|
|
||||||||
B Pathway1


* Department of Pharmacology, College of Medicine, China Medical University, Taichung, Taiwan;
Department of Orthopaedics, Taichung Veterans General Hospital, Taichung, Taiwan; and
Department of Orthopaedics and
Department of Pharmacology, College of Medicine, National Taiwan University, Taipei, Taiwan
| Abstract |
|---|
|
|
|---|
1 small interference RNA. Pretreatment with AMPK inhibitor (araA and compound C), p38 inhibitor (SB203580), NF-
B inhibitor, I
B protease inhibitor, and NF-
B inhibitor peptide also inhibited the potentiating action of adiponectin. Adiponectin increased the kinase activity and phosphorylation of AMPK and p38. Stimulation of synovial fibroblasts with adiponectin activated I
B kinase
/
(IKK
/
), I
B
phosphorylation, I
B
degradation, p65 phosphorylation at Ser (276), p65 and p50 translocation from the cytosol to the nucleus, and
B-luciferase activity. Adiponectin-mediated an increase of IKK
/
activity,
B-luciferase activity, and p65 and p50 binding to the NF-
B element and was inhibited by compound C, SB203580 and AdipoR1 small interference RNA. Our results suggest that adiponectin increased IL-6 production in synovial fibroblasts via the AdipoR1 receptor/AMPK/p38/IKK
and NF-
B signaling pathway. | Introduction |
|---|
|
|
|---|
, complement factor 3a, complement factor B, leptin, resistin, and adiponectin (3, 4, 5, 6, 7, 8). For these molecules, the term "adipocytokines" was introduced (1), which reflects the novel function of adipose tissue as an immunological, endocrine, and paracrine organ. Adiponectin (also known as Acrp30, AdipoQ, and GBP28), an adipocytokine secreted by adipocytes, has been receiving a great deal of attention due to its insulin-sensitizing effects and possible therapeutic use for metabolic disorders (9, 10). Accumulating evidence has suggested a novel link between adipose tissue, adipocytokines, and inflammatory joint disease (11, 12, 13). It has been described in the synthesis of proinflammatory cytokines and growth factors in the infrapatellar fat pad from patients with osteoarthritis (OA)3 (4), and Yamasaki et al. (14) demonstrated that fibroblasts have the potential to transform into adipocytes under the influence of cytokines. Moreover, it has been found that adipocytokine levels (resistin and adiponectin) are greatly elevated in the synovial fluid from patients with OA and rheumatoid arthritis (RA) (15).
IL-6 is a multifunctional cytokine that plays a central role in both innate and acquired immune responses. IL-6 is the predominant mediator of the acute phase response, an innate immune mechanism that is triggered by infection and inflammation (16, 17). IL-6 also plays multiple roles during the subsequent development of acquired immunity against incoming pathogens, including regulation of the expressions of cytokine and chemokine, stimulation of Ab production by B cells, regulation of macrophage and dendritic cell differentiation, and the response of regulatory T cells to microbial infection (16, 17). In addition to these roles in pathogen-specific inflammation and immunity, IL-6 levels are elevated in chronic inflammatory conditions, such as RA (18, 19). Several consensus sequences, including those for NF-
B, CREB, NF-IL-6, and AP-1 in the 5' promoter region of the IL-6 gene, have been identified as regulatory sequences that induce IL-6 in response to various stimuli (20, 21). NF-
B, a key transcription factor that regulates IL-6 expression, is a dimer of either transcription factor p65 or transcription factor p50 (22). In a resting state, this dimer is associated with I
Bs to retain NF-
B in the cytosol (23). I
B kinase (IKK), which is activated through stimulation by cytokines and bacterial products, phosphorylates I
B
at Ser (32) and Ser (36) and I
B
at Ser (19) and Ser (23) (24, 25), to produce ubiquitination of I
B
/
at lysine residues and degradation by the 26S proteasome (26).
Adiponectin was originally described as an adipocytokine exclusively expressed by adipose tissue (1). Interestingly, adiponectin shares strong homologies with the complement factor C1q and the proinflammatory cytokine TNF-
. Thus, it belongs to the C1q-TNF-superfamily, the members of which are thought to be derived from a common progenitor molecule and to share common (proinflammatory) functions (27). Adiponectin activates intracellular signaling pathways by activation of 5'-AMP-activated protein kinase (AMPK). Treatment with adiponectin or ectopic expression of its receptors has been shown to increase AMPK phosphorylation and fatty acid oxidation in muscles, and this effect was abolished by the use of dominant-negative AMPK (28, 29). However, the signaling pathway for adiponectin on IL-6 production in synovial fibroblasts is mostly unknown. In the present study, we explored the intracellular signaling pathway involved in adiponectin-induced IL-6 production in synovial fibroblast cells. The results show that adiponectin activates AdipoR1 receptor and results in the activation of AMPK/p38/IKK
and NF-
B, leading to up-regulation of IL-6 expression.
| Materials and Methods |
|---|
|
|
|---|
Protein A/G beads, anti-mouse and anti-rabbit IgG-conjugated HRP, rabbit polyclonal Abs specific for I
B
, p-I
B
, IKK
/
, p65, p50, p-p38, p38, and GST-I
B
fusion protein were purchased from Santa Cruz Biotechnology. Rabbit polyclonal Ab specific for AMPK
phosphorylated at Thr (172), IKK
/
phosphorylated at Ser180/181, p65 phosphorylated at Ser (276), AMPK
, AMPK
1, and AMPK
2 were purchased from Cell Signaling and Neuroscience. NF-
B inhibitor (PDTC), I
B protease inhibitor (TPCK), SB203580, 5-aminoimidazole-4-carboxamide ribonucleoside (AICAR), compound C, and adenosine-9-
-D-arabino-furanoside (AraA) were obtained from Calbiochem. The NF-
B inhibitor peptide (in a cell-permeable form) was purchased from Biomol. IL-6 enzyme immunoassay kit was purchased from Cayman Chemical. [
-32P]ATP was purchased from Amersham Biosciences. The NF-
B luciferase plasmid was purchased from Stratagene. The IKK
(KM) and IKK
(KM) mutants were gifts from Dr. H. Nakano (Juntendo University, Tokyo, Japan). The p38 dominant negative mutant was provided by Dr. J. Han (Southwestern Medical Center, Dallas, TX). pSV-
-galactosidase vector, luciferase assay kit was purchased from Promega. All other chemicals were obtained from Sigma-Aldrich.
Cell cultures
Synovial tissues were obtained from ten patients with RA and ten patients with OA undergoing knee replacement surgeries (Taichung Veterans General Hospital, Taichung, Taiwan). Patients with RA and OA are fulfilled with diagnostic criteria of American College of Rheumatology (ACR), respectively (46, 47). All of rheumatic arthritis received at least 3 years of DMARD, steroid, or anti-inflammatory drugs therapy. Fresh synovial tissues were minced and digested in a solution of collagenase, and DNase. Isolated fibroblasts were filtered through 70 µM nylon filters. The cells were grown on the plastic cell culture dishes in 95% air-5% CO2 with RPMI 1640 (Invitrogen Life Technologies) which was supplemented with 20 mM HEPES and 10% heat-inactivated FBS, 2 mM-glutamine, penicillin (100 U/ml), and streptomycin (100 µg/ml) (pH adjusted to 7.6). Fibroblasts from passages four to nine were used for the experiments.
Measurements of IL-6 production
Human synovial fibroblasts were cultured in 24-well culture plates. After reaching confluence, cells were treated with 0.1 µg/ml, 0.3 µg/ml, 1 µg/ml, 3 µg/ml, 10 µg/ml, 30 µg/ml human full-length adiponectin (Catalog no. 1065-AP; R&D Systems), and then incubated in a humidified incubator at 37°C for 24 h. For examination of the downstream signaling pathways involved in adiponectin treatment, cells were pretreated with various inhibitors (ara A (0.5 mM); compound C (10 µM); SB203580 (10 µM); PDTC (60 µM); TPCK (3 µM); NF-
B inhibitor peptide (10 µg/ml)) for 30 min before adiponectin (3 µg/ml) administration. After incubation, the medium was removed and stored at –80°C until assay. IL-6 in the medium was assayed using the IL-6 enzyme immunoassay kits, according to the procedure described by the manufacturer.
siRNA transfection
Two pairs of small-interfering RNAs (siRNAs) were synthesized by MDBio. The sequences of human AdipoR1 and AdipoR2 siRNAs were used as previously described (29). The siRNA against human AMPK
1 and AMPK
2 were purchased from Santa Cruz Biotechnology. Cells were transfected with siRNAs (0.4 nmol) using Lipofectamine 2000 (Invitrogen Life Technology) according to the manufacturers instructions.
mRNA analysis by reverse transcriptase-PCR (RT-PCR)
Total RNA was extracted from synovial fibroblasts using a TRIzol kit (MDBio). The reverse transcription reaction was performed using 2 µg of total RNA that was reverse transcribed into cDNA using oligo(dT) primer, then amplified for 33 cycles using two oligonucleotide primers: IL-6: AAATGCCAGCCTGCTGACGAAG and AACAACAATCTGAGGTGCCCATGCTAC; AdipoR1: CCTTTCCCCAAGCTGAAGCTGC and CCTTGACAAAGCCCTCAGCGAT; AdipoR2: AACGAGCCAACAGAAAAC CGATTG and ATACACACAGAAACAGGCAACATTTG; GAPDH: AAGCCCATCACCATCTTCCAG and AGGGGCCATCCACAGTCTTCT (30).
Each PCR cycle was conducted for 30 s at 94°C, 30 s at 55°C, and 1 min at 68°C.
PCR products were then separated electrophoretically in a 2% agarose DNA gel and stained with ethidium bromide.
Western blot analysis
The cellular lysates were prepared as described previously (31). Proteins were resolved on SDS-PAGE and transferred to Immobilon polyvinyldifluoride (PVDF) membranes. The blots were blocked with 4% BSA for 1 h at room temperature and then probed with rabbit anti-human Abs against I
B
, IKK
, p65, p50 or p-AMPK (1/1000) for 1 h at room temperature. After three washes, the blots were subsequently incubated with a donkey anti-rabbit peroxidase-conjugated secondary Ab (1/1000) for 1 h at room temperature. The blots were visualized by ECL using Kodak X-OMAT LS film (Eastman Kodak). Quantitative data were obtained using a computing densitometer and ImageQuant software (Molecular Dynamics).
Transfection and reporter gene assay
Human synovial fibroblasts were cotransfected with 0.8 µg
B-luciferase plasmid, 0.4 µg
-galactosidase expression vector. Fibroblasts were grown to 80% confluent in 12 well plates and were transfected on the following day by Lipofectamine 2000 (LF2000; Invitrogen Life Technologies). DNA and LF2000 were premixed for 20 min and then applied to the cells. After 24 h transfection, the cells were then incubated with the indicated agents. After further 24 h incubation, the medium were removed, and cells were washed once with cold PBS. To prepare lysates, 100 µl reporter lysis buffer (Promega) was added to each well, and cells were scraped from dishes. The supernatant was collected after centrifugation at 13,000 rpm for 2 min. Aliquots of cell lysates (20 µl) containing equal amounts of protein (20–30 µg) were placed into wells of an opaque black 96-well microplate. An equal volume of luciferase substrate was added to all samples, and luminescence was measured in a microplate luminometer. The value of luciferase activity was normalized to transfection efficiency monitored by the cotransfected
-galactosidase expression vector.
Preparation of nuclear extracts
The nuclear extracts were prepared as described previously (32). Cells were harvested and suspended in hypotonic buffer A (10 mM HEPES (pH 7.6), 10 mM KCl, 1 mM DTT, 0.1 mM EDTA, and 0.5 mM PMSF) for 10 min on ice and vortexed for 10 s. Nuclei were pelleted by centrifugation at 12,000 x g for 20 s. The supernatants containing cytosolic proteins were collected. A pellet containing nuclei was suspended in buffer C (20 mM HEPES (pH 7.6), 1 mM EDTA, 1 mM DTT, 0.5 mM PMSF, 25% glycerol, and 0.4 M NaCl) for 30 min on ice. The supernatants containing nuclei proteins were collected by centrifugation at 12,000 x g for 20 min and stored at –70°C.
AMPK in vitro kinase assay
AMPK activity assays were conducted as previously described (33). In brief, total cell extracts were prepared from synovial fibroblasts in 1x radioimmunoprecipitation assay buffer and precipitated with saturated ammonium sulfate solution (final concentration 35%). Assays were performed at 30°C for 10 min in 25 µl reaction mixtures containing 5 µg protein extracts in a reaction buffer (40 mmol/l HEPES (pH 7.0), 80 mmol/l NaCl, 5 mmol/l magnesium acetate, 1 mmol/l DTT, 200 µmol/l each of AMP and ATP, and 2 µCi [
-32P] ATP) with or without 200 µmol/l SAMS peptide (Upstate). For immunoprecipitated kinase assays, cell lysates were immunoprecipitated with anti-AMPK-
1 or AMPK
2 Abs (Upstate), washed with 40 mmol/l HEPES (pH 7.0), and suspended in 20 µl reaction buffer. The reaction mixtures were spotted onto P81 cation exchange papers, washed three times with 1% phosphoric acid, and measured using a scintillation counter. AMPK activity was expressed as [32P] incorporated per microgram of protein.
Protein kinase assays
The cellular lysates were prepared as described previously (34). Equal amounts of protein were incubated with specific Abs against p38 or IKK
/
in the presences of protein A/G-agarose beads for 12 h at 4°C with gentle rotation. The beads were washed three times with lysis buffer and two times with kinase buffer (20 mM HEPES, pH 7.4, 20 mM MgCl2, and 2 mM DTT). The kinase reactions were performed by incubating immunoprecipitated beads with 20 µl of kinase buffer (20 mM ATP and 3 µCi of [
-32P]ATP) at 30°C for 30 min. To assess p38 and IKK
/
activities, 2 µg of MBP and 0.5 µg of GST-I
B
were added as the substrate. The reaction mixtures were analyzed by SDS-PAGE followed by autoradiography.
DNA affinity protein-binding assay (DAPA)
Binding of transcription factors to the IL-6 promoter DNA sequences was assayed, as described (21). Following treatment with adiponectin, nuclear extracts were prepared. Biotin-labeled double-stranded oligonucleotides (2 µg) synthesized based on the IL-6 promoter sequence, were mixed at room temperature for 1 h with shaking with 200 µg nuclear extract proteins, and 20 µl streptavidin agarose beads in a 70% slurry. Beads were pelleted and washed three times with cold PBS, then the bound proteins separated by SDS-PAGE, followed by Western blot analysis with specific Abs.
Chromatin immunoprecipitation assay
Chromatin immunoprecipitation (ChIP) analysis was performed as described previously (32). DNA immunoprecipitated by anti-p65 or anti-p50 Ab was purified. The DNA was then extracted with phenol-chloroform. The purified DNA pellet was subjected to PCR. PCR products were then resolved by 1.5% agarose gel electrophoresis and visualized by UV.
The primers: 5'-CAAGACATGCCAAAGTGCTG-3' and 5'-TTGAGACTCATGGGAAAATCC-3' were used to amplify across the human IL-6 promoter region (–288 to –39).
Statistics
For statistical evaluation, Mann-Whitney U test for non-Gaussian parameters and Students t test for Gaussian parameters (including Bonferroni correction). The difference is significant if the p value is <0.05.
| Results |
|---|
|
|
|---|
Adiponectin is significantly higher in synovial fluid of patients with osteoarthritis and rheumatoid arthritis (15). Human synovial fibroblast was chosen to investigate the signal pathways of adiponectin in the production of IL-6, an inflammatory response gene. Treatment of rheumatoid arthritis synovial fibroblast (RASF) or osteoarthritis synovial fibroblast (OASF) with adiponectin (0.1–30 µg/ml) for 24 h induced IL-6 production in a concentration-dependent manner (Fig. 1A), this induction occurred in a time-dependent manner (Fig. 1B). After adiponectin (10 µg/ml) treatment for 24 h, the amount of IL-6 released had increased in both RASF and OASF cells (Fig. 1B). To further confirm this stimulation-specific mediation by adiponectin without LPS contamination, polymyxin B, an LPS inhibitor, was used. We found that polymyxin B (1 µM) completely inhibited LPS (1 µM)-induced IL-6 release. However, it had no effect on adiponectin (10 µg/ml)-induced IL-6 release in both RASF and OASF (Fig. 1, C and D).
|
AdipoR1 is expressed abundantly in skeletal muscle, and AdipoR2 is predominantly expressed in liver (29). However, little is known about the expression of AdipoR1 and AdipoR2 in synovial fibroblasts. To investigate the role of AdipoR1 and AdipoR2 subtype receptors in adiponectin-mediated increase of IL-6 production, we assessed the distribution of these adiponectin receptor subtype receptors in human synovial fibroblasts by RT-PCR analysis. The mRNAs of AdipoR1 and AdipoR2 subtype receptors could be detected in RASF and OASF (Fig. 2A). Upon adiponectin treatment for 12 h, the mRNA levels of IL-6 and AdipoR1subtype receptor were evidently increased, whereas other subtypes AdipoR2 receptor mRNA remained unchanged (Fig. 2A). We next examined which adiponectin subtype receptors are involved in the adiponectin-mediated increase of IL-6 release, specific inhibition of AdipoR1 receptor expression was accomplished with siRNA (Fig. 2B). It was found that AdipoR1 receptor-specific siRNA but not AdipoR2 siRNA or control siRNA significantly blocked adiponectin-mediated increase of IL-6 production in human RASF and OASF by using RT-PCR and ELISA (Fig. 2, C and D). These results suggest that AdipoR1 may be involved in adiponectin-induced IL-6 expression and release in human synovial fibroblasts.
|
Adiponectin has been shown to increase fatty acid oxidation via activation of AMPK (35). Fig. 3, A and B show that adiponectin enhanced AMPK
phosphorylation at the Thr (172) and activity in a time-dependent manner. Pretreatment of cells for 30 min with AMPK inhibitors (araA (0.5 mM) or compound C (10 µM)) and transfection with AdipoR1 siRNA markedly attenuated the adiponectin-induced AMPK kinase activity (Fig. 3C). Fig. 3D also shows that adiponectin-induced IL-6 production was inhibited by araA or compound C in human RASF and OASF. In addition, treatment of cells with araA (0.5 mM) or compound C (10 µM) did not affect cell viability, which was assessed by the MTT assay (data not shown). In an attempt to determine which catalytic subunit of AMPK
1 or AMPK
2 mediated adiponectin signaling in human synovial fibroblasts, we performed in vitro kinase assay using Abs specific for each isoform. The kinase activity of both
1 and
2 isoforms was increased by adiponectin treatment, the
1 isoform by 3-fold and
2 isoform by
50% (Fig. 3E). In addition, treatment of cells with 5-Aminoimidazole-4-caroxamide-1-
-D-ribofuranoside (AICAR; 1 mM), which activates AMPK after being metabolized to 5-aminoimidazole-4-caroxamide-1-
-D-ribofuranoside-5-monophosphate in the cells, also increased the kinase activity of AMPK
1 and AMPK
2 (Fig. 3E). To further examine whether AMPK
1 activation is involved in the signal transduction pathway leading to IL-6 production by adiponectin, the AMPK
1 siRNA was used. AMPK
1 siRNA specifically inhibited the expression of AMPK
1 but not AMPK
2 (Fig. 3F). Fig. 3G also shows that adiponectin-induced IL-6 production was inhibited by AMPK
1 siRNA. In addition, AMPK
2 siRNA also slightly attenuated adiponectin-induced IL-6 production. Therefore, AMPK
1 is much more important in adiponectin-induced IL-6 release, although the role of AMPK
2 cannot be ruled out. It was recently reported that adiponectin activates p38 MAPK in addition to AMPK in C2C12 cells (29), we tested whether p38 might also be involved in adiponectin-induced IL-6 production. As shown in Fig. 4A, treatment of fibroblasts with adiponectin resulted in a time-dependent phosphorylation of p38. Next, we directly examined p38 kinase activity in response to adiponectin. In vitro p38 kinase activity was measured using MBP as a p38 exogenous substrate. Fig. 4B shows that treatment of fibroblasts with adiponectin induced an increase in p38 activity began 5 min, peaked at 10–30 min. We also found that pretreatment of cells for 30 min with araA, compound C or transfection with AdipoR1 siRNA markedly inhibited the adiponectin-induced p38 activity (Fig. 4C). We then investigated the role of p38 in mediating adiponectin-induced IL-6 expression using the specific p38 inhibitor SB203580. Pretreatment of cell with SB203580 (10 µM) or transfection with dominant negative mutant of p38 attenuated adiponectin-induced IL-6 production (Fig. 4D). In addition, treatment of cells with SB203580 (10 µM) did not affect cell viability, which was assessed by the MTT assay (data not shown). Next, we examine the relationship of AMPK and p38, when AMPK was chemically inhibited with compound C, the stimulation of AMPK phosphorylation and activity was attenuated. In contrast, inhibition of p38 with SB203580 did not affect adiponectin-induced phosphorylation and activity of AMPK. Similar results were obtained when AMPK was directly activated using AICAR (Fig. 4, E and F). AICAR increase the phosphorylation and kinase activity of AMPK and these effects were inhibited by compound C but not SB203580 (Fig. 5, E and F). Therefore, these results indicated that p38 may function as a downstream signaling molecule of AMPK in the adiponectin signaling pathway.
|
|
|
B in adiponectin-induced IL-6 production
NF-
B activation has been reported to be necessary for IL-6 induction in macrophages (36). To examine whether NF-
B activation is involved in the signal transduction pathway leading to IL-6 expression caused by adiponectin, the NF-
B inhibitor pyrrolidine dithiocarbamate (PDTC) was used. Fig. 5A shows that PDTC (30 µM) inhibited the enhancement of IL-6 production induced by adiponectin. Furthermore, pretreatment of synovial fibroblasts with an I
B protease inhibitor (L-1-tosylamido-2-phenylenylethyl chloromethyl ketone (TPCK, 3 µM)) and NF-
B inhibitor peptide (10 µg/ml) (36) also antagonized the potentiating action of IL-6 (Fig. 5A). In addition, treatment of cells with PDTC (30 µM), TPCK (3 µM) or NF-
B inhibitor peptide (10 µg/ml) did not affect cell viability, which was assessed by the MTT assay (data not shown). It has been report that the NF-
B binding site between –72 and –63 was important for the activation of the IL-6 gene (21). NF-
B activation was further evaluated by analyzing the translocation of NF-
B from cytosol to the nucleus, as well as by DNA affinity protein-binding assay (DAPA) and chromatin immunoprecipitation (ChIP) assay. Treatment of cells with adiponectin resulted in a marked translocation of p65 and p50 NF-
B from the cytosol to the nucleus (Fig. 5B). DAPA experiments showed a time-dependent increase in the binding of p65 and p50 to the NF-
B element on the IL-6 promoter after adiponectin treatment (Fig. 5C). The in vivo recruitment of p65 and p50 to the IL-6 promoter (–288 to –39) was assessed by ChIP assay. In vivo binding of p65 and p50 to the NF-
B element of IL-6 promoter occurred as early as 10 min and sustained to 60 min after adiponectin stimulation (Fig. 5D). The binding of p65 and p50 to NF-
B element by adiponectin stimulation was attenuated by compound C, SB203580 and AdipoR1 siRNA (Fig. 5E). To further confirm the NF-
B element involved in the action of adiponectin-induced IL-6 expression, transient transfection was performed using the
B promoter-luciferase constructs. Synovial fibroblasts incubated with adiponectin (3 µg/ml) led to a 3.1-fold increase in
B promoter activity. The increase of
B activity by adiponectin was antagonized by araA, compound C and SB203580 (Fig. 5F). These results suggest that NF-
B activation is necessary for adiponectin-induced IL-6 production in human synovial fibroblasts.
Adiponectin causes an increase in IKK
/
phosphorylation, I
B
phosphorylation and I
B
degradation
We further examined the upstream molecules involved in adiponectin-induced NF-
B activation. Stimulation of cells with adiponectin induced IKK
/
phosphorylation and activity in a time-dependent manner (Fig. 6, A and B). Pretreatment of cells with compound C and SB203580 or transfection with AdipoR1 siRNA attenuated adiponectin-induced IKK
/
activity (Fig. 6C). Furthermore, transfection with IKK
or IKK
mutant markedly inhibited the adiponectin-induced IL-6 production (Fig. 6D). These data suggest that IKK
/
activation is involved in adiponectin-induced IL-6 production in human synovial fibroblasts. Treatment with synovial fibroblasts with adiponectin also caused I
B
phosphorylation and I
B
degradation in a time-dependent manner (Fig. 6E). Next, we further examined p65 phosphorylation at Ser (276) by adiponectin in synovial fibroblasts. Treatment of cells with adiponectin induced p65 phosphorylation at Ser (276) in a time-dependent manner (Fig. 6F).
|
| Discussion |
|---|
|
|
|---|
1 was more important than AMPK
2 in the adiponectin-induced IL-6 production. Third, IKK
/NF-
B pathway was involved in adiponecitn-induced IL-6 release. Fourth, the potentiation of IL-6 by adiponectin required an activation of the AdipoR1 receptor, AMPK
1, p38, IKK
and NF-
B signaling pathway. Fifth, the same signaling pathway was required for adiponectin-induced IL-6 production in both RASF and OASF. Our findings suggest that adiponectin acts as an inducer of inflammatory cytokines such as IL-6 and as an enhancer of the inflammatory response in RA and OA. Two adiponectin receptors, AdipoR1 and AdipoR2, that mediated the biological effects of adiponectin was identified recently (29). AdipoR1 is a high-affinity receptor for globular adiponectin and a low-affinity receptor for the full-length ligand, whereas AdipoR2 is an intermediate-affinity receptor for both forms of adiponectin (29). AdipoR1 is abundantly expressed in skeletal muscle, whereas AdipoR2 is predominantly expressed in the liver. However, the express of AdipoR1 or AdipoR2 receptors in synovial fibroblast are large unknown. We found that RASF and OASF cells express both AdipoR1 and AdipoR2 receptor isoforms by RT-PCR analysis. In addition, adiponectin increases the expression of IL-6 and AdipoR1 but not AdipoR2. Furthermore, transfection with AdipoR1 but not AdipoR2 siRNA antagonized the adiponectin-induced IL-6 production. These results suggest that AdipoR1 is an upstream receptor in adiponectin-induced IL-6 release.
AMPK is a heterotrimeric serine/threonine kinase composed of
catalytic a subunit and regulatory
and
subunit (39). It has been previously shown that AMPK is involved in the signaling pathway for the metabolic effects of adiponectin (39). We demonstrated that the AMPK inhibitors ara A and compounds C antagonized the adiponectin-mediated potentiation of IL-6 expression, suggesting that AMPK activation is an obligatory event in adiponectin-induced IL-6 expression in these cells. In an attempt to determine which catalytic subunit of AMPK
1 or
2 mediated adiponectin signaling in human synovial fibroblasts. We found that adiponectin and AICAR (AMPK activator) increased kinase activity of AMPK
1 but only slightly increased the kinase activity of AMPK
2. This was further confirmed by the results that the siRNA of AMPK
1 inhibited the enhancement of IL-6 production by adiponectin. However, only slightly effect of AMPK
2 siRNA in adiponectin-induced IL-6 expression. Therefore, AMPK
1 is much more important in adiponectin-induced IL-6 release. Although we cannot ruled out the effect of AMPK
2 in adiponectin-induced IL-6 production in synovial fibroblasts. It has been reported that AMPK interacts with p38 to regulated glucose metabolism (40). We examined the potential role of p38 in the signaling pathway adiponectin-induced IL-6 expression. Pretreatment of synovial fibroblasts for 30 min with SB203580 or transfection with p38 mutant for 24 h markedly attenuated the adiponectin-induced IL-6 production. In addition, we also found that treatment of synovial fibroblasts with adiponectin induced increases in p38 phosphorylation and kinase activity. These effects were inhibited by araA, compound C and AdipoR1 siRNA, indicating the involvement of AdipoR1-AMPK-dependent p38 activation in adiponectin-mediated IL-6 induction. It has also reported that AMPK is downstream molecule of p38 in the control of myocardial glucose metabolism (41). In this study, we found that p38 inhibitor SB203580 cannot antagonized the adiponectin or AICAR-increased AMPK phosphorylation and kinase activity. Therefore, these results indicated that p38 may function as a downstream signaling molecule of AMPK in the adiponectin signaling pathway.
There are several binding sites for a number of transcription factors including NF-
B, CREB, NF-IL-6, and AP-1 box in the 5' region of the IL-6 gene (20, 21). Recent studies on the IL-6 promoter have demonstrated that IL-6 induction by several transcription factors occurs in a highly stimulus-specific or cell-specific manner. For example, NF-
B has been shown to control the induced transcription of IL-6 in mouse macrophages (36). In osteoblasts, vasoactive intestinal peptide-induced IL-6 expression is mediated by AP-1 and CREB (42). The results of this study show that NF-
B activation contributes to adiponectin-induced IL-6 production in synovial fibroblasts, and that the inhibitors of the NF-
B-dependent signaling pathway, including PDTC, TPCK or NF-
B inhibitor peptide inhibited adiponectin-induced IL-6 expression. In an inactivated state, NF-
B is normally held in the cytoplasm by the inhibitor protein I
B. Upon stimulation, such as by TNF-
, I
B proteins become phosphorylated by the multisubunit IKK complex, which subsequently targets I
B for ubiquitination, and then are degraded by the 26S proteasome. Finally, the free NF-
B translocates to the nucleus, where it activates the responsive gene (43). In the present study, we found that treatment of synovial fibroblasts with adiponectin resulted in increases in IKK
/
phosphorylation and activity, p65 and p50 translocation from the cytosol to the nucleus, and the binding of p65 and p50 to NF-
B element on IL-6 promoter. Using transient transfection with
B-luciferase as an indicator of NF-
B activity, we also found that adiponectin-induced an increase in NF-
B activity. The IKKs can be stimulated by various proinflammatory stimuli, including IL-1
, peptidoglycan and thrombin (43, 44). These extracellular signals activate the IKK complex, which is comprised of catalytic subunits (IKK
and IKK
) and a linker subunit (IKK
/NEMO). This kinase complex, in turn, phosphrylates I
B
at Ser (32) and Ser (36) and signals for ubiquitinrelated degradation. The released NF-
B is then translocated into the nucleus where it promotes NF-
B-dependent transcription (45). The findings of our experiments showed that pretreatment of synovial fibroblasts with compound c, SB203580 or transfection with AdipoR1 siRNA antagonized the increase of IKK
/
activity by adiponectin. Based on these findings, we suggest that the AdipoR1/AMPK/p38 pathway is involved in adiponectin-induced IKK
/
activation. Here, we also found that treatment with adiponectin (3 µg/ml) for 24 h caused TNF-
and IL-1
release in human synovial fibroblasts from 52 ± 8 to 105 ± 16 pg/ml (n = 3, p < 0.05) and 196 ± 13 to 363 ± 18 pg/ml (n = 3, p < 0.05), respectively. In addition, pretreatment of cells with araA, compound C, SB203580, PDTC, TPCK or NF-
B inhibitor peptide also antagonized adiponectin-induced TNF-
and IL-1
release (data not shown). These results suggest that the similar signaling pathways are involved in adiponectin-induced cytokines/chemokines release.
In conclusion, the signaling pathway involved in adiponectin-induced IL-6 production in human synovial fibroblasts has been explored. Adiponectin increases IL-6 production by binding to the AdipoR1 receptor and activation of AMPK, p38 and IKK
, which enhances binding of p65 and p50 to the NF-
B site, resulting in the transactivation of IL-6 production (Fig. 7).
|
| Acknowledgments |
|---|
and IKK
mutants; Dr. J. Han for providing p38 mutant. We also thank the Biostatistic Center of China Medical University for statistical consultation. | Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by grants from National Science Council of Taiwan (NSC 95-2314-B-039-045) and China Medical University (CMU 95-208, 95-309, and 95-PH-06). ![]()
2 Address correspondence and reprint requests to Dr. Tang Chih-Hsin, Department of Pharmacology, College of Medicine, China Medical University, No. 91, Hsueh-Shih Road, Taichung, Taiwan; Yang Rong-Sen, Department of Orthopaedics, National Taiwan University and Hospital, Taiwan; or Fu Wen-Mei, Department of Pharmacology, College of Medicine, National Taiwan University, Taiwan. E-mail addresses: chtang{at}mail.cmu.edu.tw, rsyang{at}ntuh.gov.tw, or wenmei{at}ntu.edu.tw ![]()
3 Abbreviations used in this paper: OA, osteoarthritis; siRNA, small interference RNA; IKK, I
B kinase; LPS, Lipopolysaccharide; IL, interleukin; TNF, tumor necrosis factor; RT-PCR, reverse transcriptase-polymerase chain reaction; DAPA, DNA affinity protin-binding assay; ChIP, chromatin immunoprecipitation assay; RA, rheumatoid arthritis; AMPK, 5'-AMP-activated protein kinase; RASF, rheumatoid arthritis synovial fibroblasts; OASF, osteoarthritis synovial fibroblasts. ![]()
Received for publication June 19, 2007. Accepted for publication August 12, 2007.
| References |
|---|
|
|
|---|
, in vivo. J. Clin. Endocrinol. Metab. 82: 4196-4200.
in fibroblast-like synoviocytes from patients with rheumatoid arthritis. J. Rheumatol. 33: 463-471.
B synergistically activate transcription of the inflammatory cytokines, interleukin 6 and interleukin 8. Proc. Natl. Acad. Sci. USA 90: 10193-10197.
B and I
B proteins: new discoveries and insights. Annu. Rev. Immunol. 14: 649-683. [Medline]
B-
regulates the persistent response in a biphasic activation of NF-
B. Cell 80: 573-582. [Medline]
B kinase that activates the transcription factor NF-
B. Nature 388: 548-554. [Medline]
B kinase complex. Science 278: 818-819.
B
to the ubiquitin-proteasome pathway. Genes Dev. 9: 1586-1597.
), protein kinase C (
), Src, NF-
B and p300 pathway in osteoblasts. J. Cell. Physiol. 221: 45-55.
. Diabetes 55: 2562-2570.
, and c-Src pathway in primary cultured rat osteoblasts. J. Biol. Chem. 280: 22907-22916.
B kinase and NF
B. J. Immunol. 177: 681-693.
in human obesity and insulin resistance. J. Clin. Invest. 95: 2409-2415.
B, in mouse calvarial osteoblasts. Bone 37: 513-529. [Medline]
B and the innate immune response. Curr. Opin. Immunol. 12: 52-58. [Medline]
(q) and G
regulate PAR-1 signaling of thrombin-induced NF-
B activation and ICAM-1 transcription in endothelial cells. Circ. Res. 91: 398-405.
B activity. Annu. Rev. Immunol. 18: 621-663. [Medline]This article has been cited by other articles:
![]() |
M. LEWICKI, P. KOTYLA, and E. KUCHARZ Increased Adiponectin Levels inWomen with Rheumatoid Arthritis After Etanercept Treatment J Rheumatol, June 1, 2009; 36(6): 1346 - 1346. [Full Text] [PDF] |
||||
![]() |
M. Pini, M. E. Gove, R. Fayad, R. J. Cabay, and G. Fantuzzi Adiponectin deficiency does not affect development and progression of spontaneous colitis in IL-10 knockout mice Am J Physiol Gastrointest Liver Physiol, February 1, 2009; 296(2): G382 - G387. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |