The Journal of Immunology, 2007, 179, 5839-5844
Copyright © 2007 by The American Association of Immunologists, Inc.
A Functionally Coupled µ3-Like Opiate Receptor/Nitric Oxide Regulatory Pathway in Human Multi-Lineage Progenitor Cells1
Patrick Cadet,
Kirk J. Mantione,
Wei Zhu,
Richard M. Kream,
Melinda Sheehan and
George B. Stefano2
Neuroscience Research Institute, State University of New York College, Old Westbury, NY 11568
 |
Abstract
|
|---|
Ongoing studies from our group support the existence and biological importance of a distinct cellular signaling pathway involving endogenously synthesized, chemically authentic, L-morphine, its cognate µ3 opiate receptor subtype, and constitutive NO synthase. Based on prior studies indicating evolutionary conservation and adaptation of morphinergic/NO-coupled signaling to mediate autocrine/paracrine control of cellular functions, our goal was to determine whether a functionally competent µ3 opiate receptor/NO-coupled regulatory pathway exists in human multilineage progenitor cells (MLPC) prepared from umbilical cord blood. Real-time PCR analysis indicated significant expression of µ3 opiate receptor-encoding RNA by undifferentiated human MLPC, in the absence of traditional µ1 opioid receptor-encoding RNA expression. Unpredictably, confirmatory RT-PCR analyses indicated cellular expression of a splice variant of the previously characterized µ3 opiate receptor-encoding mRNA. Pharmacological analyses provided critical validating evidence of functional µ3-like opiate receptor/NO-coupled signaling within primary cultures of undifferentiated human MLPC via morphine-evoke real-time release of NO. Control analyses indicated that morphine-stimulated NO release was markedly inhibited by prior treatment with the opiate antagonist L-naloxone or the constitutive NO synthase inhibitor N(G)-nitro-L-arginine methyl ester and unresponsive to stimulation by the opioid peptide methionine enkephalin. Complementary microarray analysis demonstrated that traditional µ1,
, and
opioid receptor gene expression is not detected in both undifferentiated and differentiated MLPC. Chemical differentiation of MLPC into neuronal progenitor cells effected significant phenotypic expression of a variety of neurally-associated genes. Our data provide compelling evidence in support of both the evolutionary primacy and primordial regulatory role of µ3-like opiate receptor/NO signaling in embryogenesis.
 |
Introduction
|
|---|
A considerable body of published work has established a temporal profile of endogenous opioid peptide and opioid receptor gene expression in the development of mammalian brain (1, 2, 3). Recently, similar analyses have demonstrated (4, 5) programmed expression of opioid peptide and opioid receptor genes in cultured neural progenitor cells at various stages of differentiation. Human multilineage progenitor cells (MLPC)3 derived from postpartum umbilical cord blood have recently been established as a high resolution model (6, 7, 8, 9, 10, 11, 12) for studying biochemical and molecular mechanisms underlying differentiation of multipotent progenitor cells into clonal cell lines (e.g., adipocytes, osteoblasts, myocytes, vascular endothelial cells, neurons, astrocytes, and oligodendrocytes). Because MLPC are nontransformed, and nonimmortalized, their potential for both proliferation and differentiation into phenotypically distinct clonal lines is temporally defined by the complex chemical profile of their respective microenvironments (13). Previous studies of opioid regulation of hematopoesis in adult animals from other groups (14, 15, 16) have provided initial insights into the potential role of opioid processes in MLPC maturation.
Ongoing studies from our group support the existence and biological importance of a distinct morphinergic signaling pathway utilizing endogenously synthesized, chemically authentic, L-morphine, and its cognate µ3 opiate receptor subtype. The µ3 opiate receptor is selectively activated by morphine and related morphinan opiate alkaloids and is unresponsive to all classes of endogenous opioid peptides as well as synthetic phenylpiperidine analgesics such as fentanyl (17, 18, 19). The µ3 opiate receptor is expressed in diverse human tissues including cardiovascular endothelium, leukocytes, anterior segment of the eye, CNS neurons, glia, and peripheral nerves (17, 18, 19), nerves as well as invertebrate hematopoetic and nervous tissues (17, 18, 19, 20, 21).
Morphinergic signaling involves selective coupling of the µ3 opiate receptor to production and release of NO via Ca2+-stimulated activation of constitutive nitric oxide synthase (cNOS) and appears to integrate autocrine/paracrine regulatory loops within cellular microdomains (20, 22). It is our contention that µ3 opiate receptor/NO coupled signaling represents a primordial system of intra/intercellular communication that has been functionally conserved via extensive evolutionary adaptation, resulting in the development and elaboration of endogenous opioid peptide systems and their cognate µ,
, and
opioid/G-protein coupled receptor-linked transduction pathways.
Recent data support a novel regulatory role of tonically released NO to maintain various classes of stem cells in metabolically viable, undifferentiated states of biological readiness (23). Accordingly, the present studies were designed to evaluate whether a µ3 opiate receptor/NO coupled regulatory pathway exists and is functionally competent in MLPC prepared from umbilical cord blood. Real-time PCR analysis of extracted RNA from undifferentiated human MLPC indicated significant expression of µ3 opiate receptor-encoding RNA, in the absence of traditional µ1 opioid receptor-encoding RNA expression. Pharmacological analyses provided confirmatory evidence of functional µ3 opiate receptor/NO coupling via morphine-evoked real-time release of NO into the bath medium. Complementary microarray analysis of extracted RNA indicated that traditional µ,
, and
opioid receptor gene expression is not detected in both undifferentiated and differentiated MLPC. Chemical differentiation of MLPC into neuronal progenitor cells effected significant phenotypic expression of a variety of neurally-associated genes. Our data provide compelling evidence in support of both the evolutionary primacy and primordial regulatory role of µ3-like opiate receptor/NO signaling in embryogenesis.
 |
Materials and Methods
|
|---|
MLPC preparations
Frozen MLPC preparations were obtained from BioE, quickly thawed in a 37°C waterbath and transferred to 75 cm2 tissue culture flasks containing 15 ml of Mesenchymal Stem Cell Growth Medium Bullet kit (Lonza, PT-3001). MLPC were incubated overnight in a 5% CO2 incubator at 37°C followed by a change of medium. At a confluence of 40%, cells were detached using 15 ml of PBS containing 0.1% EGTA, pH 7.3. Detached MLPC were pelleted by centrifugation (500 x g for 7 min), reseeded or utilized for pharmacological experiments and/or RNA extraction.
Total RNA was extracted from 2 x 106 MLPC following lysis in 600 µl RLT buffer according to procedures outlined in the RNeasy mini kit (Qiagen). RNA was eluted in 50 µl RNase free H2O and a 750 ng aliquot was denatured at 95°C and reverse transcribed at 40°C for 1 h using random primers and SuperScript III RNase H-Reverse Transcriptase (Invitrogen Life Technologies).
Differentiation of MLPC into neural progenitor cells was accomplished in neural progenitor maintenance media containing human recombinant basic fibroblast growth factor, human recombinant epidermal growth factor, neural survival factor-1 (Lonza, CC-3209) supplemented with fibroblast growth factor-4 (Sigma-Aldrich), Glutamax I supplement (Invitrogen Life Technologies) and penicillin and streptomycin (Invitrogen Life Technologies). After the development of neurospheres (10 days), the neurospheres were further differentiated into neurons by supplementing the neural progenitor maintenance media with 10 ng/ml brain-derived neurotrophic factor (Sigma-Aldrich) and 10 ng/ml neurotrophin-3 (Sigma-aldrich) for 21 days (Fig. 1). Medium was changed every 3–4 days.

View larger version (44K):
[in this window]
[in a new window]
|
FIGURE 1. Differentiation of the MLPC cells into neuronal cells. Day 1 and Day 28, Undifferentiated and differentiated human MLPC, respectively.
|
|
TaqMan real-time PCR analyses
Real-time PCR analyses were employed to detect µ3 opiate receptor-encoding RNA and traditional µ1 opioid receptor-encoding RNA expression by human MLPC. First strand cDNA synthesis was performed using random hexamers (Invitrogen Life Technologies) and 2 µg of extracted cellular RNA. RNA was denatured at 95°C for 5 min and reverse transcribed at 40°C for 1 h using SuperScript III RNase H-RT (Invitrogen Life Technologies). Primers and probes specific for the µ1 opioid receptor were purchased from Applied Biosystems (part no. Hs00168570_m1). The 2x universal master mix (Applied Biosystems) containing the PCR buffer, MgCl2, dNTPs, and the thermal stable AmpliTaq Gold DNA polymerase was used in the PCR. Reactions were done in triplicate using 4 µl of RT product and RNase/DNase-free water was added to the master mix to a final volume of 50 µl. Real-time PCR for the
-actin reference gene was performed using Applied Biosystems part no. 401846 and only required 1 µl of the RT product. The PCR mixtures were transferred to a MicroAmp optical 96-well reaction plate and incubated at 95°C for 10 min to activate the Amplitaq Gold DNA polymerase and then run for 40 cycles at 95°C for 30 s and 60°C for 1 min on the Applied Biosystems GeneAmp 7500 real-time PCR system. The PCR products were analyzed using the GeneAmp 7500 real-time PCR system software (Applied Biosystems). The TaqMan assay primer and probe sequence (CGGCCAATACAGTGGATAGAACTAATCATCAGCTAGAAAATCTG-GAAGCAGAAACTGCTCCGTTGCCCTA) amplicon is located between 1371 and 1440 of the µ1 gene (Table I). The selective µ3 sequence (bases 853–884) only lines up with the first 32 bases of the TaqMan probe and primer for the µ1 gene (CGGCCAATACAGTGGATAGAACTAATCATCAG).
View this table:
[in this window]
[in a new window]
|
Table I. Primers and TaqMan Probe for the µ opiate receptor sequence used in real-time polymerase chain reactions
|
|
Reverse transcription-PCR
RT-PCR analyses of µ3 opiate receptor-encoding mRNA from human MLPC were performed according to our previously published procedures (20). Following first-strand cDNA synthesis, 7 µl of the RT product was added to the PCR mix containing TaqDNA polymerase (Invitrogen Life Technologies) and specific primers designed to amplify a selective 550 bp sequence of the µ3 opiate receptor transcript. The PCR was denatured at 95°C for 5 min, followed by 35 cycles at 95°C for 1 min, 57°C for 1 min, and 72°C for 1 min, and then an extension step cycle at 72°C for 10 min. PCR products were analyzed on a 2% agarose gel (Sigma-Aldrich) stained with ethidium bromide. The forward primer sequence was, 5'-GGTACTGGGAAAACCTGCTGAAGATCTGTG-3', and the reverse primer was, 5'-CAAAAGCCAGTCTTGCTCTGGTT-3'. The PCR products were excised from the gel and purified with the Qiaquick gel extraction kit (Qiagen). The PCR product (250 ng) and the forward primer were sent to Lark Technologies for direct sequencing. Primers designed to amplify the µ1 opioid receptor had the following sequences 5'-CGGATGAGCCTCTGTGAACTACTA-3' for the forward primer and 5'-GATCCTTCGAAGATTCCTGTCCT-3' for the reverse primer and were designed to amplify a 1052 bp fragment of the transcript.
Real-time measurement of NO release
Real-time release of NO from MLPC was quantified using a 4-channel ESA BioStat with an NO-selective amperometric 600 µm nanoprobe (Innovative Instruments). The well-established NO donor S-nitroso-N-acetyl- DL-penicillamine was used to calibrate the system daily. For each pharmacological trial, 5 x 105 pelleted MLPC in defined medium were placed in a 1.5 ml microcentrifuge tube and the cell medium was immediately replaced with 1 ml of PBS solution (pH = 7.2). The amperometric probe was allowed to equilibrate for at least 10 min before being transferred to the well containing the cells. Baseline levels of NO release were determined by evaluation of real-time NO concentration in PBS. Evoked release of NO from MLPC was evaluated at final concentrations of 10–5 M to 10–7 M morphine in the presence or absence of the µ opioid receptor antagonist naloxone at 10–5 M or the cNOS inhibitor N(G)-nitro-L-arginine methyl ester (L-NAME) at 10–4 M. Additional pharmacological trials utilized a traditionally-employed saturating concentration of 10–5 M methionine enkephalin to confirm µ3 opiate receptor selectivity of NO release.
Gene array analysis of extracted human MLPC RNA
Applied Biosystems Human Genome Survey Arrays were used to construct and differentially analyze by strict statistical criteria transcriptional/gene expression profiles of neuronally differentiated and undifferentiated human MLPC in three independent experiments. The Applied Biosystems Human Genome Survey Array contains 31,700 60-mer oligonucleotides probes representing a set of 27,868 individual human genes and >1,000 control probes. Sequences used for microarray probe design are from curated transcripts from the Celera Genomics Human Genome Database (www.celeradiscoverysystem.com), RefSeq transcripts that have been structurally curated from the LocusLink public database (http://ncbi.nlm.nih.bov/LocusLink/refseq.html), high-quality cDNA sequences from the Mammalian Gene Collection (http://mgc.nci.nih.gov) and transcripts that were experimentally validated at Applied Biosystems.
Pelleted MLPC were resuspended in 600 µl of RLT buffer and homogenized by passing the lysate 20 times through a 1 ml pipette tip. The samples were then processed according to the manufacturers detailed instructions. In the final step, the RNA was eluted with 50 µl of RNase-free water by centrifugation for 1 min at 10,000 rpm. The RNA was analyzed on a model 2100 bioanalyzer (Agilent) using a total RNA nanochip according to the manufacturers protocol. Digoxigenin-UTP labeled cRNA was generated and linearly amplified from 1 µg of total RNA using Applied Biosystems Chemiluminescent RT-IVT Labeling Kit v 2.0 and manufacturers protocol.
Array hybridization, chemiluminescence detection, image acquisition, and analysis were performed using Applied Biosystems Chemiluminescence Detection kit and Applied Biosystems 1700 Chemiluminescent Microarray Analyzer according to protocols supplied by ABI. A total of 15 µg of labeled cRNA targets were hybridized to each chip at 55°C for 19 h. AB1700 Expression System software was used to extract assay signal, and assay signal to noise ratio values from the microarray images. The specific genes noted were selected for their relationship to endogenous morphine biosynthesis when their signal to noise ratio was >2.
 |
Results
|
|---|
Real-time RT-PCR detection of µ3 opiate receptor gene expression by undifferentiated human MLPC
Real-time RT-PCR analyses of µ3 opiate receptor gene expression have been previously validated by our group and employ a custom-synthesized TaqMan probe and a
actin TaqMan amplicon as the internal reference standard (21). Presently, the expression of µ3 opiate receptor-encoding RNA was demonstrated in three independent experiments utilizing different pooled samples of human MLPC, yielding highly reliable Ct values of 30.46 ± 0.06 and 36.91 ± 0.16 (SEM) for µ3 opiate receptor and
actin amplicons, respectively. In contrast, parallel real-time RT-PCR analyses of the same RNA extracts employing previously validated µ1 opioid receptor primers, TaqMan amplicon, and
actin reference standard, yielded Ct values >40. Thus, real-time RT-PCR analyses indicate that µ1 opioid receptor-encoding RNA is not expressed by human MLPC.
Confirmatory RT-PCR analyses of µ3 opiate receptor gene expression by undifferentiated human MLPC
To provide critical confirmation of real-time PCR detection of µ3 opiate receptor-encoding mRNA by undifferentiated human MLPC, conventional RT-PCR analyses were performed (20). Surprisingly, RT-PCR analyses utilizing previously validated µ3 opiate receptor primers resulted in the amplification of an 888 bp fragment, significantly larger than the 550 bp µ3 opiate receptor fingerprint (Fig. 2). Additionally, the RT-PCR analysis failed to amplify a 1052 bp fragment indicative of µ1 opiate receptor-encoding mRNA expression by human MLPC.

View larger version (40K):
[in this window]
[in a new window]
|
FIGURE 2. RT-PCR analysis of MLPCs for µ3-like opiate receptor. Lane 1, m.w. markers (bp); lane 2, undifferentiated MLPC cells; lane 3, differentiated MLPC cells; lane 4, µ1 gene expression in MLPC cells. The expected size fragments for µ3 is 550 bp and 888 bp for the splice variant. Lanes 2 and 3 demonstrate a PCR product clearly larger than the expected 550 bp fragment previously established for the µ3 receptor-encoding mRNA. Greater expression of the 888 bp PCR product in lane 3 is reflected by a more intense band with an apparent slightly faster migration. The absence of a 1052 bp PCR product in lane 4 indicates that MLPC do not express traditional µ1 receptor encoding mRNA. Sequence analysis of bands in lanes 2 and 3 demonstrated that the PCR products contained 888 bp.
|
|
Analysis of the amplified 888 bp fragment indicated a novel 333 nucleotide sequence (underlined in Fig. 3) located between nucleotide positions 874 and 875 of the µ3 transcript. Accordingly, the amplified 888 bp fragment is representative of cellular expression of a splice variant of µ3 opiate receptor-encoding mRNA, in the absence of previously characterized µ3 opiate receptor- and µ1 opiate receptor-encoding mRNAs.

View larger version (52K):
[in this window]
[in a new window]
|
FIGURE 3. µ3 opiate receptor variant partial sequence from PCR product generated by a conventional reverse transcription-PCR. The novel 333 bp sequence (underlined) is located between nucleotide position 874 and 875 of the µ3 transcript.
|
|
Real-time release of NO from undifferentiated human MLPC
Pharmacological analyses were performed to provide critical confirmation that cellular expression of a splice variant of µ3 opiate receptor-encoding mRNA produced functional morphinergic/NO-coupled in primary cultures of undifferentiated human MLPC. Morphine at a final concentration of 10–5 M promoted a strikingly rapid release of NO into the PBS/tissue bath to achieve a maximal concentration of 60 nM at 60 s, with an apparent exponential decrease of extracellular NO concentration between 60 and 160 s (Fig. 4). The morphology of the morphine/NO time-effect trace is characteristic of rapid opiate-coupled cNOS responses observed in our previous work (17, 18, 19).

View larger version (13K):
[in this window]
[in a new window]
|
FIGURE 4. Representative real-time amperometric NO release from 500,000 multilineage progenitor cells stimulated with 10–5 M morphine sulfate. Cells were transferred to 1.5 ml tubes and allowed to adhere for 18 h before assay. Cells were exposed to the noted drugs as described in the text, including to naloxone (10–5 M) and L-NAME (10–4 M) alone (data not shown), which yielded no response (see Table II).
|
|
In separate pharmacological trials, prior incubation with the µ3 antagonist naloxone at 10–5 M or the competitive cNOS inhibitor L-NAME at 10–4 M resulted in marked attenuation of the morphine-evoked release of NO into the PBS/tissue bath (Fig. 4), demonstrating the specificity of the response. In contrast to previous observations of µ3 opiate receptor-stimulated NO release (17, 18, 19), morphine concentrations of 10–6 and 10–7 M were without effect, suggesting that the splice variant of µ3 opiate receptor expressed by human MLPC possesses a lower intrinsic affinity for morphine. Importantly, a traditionally-employed saturating concentration of the prototype opioid peptide methionine enkephalin of 10–5 M was observed to be without effect on evoked release of NO from human MLPC and indistinguishable from basal NO release (Table II). The representative analyses depicted in Fig. 4 are supported by tabulated and statistically analyzed data from three independent series of pharmacological trials (Table II). In sum, the pharmacological trials provide strong corroborative evidence that cellular expression of a splice variant of µ3 opiate receptor-encoding mRNA results in functional expression of a µ3-like opiate receptor by human MLPC that selectively transduces morphine/NO-coupled regulatory signaling.
Gene array analysis of extracted RNA from undifferentiated and neuronally differentiated human MLPC
Complementary microarray analysis of extracted RNA indicated that traditional µ,
, and
opioid receptor gene expression is not detected in both undifferentiated and differentiated MLPC, supporting the earlier observations (Table III). Additionally, of the three major types of dopamine (DA) receptor, only the D2 receptor was found to be weakly expressed in undifferentiated MLPC, displaying an approximate 2-fold increase in differentiated MLPC. Chemical differentiation of MLPC into neuronal progenitor cells effected significant increases in phenotypic expression of a variety of neurally-associated genes including neuron specific enolase, neurexin 3, neuroligin 3, nestin, neurotrophic tyrosine kinase receptor type 1, and glial fibrillary acidic protein (Table III).
 |
Discussion
|
|---|
The present study demonstrates the functional expression of a µ3 opiate receptor subtype variant by human MLPC. The functional role and potential biological importance of expressed µ3 opiate receptors are supported by independent lines of pharmacological evidence demonstrating that morphine-evoked release of NO from MLPC is inhibited either by a selective receptor antagonist or by L-NAME, a competitive inhibitor of cNOS. Importantly, a saturating concentration of the prototype opioid peptide methionine enkephalin, capable of activating traditional µ1,
, and
opioid receptors, was observed to be without effect on evoked release of NO from human MLPC.
Complementary microarray analysis of extracted RNA indicated that traditional µ,
, and
opioid receptor gene expression is not detected in both undifferentiated and differentiated MLPC, and other prominent classes of neural receptors such as the tachykinin and 5-HT2B are only weakly expressed following differentiation. Incomplete expression of an active DA system is also indicated by the lack of expression of DA1 and DA3 receptors and the vesicular DA transporter. The strong expression of the cellular DA transporter suggests that peripherally synthesized DA may be taken up and utilized for nonsynaptic functions or for the synthesis of endogenous morphine (24, 25). Importantly, candidate genes involved in endogenous morphine biosynthesis including catechol-O-methyltransferase, cytochrome P450 2D6, and phenylethanolamine N-methyltransferase are expressed in both undifferentiated and differentiated MLPC (26) (Table III), suggesting that MLPC have the potential for morphine expression. Taken together, for the first time, we show elements of an endogenous morphine signaling in progenitor stem cells, suggesting the presence and physiological significance of a µ3–like receptor, during early development.
The µ3 receptor cDNA, compared with µ1, is truncated at the 5'-end, missing several hundred nucleotides, but the middle and conserved region sequences are identical with µ1 (20). The 3' end of µ3 exhibits 100% identity to a portion of the 3' end of the µ1 variant, followed by a new fragment of 263 bases, and then a 201-bp fragment of the 3' end of the µ1 gene untranslated region (20). As observed presently, the µ3-like opiate receptor represents a typical transmembrane G protein-coupled receptor with a novel linkage to cNOS (17, 18, 19, 27, 28, 29, 30, 31) as well as having an additional 333 bases inserted within the coding region of the µ3 transcript. The novelty and selectivity of this G protein-coupled, naloxone-sensitive receptor was made apparent when a variety of opioid peptides were found to be ineffective in displacing specifically bound dihydromorphine as well as in stimulating NO release, whereas opiate alkaloids were quite potent (17, 20). In this report, we found that only one set of µ-specific primers used in the PCR (from map position 896-1336) yielded a specific PCR product (32). This segment of the cDNA encodes the third extracellular loop of the receptor that is important for µ agonist selectivity (33, 34).
Functional expression of a µ3-like opiate receptor by embryonic stem cells suggests a role as a primordial or progenitor opiate signaling system. Morphine-mediated NO production may therefore represent an original transductive pathway underlying the cellular actions of opiates. NO signaling has been demonstrated in embryonic cells, adding and supporting the current findings (23, 35). NO inhibits subventricular zone-derived neural stem cells proliferation, which was found not to involve cGMP synthesis (36). These neurosphere cells expressed the neuronal and endothelial isoforms of NO and produced NO in culture. This study further suggests NO may be acting in a autocrine/paracrine manner. Recent studies (23) demonstrate that a NO-cGMP signaling system exists in embryonic stem cells and may be involved in forming committed precursor cells.
Importantly, mammalian and human cells have the ability to make morphine via a multienzyme mediated process, containing numerous feedback inhibitory steps (24, 25), and pharmacological administration of high concentrations of exogenous morphine may alter one or all of these regulatory steps (26). Our recent work provides compelling prima facie evidence that chemically authentic morphine is endogenously synthesized by diverse animal cellular systems from L-tyrosine-derived small molecules within a strikingly similar biochemical pathway to that described in opium poppy (24, 25, 37, 38).
In conclusion, we have identified, for the first time in human MLPC, the expression of a µ3-like opiate receptor variant of the opiate receptor gene family. These progenitor cells not only expressed this variant, but also the protein produced from this transcript exhibits the biochemical characteristic of the µ3 receptor by the production of NO in the presence of morphine. This finding is important in further understanding the role of endogenous opiates and opiate receptors in the developmental process, which may have a strong implication in the development of tolerance in pain and in drug addiction. Our data also provide compelling evidence in support of both the evolutionary primacy and primordial regulatory role of a µ3-like opiate receptor/NO in embryogenesis.
 |
Disclosures
|
|---|
The authors have no financial conflict of interest.
 |
Footnotes
|
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 This work was supported in part by Grants DA 09010 and MH 47292, and the New York State Empire Innovation Award Program. 
2 Address correspondence and reprint requests to Dr. George B. Stefano, Neuroscience Research Institute, State University of New York College, P.O. Box 210, Old Westbury, NY 11568. E-mail adddress: gstefano{at}sunynri.org 
3 Abbreviations used in this paper: MLPC, multi-lineage progenitor cells; L-NAME, N(G)-nitro-L-arginine methyl ester; cNOS, constitutive nitric oxide synthase; DA, dopamine. 
Received for publication May 21, 2007.
Accepted for publication August 25, 2007.
 |
References
|
|---|
- Zamir, N., R. Quirion, M. Segal. 1985. Ontogeny and regional distribution of proenkephalin- and prodynorphin-derived peptides and opioid receptors in rat hippocampus. Neuroscience 15: 1025-1034. [Medline]
- Leslie, F. M., Y. Chen, U. H. Winzer-Serhan. 1998. Opioid receptor and peptide mRNA expression in proliferative zones of fetal rat central nervous system. Can. J. Physiol. Pharmacol. 76: 284-293. [Medline]
- Zhu, Y., M. S. Hsu, J. E. Pintar. 1998. Developmental expression of the µ,
, and
opioid receptor mRNAs in mouse. J. Neurosci. 18: 2538-2549. [Abstract/Free Full Text] - Ventura, C., M. Maioli. 2000. Opioid peptide gene expression primes cardiogenesis in embryonal pluripotent stem cells. Circ. Res. 87: 189-194. [Abstract/Free Full Text]
- Kim, E., A. L. Clark, A. Kiss, J. W. Hahn, R. Wesselschmidt, C. J. Coscia, M. M. Belcheva. 2006. µ- and
-opioids induce the differentiation of embryonic stem cells to neural progenitors. J. Biol. Chem. 281: 33749-33760. [Abstract/Free Full Text] - McGuckin, C. P., N. Forraz, Q. Allouard, R. Pettengell. 2004. Umbilical cord blood stem cells can expand hematopoietic and neuroglial progenitors in vitro. Exp. Cell Res. 295: 350-359. [Medline]
- Collins, D. P.. 2006. Isolation and characterization of umbilical cord blood-derived multipotent stem cells arising from an adherent CD45+CD34+ cell subset. 4th Annual International Umbilical Cord Blood Transplantation Symposium, May 19–20 , St. Paul, MN.
- McGuckin, C. P., N. Forraz, M. O. Baradez, S. Navran, J. Zhao, R. Urban, R. Tilton, L. Denner. 2005. Production of stem cells with embryonic characteristics from human umbilical cord blood. Cell Prolif. 38: 245-255. [Medline]
- McGuckin, C., N. Forraz, M. O. Baradez, C. Basford, A. M. Dickinson, S. Navran, J. D. Hartgerink. 2006. Embryonic-like stem cells from umbilical cord blood and potential for neural modeling. Acta Neurobiol. Exp. 66: 321-329. [Medline]
- Forraz, N., R. Pettengell, C. P. McGuckin. 2004. Characterization of a lineage-negative stem-progenitor cell population optimized for ex vivo expansion and enriched for LTC-IC. Stem Cells 22: 100-108. [Abstract/Free Full Text]
- Goodwin, H. S., A. R. Bicknese, S. N. Chien, B. D. Bogucki, C. O. Quinn, D. A. Wall. 2001. Multilineage differentiation activity by cells isolated from umbilical cord blood: expression of bone, fat, and neural markers. Biol. Blood Marrow Transplant. 7: 581-588. [Medline]
- Lee, O. K., T. K. Kuo, W. M. Chen, K. D. Lee, S. L. Hsieh, T. H. Chen. 2004. Isolation of multipotent mesenchymal stem cells from umbilical cord blood. Blood 103: 1669-1675. [Abstract/Free Full Text]
- Horowitz, D., J. F. Callahan, L. M. Pelus, S. Fukuda, A. G. King. 2002. Inhibition of hematopoietic progenitor cell growth by Tyr-MIF, an endogenous opiate modulator, and its degradation products. Int. Immunopharmacol. 2: 721-730. [Medline]
- Rameshwar, P., A. Poddar, P. Gascon. 1997. Hematopoietic regulation mediated by interactions among the neurokinins and cytokines. Leuk. Lymphoma. 28: 1-10. [Medline]
- Broome, C. S., A. D. Whetton, J. A. Miyan. 2000. Neuropeptide control of bone marrow neutrophil production is mediated by both direct and indirect effects on CFU-GM. Br. J. Haematol. 108: 140-150. [Medline]
- Sharp, B. M., S. Roy, J. M. Bidlack. 1998. Evidence for opioid receptors on cells involved in host defense and the immune system. J. Neuroimmunol. 83: 45-56. [Medline]
- Stefano, G. B., A. Digenis, S. Spector, M. K. Leung, T. V. Bilfinger, M. H. Makman, B. Scharrer, N. N. Abumrad. 1993. Opiate-like substances in an invertebrate, an opiate receptor on invertebrate and human immunocytes, and a role in immunosuppression. Proc. Natl. Acad. Sci. USA 90: 11099-11103. [Abstract/Free Full Text]
- Makman, M. H., T. V. Bilfinger, G. B. Stefano. 1995. Human granulocytes contain an opiate receptor mediating inhibition of cytokine-induced activation and chemotaxis. J. Immunol. 154: 1323-1330. [Abstract]
- Stefano, G. B., A. Hartman, T. V. Bilfinger, H. I. Magazine, Y. Liu, F. Casares, M. S. Goligorsky. 1995. Presence of the µ3 opiate receptor in endothelial cells: coupling to nitric oxide production and vasodilation. J. Biol. Chem. 270: 30290-30293. [Abstract/Free Full Text]
- Cadet, P., K. J. Mantione, G. B. Stefano. 2003. Molecular identification and functional expression of µ3, a novel alternatively spliced variant of the human µ opiate receptor gene. J. Immunol. 170: 5118-5123. [Abstract/Free Full Text]
- Cadet, P., K. J. Mantione, T. V. Bilfinger, G. B. Stefano. 2004. Differential expression of the human µ opiate receptor from different primary vascular endothelial cells. Med. Sci. Monit. 10: BR351-BR355. [Medline]
- Prevot, V., C. Rialas, D. Croix, M. Salzet, J.-P. Dupouy, P. Puolain, J. C. Beauvillain, G. B. Stefano. 1998. Morphine and anandamide coupling to nitric oxide stimulated GnRH and CRF release from rat median eminence: neurovascular regulation. Brain Res. 790: 236-244. [Medline]
- Madhusoodanan, K. S., F. Murad. 2007. NO-cGMP signaling and regenerative medicine involving stem cells. Neurochem. Res. 32: 681-694. [Medline]
- Zhu, W., K. J. Mantione, L. Shen, P. Cadet, T. Esch, Y. Goumon, E. Bianchi, D. Sonetti, G. B. Stefano. 2005. Tyrosine and tyramine increase endogenous ganglionic morphine and dopamine levels in vitro and in vivo: CYP2D6 and tyrosine hydroxylase modulation demonstrates a dopamine coupling. Med. Sci. Monit. 11: BR397-BR404. [Medline]
- Zhu, W., P. Cadet, G. Baggerman, K. J. Mantione, G. B. Stefano. 2005. Human white blood cells synthesize morphine: CYP2D6 modulation. J. Immunol. 175: 7357-7362. [Abstract/Free Full Text]
- Mantione, K. J., P. Cadet, W. Zhu, R. M. Kream, M. Sheehan, G. L. Fricchione, Y. Goumon, T. Esch, and G. B. Stefano. 2007. Endogenous morphine signaling via nitric oxide regulates the expression of CYP2D6 and COMT: autocrine/paracrine feedback inhibition. Addict. Biol. doi: 10.111/j.1369–1600.2007.00072.X.
- Stefano, G. B., A. Hartman, T. V. Bilfinger, H. I. Magazine, Y. Liu, F. Casares, M. S. Goligorsky. 1995. Presence of the µ3 opiate receptor in endothelial cells: coupling to nitric oxide production and vasodilation. J. Biol. Chem. 270: 30290-30293. [Abstract/Free Full Text]
- Magazine, H. I., Y. Liu, T. V. Bilfinger, G. L. Fricchione, G. B. Stefano. 1996. Morphine-induced conformational changes in human monocytes, granulocytes, and endothelial cells and in invertebrate immunocytes and microglia are mediated by nitric oxide. J. Immunol. 156: 4845-4850. [Abstract]
- Liu, Y., D. Shenouda, T. V. Bilfinger, M. L. Stefano, H. I. Magazine, G. B. Stefano. 1996. Morphine stimulates nitric oxide release from invertebrate microglia. Brain Res. 722: 125-131. [Medline]
- Stefano, G. B., B. Scharrer, E. M. Smith, T. K. Hughes, H. I. Magazine, T. V. Bilfinger, A. Hartman, G. L. Fricchione, Y. Liu, M. H. Makman. 1996. Opioid and opiate immunoregulatory processes. Crit. Rev. Immunol. 16: 109-144. [Medline]
- Stefano, G. B., B. Scharrer. 1996. The presence of the µ3 opiate receptor in invertebrate neural tissues. Comp. Biochem. Physiol. C 113: 369-373. [Medline]
- Cadet, P., T. V. Bilfinger, C. Fimiani, D. Peter, G. B. Stefano. 2000. Human vascular and cardiac endothelia express µ opiate receptor transcripts. Endothelium 7: 185-191. [Medline]
- Sonetti, D., E. Ottaviani, G. B. Stefano. 1997. Opiate signaling regulates microglia activities in the invertebrate nervous system. Gen. Pharmacol. 29: 39-47. [Medline]
- Matthes, H. W., R. Maldonado, F. Simonin, O. Valverde, S. Slowe, I. Kitchen, K. Befort, A. Dierich, M. Le meur, P. Dollé, et al 1996. Loss of morphine-induced analgesia, reward effect and withdrawal symptoms in mice lacking the µ opioid receptor gene. Nature 383: 819-823. [Medline]
- Mujoo, K., J. S. Krumenacker, Y. Wada, F. Murad. 2006. Differential expression of nitric oxide signaling components in undifferentiated and differentiated human embryonic stem cells. Stem Cells Dev. 15: 779-787. [Medline]
- Torroglosa, A., M. Murillo-Carretero, C. Romero-Grimaldi, E. R. Matarredona, A. Campos-Caro, C. Estrada. 2007. Nitric oxide decreases subventricular zone stem cell proliferation by inhibition of epidermal growth factor receptor and phosphoinositide-3-kinase/Akt pathway. Stem Cells 25: 88-97. [Abstract/Free Full Text]
- Kream, R. M., G. B. Stefano. 2006. De novo biosynthesis of morphine in animal cells: an evidence-based model. Med. Sci. Monit. 12: RA207-RA219. [Medline]
- Kream, R. M., G. B. Stefano. 2006. Morphine synthesis in animals (Editorial). Med. Sci. Monit. 12: ED1-ED2. [Medline]