The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

The Journal of Immunology, 2007, 179, 5644 -5648
Copyright © 2007 by The American Association of Immunologists, Inc.
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Samy, E. T.
Right arrow Articles by Peng, S. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Samy, E. T.
Right arrow Articles by Peng, S. L.

Cutting Edge: Modulation of Intestinal Autoimmunity and IL-2 Signaling by Sphingosine Kinase 2 Independent of Sphingosine 1-Phosphate1

Eileen T. Samy*, Claas A. Meyer{dagger}, Patrick Caplazi*, Claire L. Langrish*, Jose M. Lora*, Horst Bluethmann{dagger} and Stanford L. Peng2,*

* Inflammation, Autoimmunity, and Transplantation Research, Roche Palo Alto, Palo Alto, CA 94304; and {dagger} F. Hoffmann-La Roche, Roche Center for Medical Genomics, Basel, Switzerland


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results and Discussion
 Disclosures
 References
 
Sphingosine kinase (Sphk) phosphorylates sphingosine into sphingosine-1-phosphate (S1P), but its recently identified isoform Sphk2 has been suggested to have distinct subcellular localization and substrate specificity. We demonstrate here that, surprisingly, Sphk2–/– CD4+ T cells exhibit a hyperactivated phenotype with significantly enhanced proliferation and cytokine secretion in response to IL-2 as well as reduced sensitivity to regulatory T cell-mediated suppression in vitro, apparently independent of effects upon S1P. Such findings appear to reflect a requirement for Sphk2 to suppress IL-2 signaling because, in Sphk2–/– CD4+ T cells, IL-2 induced abnormally accentuated STAT5 phosphorylation and small interfering RNA knockdown of STAT5 abrogated their hyperactive phenotype. This pathway physiologically modulates autoinflammatory responses, because Sphk2–/– T cells induced more rapid and robust inflammatory bowel disease in scid recipients. Thus, Sphk2 regulates IL-2 pathways in T cells, and the modulation of Sphk2 activity may be of therapeutic utility in inflammatory and/or infectious diseases.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results and Discussion
 Disclosures
 References
 
Sphingosine kinase (Sphk)3 catalyzes the phosphorylation of sphingosine to sphingosine-1-phosphate (S1P), a molecule crucial for the regulation of diverse cellular events such as cell survival, growth, differentiation, motility, and calcium mobilization (1, 2). Two mammalian isoforms of sphingosine kinase, Sphk1 and Sphk2, have been identified that vary in their substrate specificities (3, 4, 5); for instance, recent studies have indicated that Sphk2 is the major enzyme responsible for phosphorylation and activation of the immunosuppressive agent fingolimod (FTY720) and related analogues (6). Deficiency in either kinase alone, however, does not affect the circulating levels of S1P significantly (7), whereas the overexpression of Sphk 1 but not Sphk2 increased the accumulation of intracellular S1P after exposure to extracellular S1P (8). Also, Sphk1 generally localizes in the cytoplasm and translocates to the plasma membrane upon activation, while Sphk2 generally localizes in nuclei through a nuclear localization signal sequence (9).

The role of Sphk2 remains largely undefined in the immune system. In cultured cell lines such as NIH 3T3 and/or HeLa, the overexpression of Sphk2 in vitro causes inhibition of DNA synthesis resulting in cell cycle arrest at the G1/S phase transition (9), and it also may induce apoptosis through its Bcl-2 homology 3 (BH3)-like domain (10). Recent studies in the 68-41 T cell hybridoma and the 2D6 Th1 clone have suggested that Sphk2 may also associate with the IL-12 receptor beta1 cytoplasmic region and may modulate the effect of IL-12 on the T cell response, at least as judged by overexpression studies involving dominant-negative forms of Sphk2 (11). As such, Sphk2 may possess significant immunoregulatory functions, many of which remain incompletely elucidated.

To study the physiological functions of Sphk2, we generated Sphk2-deficient (Sphk2–/–) mice. Surprisingly, Sphk2–/– T cells exhibited a hyperactivated phenotype with enhanced proliferative and Th1 cytokine-secreting capacities and an exaggerated ability to induce inflammatory bowel disease (IBD) in scid mice, likely related to increased IL-2 signaling and STAT5 activity. Thus, Sphk2 modulates IL-2 pathways in T cells to suppress inflammatory and autoimmune responses, suggesting that the therapeutic modulation of Sphk2 activity may benefit inflammatory and infectious diseases.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results and Discussion
 Disclosures
 References
 
Mice

Sphk2-deficient mice were generated via targeted mutagenesis of exons 4–7 in BALB/c embryonic stem cells (data not shown). CB17/lcr-Prkdcscid/Crl (C.B-17 scid) female mice were purchased from Charles River Laboratories. All mice were housed under specific pathogen-free conditions at Roche Palo Alto (Palo Alto, CA) and were studied according to Institutional Animal Care and Use Committee-approved guidelines and protocols.

CD4+ T cell studies

CD4+ T cells were purified from 8- to 12-wk-old mice using indirect magnetic labeling of non-CD4+ T cells with a biotin-antibody mixture and anti-biotin microbeads (Miltenyi Biotec). CD4+CD25+ T cells were isolated using CD25-PE and anti-PE microbeads by positive selection on an autoMACS device (Miltenyi Biotec). Cell purity, as judged by flow cytometry, was at least 95%. Where indicated, CD4+CD25+ or naive CD4+CD25– T cells were labeled with CFSE (Molecular Probes) by incubation for 10 min at 37°C in 10 µM CFSE in HBSS. Flow cytometric analyses were performed on lymphocytes cleared of RBC by osmotic lysis with Abs from BD Biosciences. Western blotting was performed using whole cell lysates with anti-phosphorylated STAT5 (pSTAT5; Tyr694), anti-STAT5 (Cell Signaling Technologies), and HRP-labeled goat anti-rabbit IgG (Jackson ImmunoResearch Laboratories).

For proliferation assays and regulatory T cell suppression assays, naive CD4+CD25– cells (5 x 104) were cultured in 96-well plates with the indicated amount of anti-CD3 with or without APCs (5 x 104), and CD4+CD25+ cells for 72 h at 37°C with 5% CO2 as previously described (12). Cultures were pulsed with [3H]TdR for the last 8 h of culture. Where indicated, 1 µg/ml soluble anti-CD28 (clone 37.51), 100 U/ml human rIL-2 (Roche Biosciences), and/or various concentrations of S1P (Sigma-Aldrich) were added. Supernatants were harvested at the indicated times and assayed for cytokine secretion by ELISA (BD Pharmingen; eBiosource) or multiplex bead array (Upstate Biotechnology; Luminex). For small interfering RNA (siRNA) knockdown of STAT5, CD4+CD25– T cells were electroporated with 1 µg each of a combination of three Sphk2 (CCACGUGGUGCCAAUGAUCUCUGAA; GGAGUUAGUGGAGUAUGGGCCAAUA; and CCGAGAUGGUCUAGUCUCUCUGGAU), STAT5 (GGAAGAGAAGUUCACGAUCCUGUUU; ACUCACAGUUCAGCGUCGGUGGAAA; and ACGGAUACGUGAAGCCACAGAUCAA) or control BLOCK-iT siRNA oligos (Invitrogen Life Technologies). S1P levels were measured using thin layer chromatography as described (13).

T cell transfer colitis model and histopathology

IBD was induced in C.B-17 scid mice as previously described (14, 15); briefly, CD4+CD25– T cells were purified by autoMACS (Miltenyi Biotec) and further enriched by FACS sorting (BD Biosciences). Cells (1 x 106) were injected i.p. into C.B-17 scid recipients on day 0.


   Results and Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
Disclosures
 References
 
Hyperactivated phenotype of Sphk2–/– CD4+ T cells

Sphk2–/– mice were generated by gene targeting directly in BALB/c embryonic stem cells, facilitated by Cre-mediated excision of Sphk2 exons 4–7 (data not shown). Sphk2–/– mice were viable, fertile, exhibited apparently normal longevity, and lacked overt abnormalities. Cellularities and fractional distributions of major lymphocyte subsets were not significantly affected in Sphk2–/– mice compared with their Sphk2+/+ counterparts (data not shown).

Surprisingly, though, CD4+ cells in Sphk2–/– mice displayed surface phenotypes consistent with increased activation, including higher proportions of cells that possessed a CD69high and/or CD62Llow phenotype (Fig. 1A). Sphk2–/– CD4+CD25– T cells exhibited significantly enhanced proliferation (Fig. 1B) and cytokine-secreting capacities upon the addition of IL-2 (Fig. 1C). Similar responses were seen in CD4+CD25– T cells after the knockdown of Sphk2 by siRNA (Fig. 1D). This phenotype did not seem to reflect a reduced susceptibility of Sphk2–/– CD4+CD25– T cells to apoptosis, because they demonstrated comparable if not sometimes increased proportions of apoptotic cells in comparison with their Sphk2+/+ counterparts (data not shown).


Figure 1
View larger version (38K):
[in this window]
[in a new window]

  		FIGURE 1. Hyperactivated CD4+ T cells in the absence of Sphk2. A, Flow cytometric plots of CD4-gated lymph node cells demonstrate a hyperactivated phenotype of Sphk2–/– compared with Sphk2+/+ T cells as indicated by increased populations of CD4+CD69+ and CD4+CD62Llow cells. Data are representative of eight animals per group. B–D, The proliferative capacities of (B) and cytokine production by (C) CD4+CD25– T cells from Sphk2–/– (squares) vs Sphk2+/+ (diamonds) mice or the proliferative capacities (D) of Sphk2+/+ CD4+CD25– T cells treated with Sphk2-specific or control siRNAs stimulated with the indicated amounts of plate-bound anti-CD3 and APCs were assessed after 72 h incubation with (open symbols) or without (filled symbols) human IL-2 supplementation. Shown are SD values of triplicate samples representative of at least three separate experiments. *, p < 0.05; **, p < 0.01; comparing Sphk2–/– to Sphk2+/+.

 
Notably, Sphk2–/– CD4+CD25– T cells proliferated in response to IL-2 alone in the absence of TCR ligation as shown by CFSE dilution (Fig. 2A; p < 0.05), suggesting the presence of T cells, perhaps autoreactive, that have been "primed" despite being normally kept in check by regulatory T (Treg) cells. Indeed, CD4+CD25– T cells from Sphk2–/– mice were less sensitive to Treg-mediated suppression in vitro (Fig. 2B). This enhanced proliferation seems unlikely due to differences in S1P levels because Sphk2 deficiency did not cause significant alterations in S1P (6, 7) (Fig. 2C) and, in any case, although the addition of up to 1 µM S1P to Sphk2–/– CD4+CD25– T cells reduced their proliferative capacity as expected, it did not alter their hyperactivity compared with Sphk2+/+ counterparts (Fig. 2D). Thus, Sphk2 deficiency results in hyperactivated, hyperresponsive, and hypo-suppressible CD4+ T cells, indicating that Sphk2 is required for the maintenance of helper T cell homeostasis, likely independent of S1P.


Figure 2
View larger version (42K):
[in this window]
[in a new window]

  		FIGURE 2. Sphk2-deficient CD4+ T cell hyperactivation relates to enhanced IL-2 responsiveness and resistance to regulatory T cell-mediated suppression. A, Proliferative capacities of naive CD4+ T cells from Sphk2–/– vs Sphk2+/+ mice were assessed by CFSE dilution in flow cytometry after 72 h incubation with IL-2 in the absence of TCR ligation. B, CD4+CD25– T cells from Sphk2+/+ (open diamond) or Sphk2–/– (filled circle) mice were cultured with the indicated number of CD4+CD25+ Sphk2+/+ Treg cells in the presence of 0.5 µg/ml anti-CD3 and APCs. Teff, Effector T cell. C, Levels of S1P in Sphk2+/+ or Sphk2–/– CD4+CD25– T cells. Spots corresponding to [32P]S1P by thin layer chromatography (right panel) were quantified in a scintillation counter (numbers indicate SD values) via a standard curve (left panel). D, CD4+CD25– T cells from Sphk2–/– vs Sphk2+/+ mice were stimulated with plate-bound anti-CD3 plus IL-2 with the addition of the indicated amounts of S1P (inset). Proliferative capacities were assessed by 3H incorporation (cpm) at 72 h. SD values reflect triplicate samples. Data are representative of at least three separate experiments. *, p < 0.05; **, p < 0.01; comparing Sphk2–/– to Sphk2+/+.

 
Sphk2 modulates intestinal autoimmunity and IBD

To understand further the physiological role of Sphk2, we examined the phenotype of Sphk2–/– T cells in an adoptive transfer model of IBD where CD4+CD25–CD45RBhigh T cells from Sphk2–/– or Sphk2+/+ littermates were transferred into C.B-17-scid mice (14, 15). Strikingly, recipients of Sphk2–/– T cells developed weight loss that began as early as 3 wk after injection of the cells (Fig. 3A; p < 0.01), significantly accelerated in comparison with mice that received Sphk2+/+ T cells where weight loss began only at ~6 wk (Fig. 3A; p < 0.05). Upon gross examination, the large intestines of Sphk2–/– T cell recipients were significantly enlarged as judged by the colonic weight to length ratio (mg/cm) of 93 ± 2.7 vs 85 ± 1.5, consistent with worsened intestinal inflammation. Histopathology revealed lesions, most pronounced in the large intestine, generally consisting of mononuclear cell infiltration of the lamina propria admixed with granulocytes, eosinophils, and neutrophils. Recipients of Sphk2–/– T cells exhibited more profound epithelial lesions characterized by necrosis, loss of epithelium (mostly crypt), and accumulation of cellular debris within crypt lumina. Residual crypts were widely separated by inflammatory cells, with crypt necrosis accompanied by the formation of granulation tissue and histiocytic infiltration (Fig. 3, B–E). Accordingly, mesenteric lymph node cells from Sphk2–/– T cell recipients produced higher levels of the proautoimmunity cytokines IL-2, IL-17, and IFN-{gamma} (Fig. 3F), but not IL-4 or IL-10 (data not shown), upon restimulation with anti-CD3 in vitro (16). Thus, Sphk2 deficiency resulted in significantly more severe IBD due to proinflammatory pathogenic T cell hyperreactivity.


Figure 3
View larger version (47K):
[in this window]
[in a new window]

  		FIGURE 3. Sphk2–/– T cells induce more rapid and severe cytokine production and IBD in vivo. A, Relative body weight changes (percentage) over time as an index of intestinal inflammation were assessed during the CD4+CD25–CD45RBhigh (RBhigh T) cells -> scid adoptive transfer model of IBD using Sphk2+/+ (filled squares) or Sphk2–/– (open diamonds) RBhigh T cells. Unreconstituted mice (crosses) were assessed as controls. Data are representative of three separate experiments. B–E, Representative inflammatory lesions in the large intestine of scid mice reconstituted with Sphk2+/+ (B–C) or Sphk2–/– (D–E) RBhigh T cells; B and C, Mice reconstituted by Sphk2+/+ RBhigh T cells exhibit layers of inflammatory cells, predominantly lymphocytes. D and E, Mice reconstituted by Sphk2–/– RBhigh T cells exhibit distinctly more severe colitis with extensive loss of crypts. F, Cytokine secretion by anti-CD3-stimulated T cells from mesenteric lymph nodes of scid reconstituted mice previously reconstituted with Sphk2+/+ or Sphk2–/– RBhigh T cells were quantified by ELISA. Error bars indicate SD values of data pooled from three separate experiments. *, p < 0.05; **, p < 0.01

 
Enhanced IL-2 responsiveness and signaling in Sphk2–/– T cells

Because Sphk2–/– T cells exhibit a pronounced in vitro phenotype upon IL-2 supplementation (Figs. 1 and 2), we suspected that Sphk2 might modulate IL-2 signaling, accounting for the IBD findings. Indeed, Sphk2–/– T cells exhibited increased expression of activated pSTAT5 in response to IL-2 (Fig. 4, A and B; p < 0.05), suggesting a hyperresponsiveness of Sphk2–/– T cells to IL-2 (17, 18, 19). This did not simply reflect differences in IL-2R expression, because Sphk2–/– T cells possessed generally normal levels of IL-2R subunits as judged by flow cytometry (Fig. 4B) and, in fact, Jak isoform phosphorylation in response to IL-2 was largely normal in Sphk2–/– T cells, indicating generally normal IL-2 signaling upstream of STAT5 phosphorylation (data not shown). Nonetheless, to exclude potentially confounding effects of IL-2R expression, T cells were "primed" with anti-CD3 and anti-CD28 for 24 h to induce the expression of high affinity IL-2R (heterotrimeric IL-2R{alpha}/beta/{gamma}), followed by stimulation with IL-2 for 48 h; still, higher levels of pSTAT5 were elicited in Sphk2–/– T cells (Fig. 4, C and D). The hyperresponse phenotype of Sphk2–/– T cells was reversed by siRNA knockdown of STAT5 (Fig. 4E), demonstrating that the elevated STAT5 activation indeed accounts for hyperactivation in the absence of Sphk2. Thus, Sphk2 is a novel regulator of IL-2 signaling by attenuating STAT5 activation.


Figure 4
View larger version (45K):
[in this window]
[in a new window]

  		FIGURE 4. Enhanced IL-2-STAT5 signaling activity and TCR sensitivity in the absence of Sphk2. A, Naive CD4+ Sphk2–/– T cells exhibit enhanced STAT5 phosphorylation after 30 min of exposure to IL-2 as judged by intracellular flow cytometric analysis of pSTAT5. B, Sphk2+/+ or Sphk2–/– T cells were assessed for expression levels of the IL-2R {alpha} and beta subunits by flow cytometry. Shown are CD4 gated cells. C, CD4+ T cells from Sphk2+/+ and Sphk2–/– mice were stimulated with anti-CD3 for 24 h and then incubated with IL-2 for 48 h. pSTAT5 level was assessed by flow cytometry. D, Whole cell extracts were subjected to Western blot analysis with pSTAT5-specific or total STAT5-specific Abs. All data are representative of at least three experiments. E, Proliferative capacities of CD4+CD25– T cells from Sphk2–/– (squares) vs Sphk2+/+ (diamonds) mice after STAT5 siRNA treatment. CD4+CD25– T cells were electroporated with STAT5-specific (open symbols) or control (filled symbols) siRNAs, rested for 24 h, and stimulated with the indicated amounts of plate-bound anti-CD3. Proliferation was assessed by 3H incorporation after 72 h of incubation.

 
The role of Sphk2 in T cells and inflammation

We have shown that, in the absence of Sphk2, environmental IL-2 and/or TCR ligation leads to enhanced IL-2 signaling, resulting in enhanced proliferation and proinflammatory cytokine production with the potential to exacerbate autoimmune diseases such as IBD. This could reflect a role for Sphk2 in the regulation of activities that modulate STAT5 phosphorylation and activation such as, perhaps, SOCS-3 or SHP-2; however, we have found normal levels of such proteins in Sphk2–/– T cells (not shown). Alternatively, Sphk2 might itself directly regulate STAT5, but this possibility seems less likely given the generally recognized role of phosphorylation in up-regulating STAT5 activation, and the kinase nature of Sphk2 would therefore be expected to promote STAT5 activity. Alternatively, recent studies have shown that STAT5 phosphorylation can be regulated in the nucleus by negative regulators such as T cell protein tyrosine phosphatase (TC-PTP) (20). Therefore, the effect of Sphk2 upon STAT5 phosphorylation may be indirect, perhaps via such a still undefined phosphatase or other signaling molecule. Considering that Sphk2 is predominantly localized in the nucleus (9), Sphk2 could in fact be regulating STAT5 in the nucleus. However, it has also been reported that Sphk2 can interact with cytoplasmic proteins, such as the IL-12Rbeta (11). Regardless, these results demonstrate that Sphk2 regulates STAT5 activation downstream of the IL-2R-Jak signaling complex.

These findings further raise the intriguing possibility that therapeutic enhancement of Sphk2 activity may effectively treat diseases of excess inflammation such as autoimmune diseases including IBD or, conversely, that inhibition of Sphk2 may be desirable for the treatment of diseases characterized by relative immunosuppression such as chronic infections and/or cancers. As such, continued studies on Sphks will hopefully continue to shed insight into the mechanisms by which they modulate inflammatory responses, facilitating therapeutic intervention.


   Acknowledgments
 
We are grateful to Ronald Cohn and Patricia Bailey for expert technical assistance on flow cytometric sorting and histopathology, respectively.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported in part by National Institutes of Health Grant R01 AI057571. Back

2 Address correspondence and reprint requests to Dr. Stanford L. Peng, Mail Stop R7-101, Roche Palo Alto LLC, 3431 Hillview Avenue, Palo Alto, CA 94304. E-mail address: stanford.peng{at}roche.com Back

3 Abbreviations used in this paper: Sphk, sphingosine kinase; IBD, inflammatory bowel disease; pSTAT5, phosphorylated STAT5; siRNA, small interfering RNA; S1P, sphingosine-1-phosphate; Treg, regulatory T cell. Back

Received for publication May 11, 2007. Accepted for publication August 30, 2007.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Disclosures
 References
 

  1. Spiegel, S., S. Milstien. 2003. Exogenous and intracellularly generated sphingosine 1-phosphate can regulate cellular processes by divergent pathways. Biochem. Soc. Trans. 31: 1216-1219. [Medline]
  2. Spiegel, S., S. Milstien. 2003. Sphingosine-1-phosphate: an enigmatic signalling lipid. Nat. Rev. Mol. Cell Biol. 4: 397-407. [Medline]
  3. Liu, H., M. Sugiura, V. E. Nava, L. C. Edsall, K. Kono, S. Poulton, S. Milstien, T. Kohama, S. Spiegel. 2000. Molecular cloning and functional characterization of a novel mammalian sphingosine kinase type 2 isoform. J. Biol. Chem. 275: 19513-19520. [Abstract/Free Full Text]
  4. Pitson, S. M., R. J. D’Andrea, L. Vandeleur, P. A. Moretti, P. Xia, J. R. Gamble, M. A. Vadas, B. W. Wattenberg. 2000. Human sphingosine kinase: purification, molecular cloning and characterization of the native and recombinant enzymes. Biochem. J. 350: 429-441. [Medline]
  5. Pitson, S. M., P. A. Moretti, J. R. Zebol, P. Xia, J. R. Gamble, M. A. Vadas, R. J. D’Andrea, B. W. Wattenberg. 2000. Expression of a catalytically inactive sphingosine kinase mutant blocks agonist-induced sphingosine kinase activation. A dominant-negative sphingosine kinase. J. Biol. Chem. 275: 33945-33950. [Abstract/Free Full Text]
  6. Kharel, Y., S. Lee, A. H. Snyder, S. L. Sheasley-O’neill, M. A. Morris, Y. Setiady, R. Zhu, M. A. Zigler, T. L. Burcin, K. Ley, et al 2005. Sphingosine kinase 2 is required for modulation of lymphocyte traffic by FTY720. J. Biol. Chem. 280: 36865-36872. [Abstract/Free Full Text]
  7. Pappu, R., S. R. Schwab, I. Cornelissen, J. P. Pereira, J. B. Regard, Y. Xu, E. Camerer, Y. W. Zheng, Y. Huang, J. G. Cyster, S. R. Coughlin. 2007. Promotion of lymphocyte egress into blood and lymph by distinct sources of sphingosine-1-phosphate. Science 316: 295-298. [Abstract/Free Full Text]
  8. Zhao, Y., S. K. Kalari, P. V. Usatyuk, I. Gorshkova, D. He, T. Watkins, D. N. Brindley, C. Sun, R. Bittman, J. G. Garcia, et al 2007. Intracellular generation of sphingosine 1-phosphate in human lung endothelial cells: Role of lipid phosphate phosphatase-1 and sphingosine kinase 1. J. Biol. Chem. 282: 14165-14177. [Abstract/Free Full Text]
  9. Igarashi, N., T. Okada, S. Hayashi, T. Fujita, S. Jahangeer, S. Nakamura. 2003. Sphingosine kinase 2 is a nuclear protein and inhibits DNA synthesis. J. Biol. Chem. 278: 46832-46839. [Abstract/Free Full Text]
  10. Liu, H., R. E. Toman, S. K. Goparaju, M. Maceyka, V. E. Nava, H. Sankala, S. G. Payne, M. Bektas, I. Ishii, J. Chun, et al 2003. Sphingosine kinase type 2 is a putative BH3-only protein that induces apoptosis. J. Biol. Chem. 278: 40330-40336. [Abstract/Free Full Text]
  11. Yoshimoto, T., M. Furuhata, S. Kamiya, M. Hisada, H. Miyaji, Y. Magami, K. Yamamoto, H. Fujiwara, J. Mizuguchi. 2003. Positive modulation of IL-12 signaling by sphingosine kinase 2 associating with the IL-12 receptor beta 1 cytoplasmic region. J. Immunol. 171: 1352-1359. [Abstract/Free Full Text]
  12. Thornton, A. M., E. M. Shevach. 2000. Suppressor effector function of CD4+CD25+ immunoregulatory T cells is antigen nonspecific. J. Immunol. 164: 183-190. [Abstract/Free Full Text]
  13. Edsall, L. C., S. Spiegel. 1999. Enzymatic measurement of sphingosine 1-phosphate. Anal. Biochem. 272: 80-86. [Medline]
  14. Kjellev, S., D. Lundsgaard, S. S. Poulsen, H. Markholst. 2006. Reconstitution of Scid mice with CD4+. Int. Immunopharmacol. 6: 1341-1354. [Medline]
  15. Leach, M. W., A. G. Bean, S. Mauze, R. L. Coffman, F. Powrie. 1996. Inflammatory bowel disease in C.B-17 scid mice reconstituted with the CD45RBhigh subset of CD4+ T cells. Am. J. Pathol. 148: 1503-1515. [Abstract]
  16. Yen, D., J. Cheung, H. Scheerens, F. Poulet, T. McClanahan, B. McKenzie, M. A. Kleinschek, A. Owyang, J. Mattson, W. Blumenschein, et alIL-23 is essential for T cell-mediated colitis and promotes inflammation via IL-17 and IL-6. J. Clin. Invest. 116: 1310-1316.
  17. Moriggl, R., D. J. Topham, S. Teglund, V. Sexl, C. McKay, D. Wang, A. Hoffmeyer, J. van Deursen, M. Y. Sangster, K. D. Bunting, et al 1999. Stat5 is required for IL-2-induced cell cycle progression of peripheral T cells. Immunity. 10: 249-259. [Medline]
  18. Moriggl, R., V. Sexl, R. Piekorz, D. Topham, J. N. Ihle. 1999. Stat5 activation is uniquely associated with cytokine signaling in peripheral T cells. Immunity 11: 225-230. [Medline]
  19. Welte, T., D. Leitenberg, B. N. Dittel, B. K. al Ramadi, B. Xie, Y. E. Chin, C. A. Janeway, Jr, A. L. Bothwell, K. Bottomly, X. Y. Fu. 1999. STAT5 interaction with the T cell receptor complex and stimulation of T cell proliferation. Science 283: 222-225. [Abstract/Free Full Text]
  20. Aoki, N., T. Matsuda. 2002. A nuclear protein tyrosine phosphatase TC-PTP is a potential negative regulator of the PRL-mediated signaling pathway: dephosphorylation and deactivation of signal transducer and activator of transcription 5a and 5b by TC-PTP in nucleus. Mol. Endocrinol. 16: 58-69. [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
W.-Q. Lai, A. W. Irwan, H. H. Goh, A. J. Melendez, I. B. McInnes, and B. P. Leung
Distinct Roles of Sphingosine Kinase 1 and 2 in Murine Collagen-Induced Arthritis
J. Immunol., August 1, 2009; 183(3): 2097 - 2103.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Samy, E. T.
Right arrow Articles by Peng, S. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Samy, E. T.
Right arrow Articles by Peng, S. L.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS