switch recombination, DNA break repair, and genome stability
J. Exp. Med., February 16, 2009; 206(2): 477 - 490.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M. Yabuki, E. C. Ordinario, W. J. Cummings, M. M. Fujii, and N. Maizels
E2A Acts in cis in G1 Phase of Cell Cycle to Promote Ig Gene Diversification
J. Immunol., January 1, 2009; 182(1): 408 - 415.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
L. Du, M. van der Burg, S. W. Popov, A. Kotnis, J. J.M. van Dongen, A. R. Gennery, and Q. Pan-Hammarstrom
Involvement of Artemis in nonhomologous end-joining during immunoglobulin class switch recombination
J. Exp. Med., December 22, 2008; 205(13): 3031 - 3040.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. E. J. Guikema, C. E. Schrader, N. G. J. Leus, A. Ucher, E. K. Linehan, U. Werling, W. Edelmann, and J. Stavnezer
Reassessment of the Role of Mut S Homolog 5 in Ig Class Switch Recombination Shows Lack of Involvement in cis- and trans-Switching
J. Immunol., December 15, 2008; 181(12): 8450 - 8459.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
S. Peron, A. Metin, P. Gardes, M.-A. Alyanakian, E. Sheridan, C. P. Kratz, A. Fischer, and A. Durandy
Human PMS2 deficiency is associated with impaired immunoglobulin class switch recombination
J. Exp. Med., October 27, 2008; 205(11): 2465 - 2472.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
J. E.J. Guikema, E. K. Linehan, D. Tsuchimoto, Y. Nakabeppu, P. R. Strauss, J. Stavnezer, and C. E. Schrader
APE1- and APE2-dependent DNA breaks in immunoglobulin class switch recombination
J. Exp. Med., November 26, 2007; 204(12): 3017 - 3026.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow A correction has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schrader, C. E.
Right arrow Articles by Stavnezer, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schrader, C. E.
Right arrow Articles by Stavnezer, J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS