The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


The Journal of Immunology, 2007, 179, 5514-5522
Copyright © 2007 by The American Association of Immunologists, Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bafica, A.
Right arrow Articles by Sher, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bafica, A.
Right arrow Articles by Sher, A.

The IFN-Inducible GTPase LRG47 (Irgm1) Negatively Regulates TLR4-Triggered Proinflammatory Cytokine Production and Prevents Endotoxemia1

Andre Bafica2,*,{dagger}, Carl G. Feng*, Helton C. Santiago{ddagger}, Julio Aliberti§, Allen Cheever*, Karen E. Thomas, Gregory A. Taylor||,#, Stefanie N. Vogel and Alan Sher*

* Immunobiology Section, Laboratory of Parasitic Diseases, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892; {dagger} Division of Immunology, Department of Microbiology and Parasitology, Federal University of Santa Catarina, Florianopolis, SC, Brazil; {ddagger} Federal University of Minas Gerais, Belo Horizonte, MG, Brazil; § Division of Molecular Immunology, Cincinnati Children’s Hospital Medical Center, Cincinnati, OH 45229; Department of Microbiology and Immunology, University of Maryland, Baltimore, MD 21201; || Geriatric Research, Education, and Clinical Center, VA Medical Center, and # Department of Medicine, Immunology, and Department of Molecular Genetics and Microbiology, and Center for the Study of Aging, Duke University, Durham, NC 27710


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
LRG47/Irgm1, a 47-kDa IFN-inducible GTPase, plays a major role in regulating host resistance as well as the hemopoietic response to intracellular pathogens. LRG47 expression in macrophages has been shown previously to be stimulated in vitro by bacterial LPS, a TLR4 ligand. In this study, we demonstrate that induction of LRG47 by LPS is not dependent on MyD88 signaling, but rather, requires STAT-1 and IFN-beta. In addition, LRG47-deficient mice are highly susceptible to LPS, but not TLR2 ligand-induced shock, an outcome that correlates with enhanced proinflammatory cytokine production in vitro and in vivo. Further analysis revealed that LPS-stimulated LRG47-deficient macrophages display enhanced phosphorylation of p38, a downstream response associated with TLR4/MyD88 rather than IFN-beta/STAT-1 signaling. In contrast, LPS-induced phosphorylation of IFN regulatory factor-3 and expression of IFN-beta or the type I IFN-regulated genes, CCL5 and CCL10, were unaltered in LRG47–/– cells. Together, these observations indicate that in LPS-stimulated murine macrophages LRG47 is induced by IFN-beta and negatively regulates TLR4 signaling to prevent excess proinflammatory cytokine production and shock. Thus, our findings reveal a new host-protective function for this GTPase in the response to pathogenic encounter.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The p47 GTPase family is a group of IFN-inducible 47- to 48-kDa proteins that are associated with the immune response to pathogens (1). Perhaps the most prominent of these GTPases (2) in terms of its known functional relevance is LRG47 (also referred to as Irgm-1 (3)). LRG47 has been shown to be essential for host resistance to a variety of bacterial and protozoan intracellular pathogens, including Toxoplasma gondii, Trypanosoma cruzi, Listeria monocytogenes, Mycobacterium tuberculosis, and Mycobacterium avium (4, 5, 6, 7, 8). Expression of this molecule is up-regulated in IFN-treated cells, where it is first found associated with the Golgi (3). Upon phagocytosis, LRG47 is recruited to the plasma membrane and remains associated with the mature phagosome (3). Activated macrophages from LRG47-deficient mice have been shown to be impaired in their intracellular killing of several pathogens (6, 8, 9), a phenotype that has been attributed to either retarded phagosomal maturation and lysosomal fusion or defective autophagy (6, 10, 11). In addition, LRG47-deficient animals display impaired hemopoietic responses to infection, and following inoculation with either M. avium or T. cruzi, undergo acute bone marrow (BM)3 failure, a defect associated with abnormal stem cell proliferation (5, 8) (C. Feng, unpublished data). Thus, LRG47 appears to regulate host resistance to infection by at least two distinct mechanisms.

Although LRG47 is induced by both type I and type II IFNs, early experiments indicated that its expression, along with two other p47 GTPase family members, IGTP and IIGP, is also up-regulated following stimulation of macrophages with bacterial LPS, a TLR4 agonist (12, 13). These observations raised the possibility that an additional pathway involving TLR triggering might play a role in the induction of LRG47 expression.

In the case of TLR4, LPS activates two main signaling pathways. The first involves the adapter molecule MyD88 with downstream activation of IL-1R-associated kinases (IRAK)-4 and -1, and the subsequent association of activated IRAK-1 with TNFR-associated factor 6, leading to NF-{kappa}B nuclear translocation as well as phosphorylation of MAPK, such as p38 and JNK (14, 15). The end result of this cascade is the induction of proinflammatory cytokines, including TNF, IL-1beta, and IL-6 (14, 15, 16). The second pathway uses the adapter Toll/IL1 receptor (TIR) domain-containing adapter protein-inducing IFN-beta (TRIF), rather than MyD88, and signals through the trans-acting factor, IFN regulatory factor (IRF)-3, leading to the production of type I IFN (17, 18, 19, 20). Although it was previously thought that MyD88-dependent induction of proinflammatory cytokines is primarily responsible for LPS-induced endotoxemia, recent studies have revealed a critical role for TRIF-dependent IFN-beta expression in the regulation of this toxicity (21, 22, 23, 24), as evidenced by the resistance of TRIF-deficient and IFN-beta-deficient mice to LPS-stimulated shock (21, 25). Importantly, both the MyD88- and TRIF-dependent pathways activated by engagement of LPS by TLR4 are distinct from the IFN-induced STAT1-dependent signaling cascade shown previously to lead to LRG47 up-regulation (1, 5).

In this study, we have analyzed the mechanism by which LPS triggers LRG47 expression, as well as determine the effects of LRG47 deficiency on the outcome of LPS stimulation. Our results indicate that LPS-induced LRG47 expression is dependent on the induction of IFN-beta that, in turn, up-regulates this GTPase through the well-characterized STAT1-dependent pathway. More importantly, we show that LRG47-deficient mice are hyperresponsive to LPS, as evidenced by their increased susceptibility to LPS-induced shock and overproduction of proinflammatory cytokines. Together, our findings indicate that LRG47 is a previously unrecognized negative regulator of the TLR4 signaling pathway and demonstrate a new host-protective function for this GTPase in the response to pathogenic stimulation.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Mice

LRG47–/– and IGTP–/– mice on a C57BL/6J x 129 F1 or C57BL/6 (G. Taylor, unpublished observation; n = 10) background were generated, as previously described (2, 4). MyD88–/– mice backcrossed to C57BL/6 (n = 10) were provided as breeding stock by S. Akira (Osaka University, Osaka, Japan). TRIF–/– mice backcrossed to C57BL/6 (n = 3) or BM cells derived from these animals were supplied by D. Klinman (Food and Drug Administration, Bethesda, MD) and C. Reis e Sousa (Cancer Research U.K., London, U.K.), respectively, from breeding stock originally supplied to these investigators by S. Akira (Osaka University, Osaka, Japan). STAT1-deficient mice (on a C57BL/6J x 129 F1 background) were purchased from The Jackson Laboratory. Wild-type (WT) control B6/129F1 and C57BL/6 mice were obtained from Taconic Farms. IFN-beta–/– mice (>N8 on a C57BL/6 background) were a gift from E. Fish (University of Toronto, Toronto, Canada). All mice were maintained at an Association for Assessment of Laboratory Animal Care-accredited facility at the National Institute of Allergy and Infectious Diseases, National Institutes of Health, or at University of Maryland. Mice of both sexes between 8 and 12 wk of age were used. All experiments were conducted with institutional approval.

TLR agonists and cytokines

Ultrapure Escherichia coli 0111:B04 LPS, poly(I:C), and CpG oligodeoxynucleotides (1826) DNA were purchased from InvivoGen. Protein-free E. coli K235 LPS was described elsewhere (26). The synthetic lipoprotein, S-(2,3-bis(palmitoyloxy)-(2-RS)-propyl)-N-palmitoyl-(R)-Cys-(S)-Ser-Lys4-OH, trihydrochloride (Pam3Cys) was obtained from EMC Microcollections. Recombinant murine IFN-{alpha}, IFN-beta, and IFN-{gamma} were purchased from PBL Medical Laboratories, and IL-10 from PeproTech.

In vivo administration of TLR ligands

For in vivo studies, mice were injected i.p. with 8 mg/kg LPS or Pam3Cys, unless otherwise stated. Two hours later, blood was collected and sera stored at –40°C until analyzed for cytokine levels. In some experiments, spleen and liver were harvested at different time points. In addition, mice were monitored for survival until day 10 postinjection.

Measurement of gene expression by real-time RT-PCR

Total RNA was isolated from spleen or macrophages, as previously described (27). Real-time PCR was performed on an ABI Prism 7900 sequence detection system (Applied Biosystems) using SYBR Green PCR Master Mix after reverse transcription of 1 µg of RNA. The relative amount of PCR product was determined by the comparative cycle threshold method, as described by the manufacturer, in which each sample was normalized to 18S rRNA or Gapdh (25) and expressed as a fold change vs untreated (or uninjected) controls. The following primer pairs were used: for 18S, CACGGCCGGTACAGTGAAAC (forward) and CCCGTCGGCATGTATTAGCT (reverse); for Il-6, GGCCTTCCCTACTTCACAAG (forward) and ATTTCCACGATTTCCACGAG (reverse); for tnf, AAAATTCGAGTGACAAGCCTGTAG (forward) and CCCTTGAAGAGAACCTGGGAGTAG (reverse); for Irg47, TGAGCTCAGCCTTCCCCTTT (forward) and TGGGACAATGTTGCCACAGT (reverse); for cxcl10/ip-10, GCTGCCGTCATTTTCTGC (forward) and TCTCACTGGCCCGTCATC (reverse); for ccl5/RANTES, ACTCCGGTCCTGGGAAAAT (forward) and GCTGATTTCTTGGGTTTCGT (reverse).

Histology

WT and LRG47–/– mice were i.p. injected with 8 mg/kg LPS. Twenty-four hours later, livers were harvested and fixed in 10% neutral buffered formalin for 7 days. Paraffin-embedded sections (5 µm) were stained with H&E and examined at x20 magnification. In situ apoptosis in liver tissues was assessed by TUNEL assay using the Serologicals Apop tag kit (Serologicals) following the manufacturer’s protocol.

Cell populations

Peritoneal macrophages were elicited by i.p. injection of 3 ml of sterile thioglycolate medium (3%), and were subsequently harvested by peritoneal lavage 3 days after injection. Cells (5 x 105 cells/well in 96-well plates) were cultured in complete RPMI 1640 at 37°C, and 4 h later, nonadherent cells were removed, and 200 µl of fresh medium (RPMI 1640 supplemented with 10% heat-inactivated FCS, 100 U/ml penicillin, 100 µg/ml streptomycin, 2 µM glutamine, 10 mM HEPES, and 50 µM 2-ME) was added. For preparation of splenic macrophages, bulk splenocytes were incubated with anti-Mac1/CD11b MicroBeads (Miltenyi Biotec) for 15 min at 4°C, followed by washing in PBS/BSA, and then sorted in an AutoMACS (Miltenyi Biotec). Analysis of the sorted cells showed a purity of >90%. Mac-1 (CD11b)+ and Mac-1-negative cells were stimulated with the indicated concentrations of LPS or Pam3Cys and cultured for 20 h. TNF and IL-6 levels in culture supernatants were determined by ELISA (R&D Systems). IFN-beta levels in culture supernatants were determined by ELISA (PBL Biomedical Laboratories).

BM-derived macrophages (BMM) were generated, as previously described (28). Briefly, BM cells were washed and resuspended in DMEM-10 supplemented with 30% L929 cell-conditioned medium (as a source of M-CSF) and incubated for 7 days at 37°C, 5% CO2.

Gene silencing of LRG47

A peptide nucleic acid (gripNA) was used for gene silencing, according to the manufacturer’s instructions (Active Motif). Briefly, BMM (2 x 105 cells) were transfected with 3 µM FITC-labeled gripNA murine LRG47 (5'-ACTGTGTGATGGTTTCAT-3'; accession U19119) or control gripNA human CREB control (5'-TCCAGATTCCATGGTCAT-3'; accession AY347527) using Charriot II as a transfection reagent. Two hours later, cells were analyzed by FACS, which showed a transfection efficiency of ~75%, and this was confirmed by Western blotting, as previously demonstrated (8). After 12- to 24-h incubation, cells were stimulated with LPS, and TNF was assayed in the supernatants 6 h later.

Western blot analysis and p38 kinase assay

Peritoneal macrophages or BMM (2 x 107 cells) were lysed in mammalian lysis buffer (Pierce) containing protease inhibitors (Phosphatase Inhibitor Cocktail Set II; 1/100; Calbiochem), following the manufacturer’s protocol. Cell lysates (20 µg) were resolved on 4–12% or 10% SDS-polyacrylamide gels (NuPage; Invitrogen Life Technologies) and transferred to nitrocellulose membranes (Invitrogen Life Technologies) by electroblotting. Blots were blocked with 5% nonfat milk and incubated overnight with anti-phospho-I-{kappa}B-{alpha} (Ser32, 1:1000), anti-phospho-p65 (Ser536, 1:1000), anti-phospho-Akt (Ser473 and Thr308, 1:1000), anti-phospho-STAT3 (Tyr705, 1:1000), and anti-STAT3 (1:1000) (all from Cell Signaling Technology); anti-actin (1:1000) (from Sigma-Aldrich); and anti-LRG47 (rabbit, 1:100) (5). After washing with 0.1% TBST, blots were incubated with HRP-conjugated goat anti-rabbit IgG (1:2000; Cell Signaling Technology) and developed using ECL-Plus (Amersham Biosciences). In one set of experiments, protein extracts from peritoneal macrophages mock or LPS stimulated (100 ng/ml) for 30 min were immunoprecipitated, and a p38 kinase assay (Active Motif) was performed by detection of activating transcription factor-2 (ATF-2) phosphorylation by Western blotting.

Statistical analysis

One-way ANOVA with post hoc analyses was used to analyze the significance of differences in means between multiple experimental groups. Survival curves were generated using the Kaplan-Meier method, and the significance of differences was calculated by the log rank test. Statistical significance was defined as p < 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Induction of LRG47 by LPS is dependent on STAT1, TRIF, and IFN-beta

To determine whether LPS induces LRG47 gene expression in vivo, as well as in vitro, as previously described (13), we measured LRG47 mRNA levels in spleens from mice 1 and 3 h following injection with LPS. As shown in Fig. 1A, increased expression of LRG47 mRNA was observed in spleens from either WT or MyD88–/– mice at both time points. This response was severely blunted in similarly injected STAT1–/– animals (Fig. 1B). LPS also triggered LRG47 protein expression in macrophages in vitro to a level comparable to that achieved in response to either IFN-{gamma} or IFN-beta (Fig. 1C), confirming that this TLR4 agonist stimulates translation as well as transcription of the GTPase. Together, these findings suggested that LPS-induced LRG47 expression is not dependent on the MyD88 arm of the TLR4 pathway, but instead, operates through an indirect pathway involving IFN/STAT1 signaling. IFN-beta production is stimulated by LPS/TLR4/TRIF triggering and has been shown to participate in autocrine induction of a variety of STAT1-dependent genes in macrophages (25, 29). Indeed, LRG47 mRNA levels were greatly reduced in LPS-stimulated peritoneal macrophages from TRIF- or IFN-beta-deficient mice (Fig. 1, D and E), indicating that the induction of IFN-beta plays a critical downstream role in the up-regulation of LRG47 expression.


Figure 1
View larger version (34K):
[in this window]
[in a new window]

 
FIGURE 1. In vivo induction of LRG47 by LPS is STAT1 dependent, but MyD88 independent. WT (C57BL/6, A; B6/129 F2, B) or knockout (MyD88–/–, A; STAT1–/–, B) mice were injected with 8 mg/kg LPS i.p., and real-time PCR for LRG47 expression was performed in spleen samples from each group of mice. Results represent mean ± SEM of measurements from four animals. The results shown are representative of two independent experiments. C, Peritoneal macrophages were stimulated with IFN-beta (100 U/ml), IFN-{gamma} (100 U/ml), or LPS (100 ng/ml), and LRG47 protein expression was assayed 4 h later by Western analysis. The results shown are representative of two experiments performed. D, BMM from either B6/129 F2 or TRIF-deficient mice were stimulated with LPS (100 ng/ml), and mRNA LRG47 induction was measured by real-time PCR at different time points. E, Peritoneal macrophages from either C57BL/6 or IFN-beta-deficient mice were stimulated with E. coli K2235 LPS (100 ng/ml), and mRNA LRG47 induction was measured by real-time RT-PCR at different time points. Results represent the mean ± SEM of measurements from two experiments performed.

 
LRG47-deficient mice display increased susceptibility to endotoxin-induced shock

To determine whether the induction of LRG47 expression following TLR4 stimulation has any functional consequences, we inoculated WT and LRG47-deficient mice i.p. with two different doses of LPS and monitored their survival. Consistent with previous studies, WT mice were found to be resistant to both doses of this E. coli LPS preparation (25) (Fig. 2A). In direct contrast, within 2 days postinjection, 100% of the LRG47-deficient mice succumbed to the 8 mg/kg dose of LPS and 50% to the 2 mg/kg dose (Fig. 2A). On the basis of this observation, as well as additional dose-response experiments (data not shown), the LD50 for LPS in LRG47–/– mice was calculated to be 140 vs 700 µg in the WT C57BL/6 controls (data not shown).


Figure 2
View larger version (47K):
[in this window]
[in a new window]

 
FIGURE 2. LRG47-deficient mice succumb to low doses of LPS in vivo and display enhanced immunopathologic responses associated with endotoxemia. A, WT or LRG47-deficient mice were injected with either PBS or LPS (2 or 8 mg/kg/mouse), and survival was monitored. Statistical analysis revealed that the LPS-injected LRG47–/– mice were significantly more susceptible (dose 2 mg/kg, p < 0.05; 8 mg/kg, p < 0.001; log rank test) than WT animals. B, Formalin-fixed, paraffin-embedded liver tissue sections from 24-h LPS-injected mice were stained with H&E (a and b). TUNEL assays performed in liver sections (c and d) revealed that LRG47–/– mice display increased staining for TUNEL-positive cells (some exemplified by arrowheads) compared with those from WT animals. Original magnification, x20. C, WT or LRG47–/– mice were injected with LPS (2 or 8 mg/kg), and 2 h later, sera were collected and TNF was measured by ELISA. D, Sera from WT or LRG47–/– mice were obtained 2 h following i.p. injection with either LPS or Pam3Cys (8 mg/kg/mouse), and TNF was measured by ELISA. E, WT, IGTP–/–, or LRG47–/– mice were injected i.p. with LPS (8 mg/kg/mouse), and TNF was assayed in the sera 2 h later. F, WT or LRG47–/– mice were injected i.p. with LPS (8 mg/kg/mouse), and TNF and IL-6 mRNA levels were detected by real-time PCR in spleen tissue at different time points. The results (C–F) shown are the means ± SEM of measurements from four animals/group. The results shown are representative of two experiments performed. *, A statistically significant difference (p < 0.05) in cytokine measurements between LRG47–/– vs WT mice.

 
Histological analyses performed on liver and spleen from WT and LRG47–/– mice 24 h post-LPS challenge revealed a major difference in the tissue response to endotoxin by the two strains of animals. Sections of liver from LRG47–/– mice displayed increased karyorexis/karyolysis (Fig. 2Bb) as well as TUNEL-positive cells (Fig. 2Bd) when compared with those from the LPS-injected WT animals (Fig. 2B, a and c). Similar response differences were observed in spleen sections and, in particular, in the white pulp areas of the same animal groups (data not shown). Thus, LPS-injected LRG47–/– mice display tissue responses typically observed in animals undergoing endotoxemia (30).

LPS-injected LRG47–/– mice produce exacerbated proinflammatory cytokine responses

Because TNF is thought to play a major role in LPS-induced lethality (31, 32, 33, 34), we analyzed serum levels of the cytokine in WT and LRG47–/– animals following LPS challenge. LRG47–/– mice displayed highly significant increases in systemic TNF levels when compared with WT animals at both LPS doses tested (Fig. 2C). In contrast, WT and LRG47–/– mice produced similar levels of serum TNF when injected with Pam3Cys, a purified TLR2 agonist (Fig. 2D). In addition, no significant increase in TNF production over the WT animal response was observed when mice lacking IGTP (Irgm3), a different member of the p47 IFN-inducible GTPase family, were injected with LPS (Fig. 2E), and no mortality occurred in these animals (data not shown). That the difference in serum TNF levels in WT vs LR47–/– mice reflects changes in transcription of the cytokine gene was confirmed by measurements of TNF mRNA levels in spleens from the same mice (Fig. 2F). In addition to TNF, IL-6 mRNA levels were found to be increased in spleens of LPS-injected LRG47–/– mice vs WT animals (Fig. 2F).

The above findings suggested that LRG47 regulates TLR4-driven proinflammatory cytokine production that is normally controlled by the downstream MyD88-dependent signaling pathway. To investigate whether LRG47 also regulates the TRIF/type I IFN pathway, we measured expression of IFN-beta itself as well as two known type I IFN-inducible genes, cxcl10 and ccl5, in LPS-injected LRG47-deficient vs WT mice in vivo and in LPS-stimulated macrophages in vitro. Consistent with previous observations (21, 29), IFN-beta protein was found to be secreted by macrophages as early as 1 h post-LPS stimulation (Fig. 3A). Interestingly, following LPS exposure, macrophages from LRG47–/– mice displayed similar levels of IFN-beta production compared with those from the WT cells (Fig. 3A). In addition, no major differences in splenic mRNA levels for ifn-beta as well as cxcl10 and ccl5 were observed between the two groups of mice at each of the time points examined (Fig. 3, B–D). Thus, LRG47 appears to selectively regulate the MyD88-dependent proinflammatory cytokine production pathway triggered by TLR4.


Figure 3
View larger version (25K):
[in this window]
[in a new window]

 
FIGURE 3. Unaltered expression of IFN-beta- or IFN-induced genes in LPS-injected LRG47-deficient mice. A, Peritoneal macrophages were stimulated with LPS (100 ng/ml) for several time points, and IFN-beta production was assayed in culture supernatants by ELISA. B–D, WT or LRG47–/– mice were injected i.p. with LPS (8 mg/kg/mouse), and IFN-beta (B), IFN-{gamma}-inducible protein-10 (ccl10) (C), and RANTES (ccl5) (D) mRNA levels were detected by real-time PCR in spleen tissues at different time points. Results are mean ± SEM of measurements from four mice/group. The results shown are representative of two experiments performed.

 
LPS-stimulated LRG47-deficient macrophages display increased proinflammatory cytokine responses

Macrophages are the major source of TNF production in LPS-injected mice (35, 36). For this reason, we next assessed the TNF/IL-6 responses to LPS in macrophages from LRG47-deficient vs WT animals. LPS-stimulated, thioglycolate-elicited peritoneal macrophages from LRG47–/– mice produced significantly higher amounts of TNF and IL-6 than WT macrophages (Fig. 4, A and B). Similar results were also obtained with sort-purified resident Mac-1+ macrophage populations from spleens (Fig. 4C). The enhanced proinflammatory cytokine response of LRG47–/– macrophages appeared to be a feature specific to LPS-stimulated cells, because the same peritoneal macrophage populations produced responses to Pam3Cys (a TLR2 agonist), poly(I:C) (a TLR3 agonist), or type I IFNs (IFN-{alpha} or IFN-beta) (Fig. 4A) that did not differ significantly with those seen with macrophages from WT mice. In addition, no major defects in LPS-triggered cytokine production or costimulatory molecule expression were observed in CD11c+ DC purified from LRG47–/– spleen cells (data not shown). More importantly, when BMM from WT animals were silenced for the lrg47 gene (using a negatively charged, peptide-nucleic acid-based system previously used to block expression of this protein (8)), increased production of both TNF and IL-6 was observed relative to the responses seen in control cells treated with an irrelevant silencing construct (Fig. 4D).


Figure 4
View larger version (30K):
[in this window]
[in a new window]

 
FIGURE 4. LPS induces exacerbated proinflammatory cytokine responses by macrophages from LRG47–/– mice compared with WT cells. A, Peritoneal macrophages were stimulated with Pam3Cys, poly(I:C), LPS, IFN-{alpha}, or IFN-beta for 12 h, and TNF and IL-6 production were assayed in culture supernatants by ELISA. B, Peritoneal macrophages were stimulated with different doses of LPS for 12 h, and TNF (left panel) or IL-6 (right panel) levels were measured in culture supernatants by ELISA. C, Mac-1+ or Mac-1-negative splenic cells, obtained as described in Material and Methods, were either left untreated or stimulated with LPS (100 ng/ml) for 12 h, and TNF production was assayed in culture supernatants by ELISA. Results are mean ± SEM of measurements from triplicate experiments. The results shown are representative of three experiments performed. D, The effect of LRG47 gene silencing on the production of TNF and IL-6 by WT macrophages. WT BMM were transfected with either grip-LRG47 or an irrelevant grip-control sequence, as previously described (8 ), and stimulated with different doses of LPS. Grip-LRG47-transfected cultures show a reduction of 70–80% in LRG47 protein measured by Western blotting (not depicted) (25 ). TNF as well as IL-6 production were detected in the supernatants 24 h later by ELISA. In all panels, *, A statistically significant difference (p < 0.05) in cytokine measurements between LRG47–/– vs WT mice or grip-LRG47 vs grip-control.

 
One possible explanation for the observed exacerbation of proinflammatory cytokine production by the three different LRG47-deficient macrophage populations tested is that in the absence of LRG47 there is decreased expression of anti-inflammatory mediators. An important candidate mediator is IL-10, which has been previously shown to be a major cytokine suppressing LPS-induced endotoxemia (37, 38, 39). Nevertheless, as demonstrated in Fig. 5A, equivalent levels of IL-10 were detected in sera from LPS-injected LRG47–/– mice and WT animals. In addition, no major defect in IL-10-mediated inhibition of TNF (40) was observed in LPS-stimulated LRG47-deficient BMM (Fig. 5B). These data indicate that LRG47–/– mice display no major impairments in either IL-10 responses or IL-10 responsiveness. Lastly, in agreement with these results, phosphorylation of STAT3, a key transcription factor activated by IL-10 in the control of LPS responses (38, 41), was found to be comparable in WT and LRG47–/– macrophages stimulated by either LPS or IL-10 (Fig. 4C). Taken together, these findings suggest that LRG47 controls LPS responses in macrophages by an IL-10-independent pathway.


Figure 5
View larger version (20K):
[in this window]
[in a new window]

 
FIGURE 5. Unimpaired IL-10 responses in LPS-stimulated macrophages from LRG47–/– mice. A, WT or LRG47–/– mice were injected with 8 mg/kg/animal, as in Fig. 2A. Two hours later, sera (four animals/group) were obtained and IL-10 was measured by ELISA. Results are mean ± SEM of measurements from four animals/group. B, Peritoneal macrophages from WT of LRG47–/– mice were incubated with LPS (100 ng/ml) in the absence or presence of IL-10 (1, 10, or 100 ng/ml). TNF was detected in culture supernatants 24 h later by ELISA. Results are mean ± SEM of measurements from triplicate experiments. C, BMM from WT and LRG47–/– were stimulated with LPS (1000 ng/ml) or IL-10 (100 ng/ml) for 4 h, and p-STAT-3, as well as total STAT-3, were detected in protein lysates by Western blotting. The results shown are representative of two experiments performed.

 
LRG47 negatively regulates LPS-induced phosphorylation of NF-{kappa}B and p38 MAPK, but not IRF-3

To examine the mechanisms by which LRG47 regulates LPS-induced proinflammatory cytokine production by macrophages, we analyzed the phosphorylation of the major intracellular signaling molecules downstream from TLR4/MyD88 in both WT and LRG47-deficient macrophages following stimulation with LPS. As shown in Fig. 6A, NF-{kappa}B signaling was found to be slightly enhanced in LPS-stimulated LRG47–/– macrophages, as judged by increased phosphorylation of p65 and p-I{kappa}B-{alpha}, and consistent, but minor differences in I{kappa}-B degradation were also observed (Fig. 6A, and data not shown). In contrast, phosphorylation of p38 MAPK was markedly increased in LRG47-deficient cells (Fig. 6A), and this correlated with enhanced p38-mediated phosphorylation of ATF-2 in a kinase-based assay (Fig. 6B). Consistent with their unaltered IFN-beta responses (Fig. 3), LPS-stimulated macrophages from LRG47–/– mice displayed levels of phosphorylated IRF-3 that were indistinguishable from those seen in WT cells.


Figure 6
View larger version (64K):
[in this window]
[in a new window]

 
FIGURE 6. LPS-stimulated macrophages from LRG47–/– mice display dysregulated activation of NF-{kappa}B as well as p38 MAPK. A, Thioglycolate-elicited peritoneal macrophages were exposed to LPS (100 ng/ml). At different time points, protein extracts were resolved by SDS PAGE and transferred onto nitrocellulose membranes, as described in Materials and Methods. Membranes were probed, stripped, and reprobed with anti-p-p65, anti-I{kappa}B-{alpha}, anti-I{kappa}B, anti-p-38, anti-p-IRF-3, or anti-actin Abs. B, Protein extracts from peritoneal macrophages mock or LPS stimulated (100 ng/ml) for 30 min were immunoprecipitated, and a p38 kinase assay was performed by detection of ATF-2 phosphorylation by Western blotting. C, Protein extracts treated as in A were evaluated for anti-p-Akt and total Akt using specific Abs. The results shown are representative of at least two experiments performed.

 
Because the serine/threonine protein kinase Akt/PKB has previously been shown to regulate TNF production negatively in LPS-treated animals in vivo (42), as well as LPS-stimulated macrophages in vitro (42, 43, 44), we next evaluated phosphorylation of Akt in cells from both WT and LRG47-deficient mice at different time points following in vitro stimulation with LPS. As shown in Fig. 6C, LPS-treated LRG47–/– macrophages displayed a 50–60% reduction in Ser473 phosphorylation and even a greater decrease in Thr308 phosphorylation when compared with WT cells. These findings suggest Akt as a possible target for LRG47-mediated regulation of TLR4 signaling (Fig. 7).


Figure 7
View larger version (21K):
[in this window]
[in a new window]

 
FIGURE 7. Proposed model for the role of LRG47 in TLR4 signaling by macrophages. Following TLR4 stimulation by LPS, macrophages produce type I IFN such as IFN-beta, as well as proinflammatory cytokines such as TNF and IL-6. Induction of LRG47 is dependent on a TRIF-IFN-beta-STAT-1 signaling pathway and negatively regulates expression of MyD88-dependent genes through the regulation of p38 and NF-{kappa}B signaling. (Whether Akt is involved in this process and whether LRG47 directly modulates Akt phosphorylation in LPS-stimulated macrophages remain to be formally addressed.)

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
LRG47 has previously been shown to play a major role in IFN-dependent host resistance to a number of intracellular pathogens (1, 4, 5, 6, 8), a function that has been explained by either defective microbicidal activity or impaired hemopoietic responses to infection. The findings reported in this study reveal a new aspect of LRG47 function, the negative regulation of TLR4-induced proinflammatory cytokine production and its downstream immunopathogical consequences. In this pathway, LRG47 induced by LPS-stimulated IFN-beta production suppresses MyD88/NF-{kappa}B/p38-triggered TNF/IL-6 synthesis by macrophages, thereby protecting the host from the tissue damage and mortality resulting from endotoxin administration.

p47 GTPases, such as LRG47, have been previously characterized as IFN/STAT1-inducible genes (2, 13). As previously reported for IGTP (Irgm3) and IIGP (Irgm6) (12), as well as proinflammatory genes such as nos2, mcp5, and ip10 (25, 29), LPS induction of LRG47 was found to occur by an indirect pathway involving the triggering of IFN-beta that, in turn, stimulates expression of the GTPase gene via the conventional STAT1-dependent pathway. Our experiments demonstrate that LPS-triggered LRG47 expression is MyD88 independent and, therefore, likely to involve the second, TRIF-dependent pathway of endotoxin signaling.

Recent observations by Thomas et al. (25) demonstrated that IFN-beta signaling can cross-regulate basal and inducible expression of many genes induced by the MyD88-dependent arm of the TLR4 cascade triggered by LPS. The data presented in this work extend these findings, as well as establish the existence of a distinct regulatory loop that connects the IFN/STAT1 and MyD88 pathways. Nevertheless, because under conditions of high-dose LPS administration IFN-beta–/– mice are known to be endotoxin hyporesponsive, rather than hypersensitive (21, 25), other IFN-beta-triggered pathways may exist that regulate MyD88-dependent inflammatory responses in addition to those controlled by LRG47.

The enhanced sensitivity of LRG47-deficient mice to LPS-induced tissue pathology and mortality provides direct evidence for the physiological relevance of the negative regulatory loop that is regulated by this GTPase. Interestingly, IGTP–/– mice failed to display the same phenotype in this model, indicating that the protection against endotoxemia afforded by LRG47 is not a general property of all p47 GTPase family members. As is frequently observed in other experimental settings of endotoxic shock (45, 46), the increased sensitivity of LRG47-deficient mice was found to correlate with enhanced systemic production of proinflammatory cytokines, in particular, TNF and IL-6. The dysregulated synthesis of these mediators appears to be a direct effect of LRG47 deficiency rather than the consequence of suppressed production of inhibitory cytokines such as IL-10 (Fig. 6) and TGF-beta (data not shown).

In vitro experiments with three different populations of LRG47-deficient macrophages confirmed that the uncontrolled production of TNF and IL-6 observed in vivo is attributable to the regulation of cytokine gene expression at the cellular level. Because no differences in TLR4 mRNA levels or surface staining with anti-TLR4/MD2 were observed in LRG47–/– vs WT macrophages either before or after LPS stimulation (data not shown), it is unlikely that these effects are due to increased expression of this TLR. Furthermore, LPS-induced expression of IFN-beta-regulated genes was not affected by LRG47 deficiency, supporting the hypothesis that the GTPase selectively regulates the MyD88 signaling pathway triggered by TLR4, suggesting that LRG47 does not promote degradation of TLR4, a mechanism recently shown to be involved in the regulation of cytokine production by a different GTPase (Rab7) (47). Finally, the enhanced proinflammatory cytokine synthesis observed in vitro and in vivo in LPS-stimulated LRG47-deficient mice was not seen following exposure to either TLR2 (Pam3Cys) or TLR3 (poly(I:C)) ligands (Fig. 5, and data not shown). These observations support the concept that LRG47 regulation of the response to LPS requires IFN-beta induction and acts on MyD88-dependent signaling, dual consequences of TLR4, but not of TLR2 triggering. The fact that this effect is not seen upon TLR3 activation is consistent with the fact that TLR3 does not signal through MyD88.

An important question raised by the above observations concerns the mechanism by which LRG47 regulates the MyD88-dependent pathway of TLR4-induced signaling. The data presented in this study indicate that in the absence of LRG47, activation of NF-{kappa}B as well as p38 MAPK is enhanced in LPS-stimulated cells. The latter findings suggest that the GTPase acts upstream of these important signaling elements. In preliminary experiments, we have been unable to demonstrate an association of LRG47 with p38 or Akt by coimmunoprecipitation in LPS-treated macrophages (data not shown), arguing against the existence of a direct interaction of LRG47 with these signaling molecules. Studies are in progress to test for associations of LRG47 with other upstream members of the MyD88-dependent TLR4 signaling cascade (e.g., receptor-interacting protein, TGFbeta-activated kinase 1, and TNFR-associated factor 6 (48, 49)). Such interactions might enhance kinase activity, as has been described in the case of the interplay of several GTPases with different protein kinases (50, 51). Consistent with the unaltered IFN-beta responses in LRG47–/– mice, LPS-stimulated macrophages from WT and LRG47–/– animals showed indistinguishable levels of IRF-3 phosphorylation, indicating that the TRIF pathway of TLR4 signaling is not directly regulated by LRG47. Interestingly, whereas p38 MAPK, and to a lesser extent, NF-{kappa}B activation were found to be enhanced in LPS-treated macrophages from LRG47–/– mice, phosphorylation of Akt was significantly reduced. Akt has previously been shown to negatively regulate the production of proinflammatory mediators in vivo and in vitro (42, 43, 44) and to inhibit the activity of the kinases (MEK1, Raf-1, and MAPK kinase kinase 3/4) crucial for MAPK signaling and NF-{kappa}B activation in macrophages (52). Although the above observations point to Akt as a possible target of LRG47 in the control of TLR4 signaling, it is important to note that studies using endothelial cell lines have indicated that Akt can also play a positive role in the activation of NF-{kappa}B (53), and that although significant, the enhancement of NF-{kappa}B activity observed in LRG47-deficient macrophages did not reach the level previously described in macrophages treated with PI3K-Akt inhibitors (43, 52). Further studies on the downstream effects of Akt inhibition in LRG47-deficient macrophages are needed to assess the involvement of this proposed pathway for LRG47 regulation of LPS-induced proinflammatory cytokine responses.

LRG47 can now be added to the list of factors that negatively regulate LPS signaling (45, 46, 54). These molecules can be expressed on the plasma membrane (e.g., RP105, SIGIRR) (55, 56, 57) and interfere with the initial TLR4-triggering complex or function intracellularly by acting on the downstream signaling cascade (e.g., suppressor of cytokine signaling-1, IRAK-M, MyD88s) (58, 59, 60, 61). LRG47 is similar to suppressor of cytokine signaling-1 in that its activity is inducible by IFN-beta, but it is unique in that it selectively affects the MyD88-dependent arm of the TLR4 signaling pathway without down-regulating the expression of IFN-beta-regulated genes (Fig. 7). This type of regulation may benefit the host by preventing the excessive production of proinflammatory cytokines while leaving the type I IFN-dependent host defense pathway intact.

LRG47-deficient mice display both decreased survival and elevated pathogen loads when infected with intracellular bacteria and protozoa. This phenotype has generally been attributed to impaired macrophage microbicidal activity. However, the increased susceptibility of LRG47–/– animals may also be the result of other defects that would influence host survival. Thus, LRG47-deficient mice infected with mycobacteria or T. cruzi develop a profound pancytopenia and BM failure coinciding with the onset of mortality (5, 8), and in the case of T. cruzi infection, display high circulating levels of TNF before death (8). As revealed in this work, in the absence of LRG47, TLR4-stimulated mice undergo acute inflammation and display enhanced proinflammatory cytokine production, leading to mortality. It is possible that similar mechanisms may be unleashed in infected LRG47–/– mice through the TLR4 agonists present in many of the pathogens studied (or endogenous TLR4 agonists released as a consequence of tissue injury) and contribute to the decreased survival observed. Therefore, the new findings reported in this study, taken together with the previous observations on LRG47 function, support the notion that this GTPase centrally regulates IFN-dependent host responses to pathogens through multiple mechanisms that not only control microbial growth, but also limit the immunopathological consequences of infection.


    Acknowledgments
 
We thank Pat Casper, Sara Hieny, and Sandy White for their invaluable technical assistance; Drs. Shizuo Akira, Dennis Klinman, Neil Rogers, and Caetano Reis e Sousa for providing knockout animals or BM; and Dr. Giorgio Trinchieri for scientific advice.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported in part by the intramural research program of the National Institute of Allergy and Infectious Diseases. This grant was supported in part by National Institutes of Health Grant AI-18797 (to S.N.V.). Back

2 Address correspondence and reprint requests to Dr. Andre Bafica, Immunobiology Section, Laboratory of Parasitic Diseases-National Institute of Allergy and Infectious Diseases-National Institutes of Health, 50 NIH South Drive, Room 6146, Bethesda, MD 20892. E-mail address: abafica{at}niaid.nih.gov Back

3 Abbreviations used in this paper: BM, bone marrow; ATF-2, activating transcription factor-2; BMM, BM-derived macrophage; IRAK, IL-1R-associated kinase; IRF, IFN regulatory factor; Pam3Cys, S-(2,3-bis(palmitoyloxy)-(2-RS)-propyl)-N-palmitoyl-(R)-Cys-(S)-Ser-Lys4-OH, trihydrochloride; TIR, Toll/IL1 receptor; TRIF, TIR domain-containing adapter protein-inducing IFN-beta; WT, wild type. Back

Received for publication May 10, 2007. Accepted for publication August 1, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Taylor, G. A., C. G. Feng, A. Sher. 2004. p47 GTPases: regulators of immunity to intracellular pathogens. Nat. Rev. Immunol. 4: 100-109. [Medline]
  2. Taylor, G. A., M. Jeffers, D. A. Largaespada, N. A. Jenkins, N. G. Copeland, G. F. Woude. 1996. Identification of a novel GTPase, the inducibly expressed GTPase, that accumulates in response to interferon {gamma}. J. Biol. Chem. 271: 20399-20405. [Abstract/Free Full Text]
  3. Bekpen, C., J. P. Hunn, C. Rohde, I. Parvanova, L. Guethlein, D. M. Dunn, E. Glowalla, M. Leptin, J. C. Howard. 2005. The interferon-inducible p47 (IRG) GTPases in vertebrates: loss of the cell autonomous resistance mechanism in the human lineage. Genome Biol. 6: R92[Medline]
  4. Collazo, C. M., G. S. Yap, G. D. Sempowski, K. C. Lusby, L. Tessarollo, G. F. Woude, A. Sher, G. A. Taylor. 2001. Inactivation of LRG-47 and IRG-47 reveals a family of interferon {gamma}-inducible genes with essential, pathogen-specific roles in resistance to infection. J. Exp. Med. 194: 181-188. [Abstract/Free Full Text]
  5. Feng, C. G., C. M. Collazo-Custodio, M. Eckhaus, S. Hieny, Y. Belkaid, K. Elkins, D. Jankovic, G. A. Taylor, A. Sher. 2004. Mice deficient in LRG-47 display increased susceptibility to mycobacterial infection associated with the induction of lymphopenia. J. Immunol. 172: 1163-1168. [Abstract/Free Full Text]
  6. MacMicking, J. D., G. A. Taylor, J. D. McKinney. 2003. Immune control of tuberculosis by IFN-{gamma}-inducible LRG-47. Science 302: 654-659. [Abstract/Free Full Text]
  7. Martens, S., K. Sabel, R. Lange, R. Uthaiah, E. Wolf, J. C. Howard. 2004. Mechanisms regulating the positioning of mouse p47 resistance GTPases LRG-47 and IIGP1 on cellular membranes: retargeting to plasma membrane induced by phagocytosis. J. Immunol. 173: 2594-2606. [Abstract/Free Full Text]
  8. Santiago, H. C., C. G. Feng, A. Bafica, E. Roffe, R. M. Arantes, A. Cheever, G. Taylor, L. Q. Vieira, J. Aliberti, R. T. Gazzinelli, A. Sher. 2005. Mice deficient in LRG-47 display enhanced susceptibility to Trypanosoma cruzi infection associated with defective hemopoiesis and intracellular control of parasite growth. J. Immunol. 175: 8165-8172. [Abstract/Free Full Text]
  9. Butcher, B. A., R. I. Greene, S. C. Henry, K. L. Annecharico, J. B. Weinberg, E. Y. Denkers, A. Sher, G. A. Taylor. 2005. p47 GTPases regulate Toxoplasma gondii survival in activated macrophages. Infect. Immun. 73: 3278-3286. [Abstract/Free Full Text]
  10. Gutierrez, M. G., S. S. Master, S. B. Singh, G. A. Taylor, M. I. Colombo, V. Deretic. 2004. Autophagy is a defense mechanism inhibiting BCG and Mycobacterium tuberculosis survival in infected macrophages. Cell 119: 753-766. [Medline]
  11. Singh, S. B., A. S. Davis, G. A. Taylor, V. Deretic. 2006. Human IRGM induces autophagy to eliminate intracellular mycobacteria. Science 313: 1438-1441. [Abstract/Free Full Text]
  12. Lapaque, N., O. Takeuchi, F. Corrales, S. Akira, I. Moriyon, J. C. Howard, J. P. Gorvel. 2006. Differential inductions of TNF-{alpha} and IGTP, IIGP by structurally diverse classic and non-classic lipopolysaccharides. Cell Microbiol. 8: 401-413. [Medline]
  13. Sorace, J. M., R. J. Johnson, D. L. Howard, B. E. Drysdale. 1995. Identification of an endotoxin and IFN-inducible cDNA: possible identification of a novel protein family. J. Leukocyte Biol. 58: 477-484. [Abstract]
  14. Medzhitov, R., C. A. Janeway, Jr. 1998. Innate immune recognition and control of adaptive immune responses. Semin. Immunol. 10: 351-353. [Medline]
  15. Muzio, M., G. Natoli, S. Saccani, M. Levrero, A. Mantovani. 1998. The human Toll signaling pathway: divergence of nuclear factor {kappa}B and JNK/SAPK activation upstream of tumor necrosis factor receptor-associated factor 6 (TRAF6). J. Exp. Med. 187: 2097-2101. [Abstract/Free Full Text]
  16. Akira, S., S. Uematsu, O. Takeuchi. 2006. Pathogen recognition and innate immunity. Cell 124: 783-801. [Medline]
  17. Fitzgerald, K. A., D. C. Rowe, B. J. Barnes, D. R. Caffrey, A. Visintin, E. Latz, B. Monks, P. M. Pitha, D. T. Golenbock. 2003. LPS-TLR4 signaling to IRF-3/7 and NF-{kappa}B involves the Toll adapters TRAM and TRIF. J. Exp. Med. 198: 1043-1055. [Abstract/Free Full Text]
  18. Hoebe, K., X. Du, P. Georgel, E. Janssen, K. Tabeta, S. O. Kim, J. Goode, P. Lin, N. Mann, S. Mudd, et al 2003. Identification of Lps2 as a key transducer of MyD88-independent TIR signalling. Nature 424: 743-748. [Medline]
  19. Sakaguchi, S., H. Negishi, M. Asagiri, C. Nakajima, T. Mizutani, A. Takaoka, K. Honda, T. Taniguchi. 2003. Essential role of IRF-3 in lipopolysaccharide-induced interferon-beta gene expression and endotoxin shock. Biochem. Biophys. Res. Commun. 306: 860-866. [Medline]
  20. Takeuchi, O., H. Hemmi, S. Akira. 2004. Interferon response induced by Toll-like receptor signaling. J. Endotoxin Res. 10: 252-256. [Medline]
  21. Karaghiosoff, M., R. Steinborn, P. Kovarik, G. Kriegshauser, M. Baccarini, B. Donabauer, U. Reichart, T. Kolbe, C. Bogdan, T. Leanderson, et al 2003. Central role for type I interferons and Tyk2 in lipopolysaccharide-induced endotoxin shock. Nat. Immunol. 4: 471-477. [Medline]
  22. Mahieu, T., J. M. Park, H. Revets, B. Pasche, A. Lengeling, J. Staelens, A. Wullaert, I. Vanlaere, T. Hochepied, F. van Roy, et al 2006. The wild-derived inbred mouse strain SPRET/Ei is resistant to LPS and defective in IFN-beta production. Proc. Natl. Acad. Sci. USA 103: 2292-2297. [Abstract/Free Full Text]
  23. Marino, M. W., A. Dunn, D. Grail, M. Inglese, Y. Noguchi, E. Richards, A. Jungbluth, H. Wada, M. Moore, B. Williamson, et al 1997. Characterization of tumor necrosis factor-deficient mice. Proc. Natl. Acad. Sci. USA 94: 8093-8098. [Abstract/Free Full Text]
  24. Pasparakis, M., L. Alexopoulou, V. Episkopou, G. Kollias. 1996. Immune and inflammatory responses in TNF{alpha}-deficient mice: a critical requirement for TNF{alpha} in the formation of primary B cell follicles, follicular dendritic cell networks and germinal centers, and in the maturation of the humoral immune response. J. Exp. Med. 184: 1397-1411. [Abstract/Free Full Text]
  25. Thomas, K. E., C. L. Galligan, R. Deonarain Newman, E. N. Fish, S. N. Vogel. 2006. Contribution of interferon (IFN)-beta to the murine macrophage response to the TLR4 agonist, lipopolysaccharide. J. Biol. Chem. 281: 31119-31130. [Abstract/Free Full Text]
  26. Hirschfeld, M., Y. Ma, J. H. Weis, S. N. Vogel, J. J. Weis. 2000. Cutting edge: repurification of lipopolysaccharide eliminates signaling through both human and murine Toll-like receptor 2. J. Immunol. 165: 618-622. [Abstract/Free Full Text]
  27. Bafica, A., C. A. Scanga, C. G. Feng, C. Leifer, A. Cheever, A. Sher. 2005. TLR9 regulates Th1 responses and cooperates with TLR2 in mediating optimal resistance to Mycobacterium tuberculosis. J. Exp. Med. 202: 1715-1724. [Abstract/Free Full Text]
  28. Rothfuchs, A. G., C. Trumstedt, H. Wigzell, M. E. Rottenberg. 2004. Intracellular bacterial infection-induced IFN-{gamma} is critically but not solely dependent on Toll-like receptor 4-myeloid differentiation factor 88-IFN-{alpha}beta-STAT1 signaling. J. Immunol. 172: 6345-6353. [Abstract/Free Full Text]
  29. Toshchakov, V., B. W. Jones, P. Y. Perera, K. Thomas, M. J. Cody, S. Zhang, B. R. Williams, J. Major, T. A. Hamilton, M. J. Fenton, S. N. Vogel. 2002. TLR4, but not TLR2, mediates IFN-beta-induced STAT1{alpha}/beta-dependent gene expression in macrophages. Nat. Immunol. 3: 392-398. [Medline]
  30. Carrithers, M., S. Tandon, S. Canosa, M. Michaud, D. Graesser, J. A. Madri. 2005. Enhanced susceptibility to endotoxic shock and impaired STAT3 signaling in CD31-deficient mice. Am. J. Pathol. 166: 185-196. [Abstract/Free Full Text]
  31. Beutler, B., A. Cerami. 1988. Tumor necrosis, cachexia, shock, and inflammation: a common mediator. Annu. Rev. Biochem. 57: 505-518. [Medline]
  32. Beutler, B., D. Greenwald, J. D. Hulmes, M. Chang, Y. C. Pan, J. Mathison, R. Ulevitch, A. Cerami. 1985. Identity of tumor necrosis factor and the macrophage-secreted factor cachectin. Nature 316: 552-554. [Medline]
  33. Freudenberg, M. A., C. Galanos. 1991. Tumor necrosis factor {alpha} mediates lethal activity of killed Gram-negative and Gram-positive bacteria in D-galactosamine-treated mice. Infect. Immun. 59: 2110-2115. [Abstract/Free Full Text]
  34. Tracey, K. J., Y. Fong, D. G. Hesse, K. R. Manogue, A. T. Lee, G. C. Kuo, S. F. Lowry, A. Cerami. 1987. Anti-cachectin/TNF monoclonal antibodies prevent septic shock during lethal bacteremia. Nature 330: 662-664. [Medline]
  35. Carswell, E. A., L. J. Old, R. L. Kassel, S. Green, N. Fiore, B. Williamson. 1975. An endotoxin-induced serum factor that causes necrosis of tumors. Proc. Natl. Acad. Sci. USA 72: 3666-3670. [Abstract/Free Full Text]
  36. Xaus, J., M. Comalada, A. F. Valledor, J. Lloberas, F. Lopez-Soriano, J. M. Argiles, C. Bogdan, A. Celada. 2000. LPS induces apoptosis in macrophages mostly through the autocrine production of TNF-{alpha}. Blood 95: 3823-3831. [Abstract/Free Full Text]
  37. Gerard, C., C. Bruyns, A. Marchant, D. Abramowicz, P. Vandenabeele, A. Delvaux, W. Fiers, M. Goldman, T. Velu. 1993. Interleukin 10 reduces the release of tumor necrosis factor and prevents lethality in experimental endotoxemia. J. Exp. Med. 177: 547-550. [Abstract/Free Full Text]
  38. Matsukawa, A., K. Takeda, S. Kudo, T. Maeda, M. Kagayama, S. Akira. 2003. Aberrant inflammation and lethality to septic peritonitis in mice lacking STAT3 in macrophages and neutrophils. J. Immunol. 171: 6198-6205. [Abstract/Free Full Text]
  39. Standiford, T. J., R. M. Strieter, N. W. Lukacs, S. L. Kunkel. 1995. Neutralization of IL-10 increases lethality in endotoxemia: cooperative effects of macrophage inflammatory protein-2 and tumor necrosis factor. J. Immunol. 155: 2222-2229. [Abstract]
  40. Lang, R., A. L. Pauleau, E. Parganas, Y. Takahashi, J. Mages, J. N. Ihle, R. Rutschman, P. J. Murray. 2003. SOCS3 regulates the plasticity of gp130 signaling. Nat. Immunol. 4: 546-550. [Medline]
  41. Moore, K. W., R. de Waal Malefyt, R. L. Coffman, A. O’Garra. 2001. Interleukin-10 and the interleukin-10 receptor. Annu. Rev. Immunol. 19: 683-765. [Medline]
  42. Schabbauer, G., M. Tencati, B. Pedersen, R. Pawlinski, N. Mackman. 2004. PI3K-Akt pathway suppresses coagulation and inflammation in endotoxemic mice. Arterioscler. Thromb. Vasc. Biol. 24: 1963-1969. [Abstract/Free Full Text]
  43. Guha, M., N. Mackman. 2002. The phosphatidylinositol 3-kinase-Akt pathway limits lipopolysaccharide activation of signaling pathways and expression of inflammatory mediators in human monocytic cells. J. Biol. Chem. 277: 32124-32132. [Abstract/Free Full Text]
  44. Park, Y. C., C. H. Lee, H. S. Kang, H. T. Chung, H. D. Kim. 1997. Wortmannin, a specific inhibitor of phosphatidylinositol-3-kinase, enhances LPS-induced NO production from murine peritoneal macrophages. Biochem. Biophys. Res. Commun. 240: 692-696. [Medline]
  45. Lee, M. S., Y. J. Kim. 2007. Signaling pathways downstream of pattern-recognition receptors and their cross talk. Annu. Rev. Biochem. 76: 447-4480. [Medline]
  46. Liew, F. Y., D. Xu, E. K. Brint, L. A. O’Neill. 2005. Negative regulation of Toll-like receptor-mediated immune responses. Nat. Rev. Immunol. 5: 446-458. [Medline]
  47. Wang, Y., T. Chen, C. Han, D. He, H. Liu, H. An, Z. Cai, X. Cao. 2007. Lysosome-associated small Rab GTPase Rab7b negatively regulates TLR4 signaling in macrophages by promoting lysosomal degradation of TLR4. Blood : 962-971.
  48. Vivarelli, M. S., D. McDonald, M. Miller, N. Cusson, M. Kelliher, R. S. Geha. 2004. RIP links TLR4 to Akt and is essential for cell survival in response to LPS stimulation. J. Exp. Med. 200: 399-404. [Abstract/Free Full Text]
  49. Dong, W., Y. Liu, J. Peng, L. Chen, T. Zou, H. Xiao, Z. Liu, W. Li, Y. Bu, Y. Qi. 2006. The IRAK-1-BCL10-MALT1-TRAF6-TAK1 cascade mediates signaling to NF-{kappa}B from Toll-like receptor 4. J. Biol. Chem. 281: 26029-26040. [Abstract/Free Full Text]
  50. Abell, A. N., A. M. DeCathelineau, S. A. Weed, D. R. Ambruso, D. W. Riches, G. L. Johnson. 2004. Rac2D57N, a dominant inhibitory Rac2 mutant that inhibits p38 kinase signaling and prevents surface ruffling in bone-marrow-derived macrophages. J. Cell Sci. 117: 243-255. [Abstract/Free Full Text]
  51. Monick, M. M., L. S. Powers, N. S. Butler, G. W. Hunninghake. 2003. Inhibition of Rho family GTPases results in increased TNF-{alpha} production after lipopolysaccharide exposure. J. Immunol. 171: 2625-2630. [Abstract/Free Full Text]
  52. Zhang, T. Y., R. A. Daynes. 2007. Glucocorticoid conditioning of myeloid progenitors enhances TLR4 signaling via negative regulation of the phosphatidylinositol 3-kinase-Akt pathway. J. Immunol. 178: 2517-2526. [Abstract/Free Full Text]
  53. Li, X., J. C. Tupper, D. D. Bannerman, R. K. Winn, C. J. Rhodes, J. M. Harlan. 2003. Phosphoinositide 3 kinase mediates Toll-like receptor 4-induced activation of NF-{kappa}B in endothelial cells. Infect. Immun. 71: 4414-4420. [Abstract/Free Full Text]
  54. Fukao, T., S. Koyasu. 2003. PI3K and negative regulation of TLR signaling. Trends Immunol. 24: 358-363. [Medline]
  55. Divanovic, S., A. Trompette, S. F. Atabani, R. Madan, D. T. Golenbock, A. Visintin, R. W. Finberg, A. Tarakhovsky, S. N. Vogel, Y. Belkaid, et al 2005. Negative regulation of Toll-like receptor 4 signaling by the Toll-like receptor homolog RP105. Nat. Immunol. 6: 571-578. [Medline]
  56. Ogata, H., I. Su, K. Miyake, Y. Nagai, S. Akashi, I. Mecklenbrauker, K. Rajewsky, M. Kimoto, A. Tarakhovsky. 2000. The Toll-like receptor protein RP105 regulates lipopolysaccharide signaling in B cells. J. Exp. Med. 192: 23-29. [Abstract/Free Full Text]
  57. Wald, D., J. Qin, Z. Zhao, Y. Qian, M. Naramura, L. Tian, J. Towne, J. E. Sims, G. R. Stark, X. Li. . 2003. SIGIRR, a negative regulator of Toll-like receptor-interleukin 1 receptor signaling. Nat. Immunol. 4: 920-927. [Medline]
  58. Burns, K., S. Janssens, B. Brissoni, N. Olivos, R. Beyaert, J. Tschopp. 2003. Inhibition of interleukin 1 receptor/Toll-like receptor signaling through the alternatively spliced, short form of MyD88 is due to its failure to recruit IRAK-4. J. Exp. Med. 197: 263-268. [Abstract/Free Full Text]
  59. Kinjyo, I., T. Hanada, K. Inagaki-Ohara, H. Mori, D. Aki, M. Ohishi, H. Yoshida, M. Kubo, A. Yoshimura. 2002. SOCS1/JAB is a negative regulator of LPS-induced macrophage activation. Immunity 17: 583-591. [Medline]
  60. Kobayashi, K., L. D. Hernandez, J. E. Galan, C. A. Janeway, Jr, R. Medzhitov, R. A. Flavell. 2002. IRAK-M is a negative regulator of Toll-like receptor signaling. Cell 110: 191-202. [Medline]
  61. Nakagawa, R., T. Naka, H. Tsutsui, M. Fujimoto, A. Kimura, T. Abe, E. Seki, S. Sato, O. Takeuchi, K. Takeda, et al 2002. SOCS-1 participates in negative regulation of LPS responses. Immunity 17: 677-687. [Medline]



This article has been cited by other articles:


Home page
J. Leukoc. Biol.Home page
S. C. Henry, X. G. Daniell, A. R. Burroughs, M. Indaram, D. N. Howell, J. Coers, M. N. Starnbach, J. P. Hunn, J. C. Howard, C. G. Feng, et al.
Balance of Irgm protein activities determines IFN-{gamma}-induced host defense
J. Leukoc. Biol., May 1, 2009; 85(5): 877 - 885.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
R. J Xavier, A. Huett, and J. D Rioux
Autophagy as an important process in gut homeostasis and Crohn's disease pathogenesis
Gut, June 1, 2008; 57(6): 717 - 720.
[Full Text] [PDF]


Home page
J. Immunol.Home page
J. Coers, I. Bernstein-Hanley, D. Grotsky, I. Parvanova, J. C. Howard, G. A. Taylor, W. F. Dietrich, and M. N. Starnbach
Chlamydia muridarum Evades Growth Restriction by the IFN-{gamma}-Inducible Host Resistance Factor Irgb10
J. Immunol., May 1, 2008; 180(9): 6237 - 6245.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bafica, A.
Right arrow Articles by Sher, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bafica, A.
Right arrow Articles by Sher, A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS