The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

The Journal of Immunology, 2007, 179, 5301 -5308
Copyright © 2007 by The American Association of Immunologists, Inc.
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lockyer, H. M.
Right arrow Articles by Nelson, B. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lockyer, H. M.
Right arrow Articles by Nelson, B. H.

STAT5 Is Essential for Akt/p70S6 Kinase Activity during IL-2-Induced Lymphocyte Proliferation1

Heather M. Lockyer2,*, Eric Tran2,*,{dagger} and Brad H. Nelson3,*,{dagger}

* British Columbia Cancer Agency, Trev and Joyce Deeley Research Centre, Victoria, Canada; and {dagger} Department of Biochemistry and Microbiology, University of Victoria, Victoria, Canada


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
IL-2R activates two distinct signaling pathways mediated by the adaptor protein Shc and the transcription factor STAT5. Prior mutagenesis studies of the IL-2R have indicated that the Shc and STAT5 pathways are redundant in the ability to induce lymphocyte proliferation. Yet paradoxically, T cells from STAT5-deficient mice fail to proliferate in response to IL-2, suggesting that the Shc pathway is unable to promote mitogenesis in the genetic absence of STAT5. Here we show in the murine lymphocyte cell line Ba/F3 that low levels of STAT5 activity are essential for Shc signaling. In the absence of STAT5 activity, Shc was unable to sustain activation of the Akt/p70S6 kinase pathway or promote lymphocyte proliferation and viability. Restoring STAT5 activity via a heterologous receptor rescued Shc-induced Akt/p70S6 kinase activity and cell proliferation with kinetics consistent with a transcriptional mechanism. Thus, STAT5 appears to regulate the expression of one or more unidentified components of the Akt pathway. Our results not only explain the severe proliferative defect in STAT5-deficient T cells but also provide mechanistic insight into the oncogenic properties of STAT5 in various leukemias and lymphomas.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Interleukin-2 is a potent cytokine used for the in vitro expansion of T cells and to treat diseases such as melanoma, renal cell carcinoma, and HIV/AIDS (1, 2, 3). IL-2 initiates a program of lymphocyte proliferation by binding IL-2R, which consists of three transmembrane proteins, IL-2R{alpha}, IL-2Rbeta, and {gamma}c (4). Intracellular signaling is mediated by IL-2Rbeta and {gamma}c, which undergo IL-2-induced heterodimerization followed by activation of the associated tyrosine kinases Jak1 and Jak3 (4, 5). Downstream signals arise from Jak1/Jak3-mediated phosphorylation of tyrosine residues on IL-2Rbeta, which creates docking sites for the adaptor protein Shc and the transcription factor STAT5 (6, 7, 8, 9, 10, 11).

Once recruited to IL-2Rbeta, Shc activates at least two downstream pathways, the Ras/Erk pathway and the PI3K pathway (12, 13, 14, 15). Shc activates the PI3K pathway by recruiting the adaptor protein Grb2, which in turn recruits the adaptor protein Gab2 followed by the p85 PI3K-regulatory subunit (14, 15, 16). Formation of the Shc/Grb2/Gab2/p85 complex ultimately leads to catalytic activation of p110{alpha} PI3K, which converts phosphatidylinositol 4,5-bisphosphate into the lipid second messenger phosphatidylinositol 3,4,5-triphosphate (PIP3)4 in the cell membrane (15, 17, 18, 19, 20). PIP3 recruits to the cell membrane proteins containing pleckstrin homology domains, such as 3-phosphoinositide-dependent kinase 1 (PDK1) and Akt. Akt is a key mediator of PI3K-mediated cell survival, growth, and proliferation (17, 18, 19, 20, 21). In parallel, the Shc/Grb2 complex also recruits the guanine nucleotide exchange factor Sos. Sos activates the GTPase Ras, which ultimately leads to the phosphorylation and activation of Erk (22).

We and others have studied the mechanism by which Shc promotes lymphocyte proliferation in the context of IL-2 signaling. Although IL-2 activates the Ras/Erk pathway, this is not essential for proliferative signaling (23, 24). By contrast, several groups have shown that the PI3K/Akt pathway is essential for T cell proliferation (24, 25, 26). The PI3K/Akt pathway was found to activate the E2F transcription factor, which is pivotal for G1 to S phase progression (25). Additionally, the PI3K/Akt pathway was shown to be necessary, although not sufficient, for maximal induction of the mitogenic genes c-myc, cyclin D2, cyclin D3, cyclin E, and Bcl-xL (24, 27). Finally, PI3K pathway-specific inhibitors have been used to show that a late phase of PI3K activity is required for IL-2-induced lymphocyte proliferation (26). Although essential, the PI3K pathway is not sufficient for proliferation, indicating the involvement of other pathways downstream of IL-2Rbeta (24, 25).

The transcription factor STAT5, which refers to two highly homologous proteins STAT5a and STAT5b, also promotes mitogenesis and antiapoptosis in lymphocytes (28). Indeed, dysregulated STAT5 activity is found in various leukemias and lymphomas (29, 30, 31). Upon tyrosine phosphorylation, STAT5 dimerizes via its SH2 domain and translocates to the nucleus where it directly trans-activates target genes such as c-myc, cyclin D2, cyclin D1,Bcl-xL, bcl-2, p21waf1, pim-1, CIS, and IL-2R{alpha} (CD25) through a C-terminal trans activation domain (29, 32, 33, 34, 35, 36, 37, 38). Although best characterized as a transcription factor, STAT5 can also act as an adaptor protein in the Gab2/p85 signaling complex (39, 40). Specifically, both phosphorylated wild-type STAT5 and a constitutively active mutant of STAT5 (caSTAT5) were found to coprecipitate with the scaffolding protein Gab2 and the PI3K-regulatory subunit p85 (39, 40, 41). Moreover, the ability of caSTAT5 to induce cell proliferation was dependent on Gab2, as expression of a functionally inactive Gab2 mutant prevented the ability of caSTAT5 to activate the PI3K/Akt and Ras/Erk pathways and induce lymphocyte proliferation (39). Altogether, these results indicate that STAT5 is capable of at least two mechanistically distinct modes of signaling.

In addition to having a major role in survival and proliferative signaling, activated STAT5 can also promote apoptosis under some conditions (38, 42). IL-2 plays a major role in sensitizing T cells to activation induced cell death, and this was found to depend on STAT5 signaling (42). Furthermore, in a lymphocyte cell line, caSTAT5 was shown to promote apoptosis by inducing expression of the growth-inhibitory protein JAB (JAK-binding) (38). Finally, naturally occurring isoforms of STAT5 can be produced by alternative splicing or proteolytic cleavage by enzymes such as cathepsin G or calpain (43, 44, 45). Although the exact physiological significance of these isoforms remains to be determined (45, 46), overexpression of isoforms lacking the C-terminal trans activation domain can exert a dominant-negative effect on STAT5 signaling and induce apoptosis in certain cell types (43, 47, 48, 49, 50).

Prior mutagenesis studies, in which the Shc or STAT5 docking sites on IL-2Rbeta were selectively removed, indicated that Shc and STAT5 are redundant in the ability to induce lymphocyte proliferation (6, 7, 13, 24, 35, 51, 52). However, T cells rendered genetically deficient in STAT5 are completely nonproliferative upon TCR and IL-2 stimulation, suggesting that STAT5 is absolutely required for mitogenesis irrespective of the Shc pathway (36). This could mean that STAT5 contributes to proliferative signaling even when not activated by the IL-2R, as has been shown for STAT1 (53). Alternatively, IL-2Rbeta mutants reported to activate Shc alone might also activate STAT5 to low but functionally significant levels. To distinguish these possibilities, we expressed mutant cytokine receptors that selectively activate Shc or STAT5, either alone or in combination, in subclones of the lymphoid cell line Ba/F3. We find that, unexpectedly, a low level of STAT5 activity is essential for sustained activation of the Akt/p70S6K pathway by Shc. Our results demonstrate a novel, essential connection between the Shc and STAT5 pathways, explain the severe proliferative defect in STAT5-deficient lymphocytes, and provide insight into the oncogenic role of STAT5 in various leukemias and lymphomas.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Plasmid construction

beta-wt, beta-Y338, beta-Y510, and wild-type STAT5A (wtSTAT5A) have been previously described (24, 35). All receptor mutants were generated by standard PCR-based techniques. beta-Y338GG was created from beta-Y338 by modification of the C terminus to the sequence Y338GFG[stop]. G-Y510 was created by joining the human G-CSFR extracellular domain to human gp130 at EcoRI to incorporate the transmembrane and Jak binding domains (box 1 and 2) of gp130. The Shp2- and STAT3-binding sites of gp130 were then replaced with a single STAT5 docking site corresponding to Y510 and flanking residues from human IL-2Rbeta (YLSLQELQ[stop]). All receptor mutants were sequenced and cloned into a human beta-actin promoter-driven expression vector containing a neomycin resistance gene (54). The caSTAT5A1*6 expression plasmid has been described elsewhere (55).

Cell culture

Murine proB Ba/F3 cells stably transfected with human GM-CSFR{alpha}, designated BAF.GM, were maintained in RPMI 1640 supplemented with 10% FBS, 2 mM L-glutamine, 50 U/ml penicillin, 50 µg/ml streptomycin, and 10% WEHI-conditioned medium (source of murine IL-3). Upon human GM-CSF stimulation, the GM-CSFR{alpha} chain dimerizes with the murine common beta-chain and induces strong lymphocyte proliferation mediated by STAT5, Shc, Gab2, ERK, and PI3K, which are signaling intermediaries also used by IL-2R (56). GM-CSF can be purchased at low cost through the hospital pharmacy and therefore represents an inexpensive yet high quality cytokine to serve as a positive control. The murine IL-2-dependent T cell lines CTLL-2 (CD8+) and HT-2 (CD4+) were maintained in RPMI 1640 supplemented with 10% FBS, 2 mM L-glutamine, 50 U/ml penicillin, 50 µg/ml streptomycin, 25 mM HEPES, 1 mM sodium pyruvate, and 25 µM 2-ME. For the generation of stable transfectants using Ba/F3 lymphocytes, linearized plasmids were electroporated into cells, and stably transfected subclones were selected at limiting dilution for G418 resistance (0.8 µg/ml; Sigma-Aldrich). Receptor expression was assessed by flow cytometry with Abs to human IL-2Rbeta or human G-CSFR (BD Biosciences). For all experiments, we used subclones with receptor expression levels between 0.5 and 1.5 log fluorescence units (Fig. 1B).


Figure 1
View larger version (29K):
[in this window]
[in a new window]

  		FIGURE 1. A, Schematic diagram of wild-type (beta-wt) and mutant IL-2 receptors with key tyrosine (Y) residues highlighted. Upon IL-2 stimulation, beta-wt delivers a wild-type IL-2 signal (Shc + STAT5); beta-Y338 activates Shc and modest levels of STAT5; and beta-Y338GG exclusively activates Shc. B, Flow cytometric analysis of IL-2Rbeta expression on BAF.GM cells expressing beta-wt, beta-Y338, or beta-Y338GG. Subclones displaying IL-2Rbeta expression within 0.5–1.5 log fluorescent units were selected for use in subsequent experiments. A representative clone for each receptor construct is shown. Max, Maximum.

 
Western blots

Cytoplasmic and nuclear extracts of BAF.GM cells expressing either beta-wt, beta-Y338, beta-Y338GG, or a combination of beta-Y338GG and G-Y510 were prepared and immunoblotted as described (57) with the following modifications: cells were washed three times with 1x PBS, and following 4 h of incubation in medium without added cytokine, 20 x 106 cells were stimulated with recombinant human GM-CSF (100 ng/ml), IL-2 (100 U/ml), G-CSF (100 ng/ml), or a combination of IL-2 and G-CSF at 37°C for the indicated time points. Extracts from 2 x 106 cells were run on 3–8% Tris-acetate gels (Criterion XT; BioRad Laboratories) and transferred to nitrocellulose. Western blotting was performed by blocking membranes in pH 7.5 0.1 M Tris, 0.9% NaCl, 0.05% Tween (TBS-T) containing 1% (w/v) BSA. Membranes were incubated for 3 h in blocking buffer containing Abs to phospho-STAT5 (Tyr694), phospho-Shc (Tyr317 or Tyr239/240), phospho-Gab2 (Tyr452), phospho-Shp2 (Tyr542), phospho-(Tyr) p85 PI3K, phospho-Akt (Ser473), phospho-p70S6K (Thr421/Ser424), phospho-S6 (Ser235/236), or phospho-ERK-p44/42 MAPK (Thr202/Tyr204), all from Cell Signaling Technology. Membranes were washed with TBS-T and incubated with HRP-conjugated goat anti-rabbit Abs (The Jackson Laboratory). Bound Abs were detected by ECL (Amersham). After detection, membranes were stripped for 1 h at 60°C with 62.5 mM Tris-HCl (pH 6.8), 2% SDS, 0.1 M 2-ME before washing with TBS-T, blocking in TBS-T + 1% BSA and reprobing with control rabbit Abs specific for: Gab2 (Upstate Biotechnology), p70S6K (Santa Cruz Biotechnology), STAT5, Shc, Shp2, p85 PI3K, Akt, S6 or ERK-p44/42 MAPK (Cell Signaling Technology).

Proliferative assays

BrdU incorporation was assessed using the Cell Proliferation Biotrak ELISA system (Amersham). Assays were conducted in triplicate with 104 transfected BAF.GM cells cultured in 200 µl of medium plus the appropriate stimulus. After 48 h, cells were fixed, permeabilized, and incubated with peroxidase-labeled anti-BrdU (1/100 in Ab dilution solution) for 90 min. Bound Abs were detected by TMB substrate and read at 450 nm on a Molecular Devices plate reader.

Transient transfections

BAF.GM lymphocytes stably expressing beta-Y338GG were resuspended at 12.5 x 106 cells/ml in 10 mM MgCl2 PBS solution with 100 µg total of plasmid DNA (wtSTAT5A or caSTAT5A in combination with a GFP vector) and electroporated (350 V, 975 µF) with a GenePulser Xcell (BioRad). Cells were then rested overnight in RPMI 1640 supplemented with 10% FBS, 2 mM L-glutamine, 50 U/ml penicillin, 50 µg/ml streptomycin, and 10% WEHI-conditioned medium (a source of murine IL-3). After recovery, cells were washed three times with 1x PBS, starved of cytokines for 4 h, and then stimulated with 100 U/ml IL-2 or medium alone. At t = 1 and 10 h, cells were harvested for intracellular flow cytometry as described below. Successful transfectants, as demarcated by GFP expression, were analyzed for phospho-S6 content (see Intracellular flow cytometry). Transfection efficiency typically ranged between 2 and 5%.

Intracellular flow cytometry

Cells were stimulated for the indicated time points with the appropriate cytokine(s), and fixed with formaldehyde (2% v/v final concentration) for 10 min at 37°C. Fixed cells were then spun at 500 x g, and cell pellets were permeabilized with 100% ice cold methanol and incubated on ice for 20 min to achieve complete permeabilization. Cells were rehydrated by washing twice with >10 volumes of 1x PBS + 0.5% BSA. Cells were then stained with Abs to phospho-STAT5 or phospho-S6 (1/200; Cell Signaling Technology) for 30–60 min at room temperature, washed twice with 1x PBS + 0.5%BSA and then stained with anti-rabbit IgG (conjugated to PE at 1/100) for 30–60 min at room temperature in the dark (CalTag Laboratories). Events were collected with a BD FACSCalibur flow cytometer and CellQuest Pro software. Data analysis was performed using FlowJo software (Tree Star).

Quantitative PCR (QPCR) analysis

Cells were snap frozen in an ethanol-dry ice bath and stored at –80°C. Total RNA was isolated using the RNeasy Mini kit (Qiagen) following the manufacturer’s protocol and quantified using a NanoDrop ND-1000 spectrophotometer. RNA was reverse transcribed to cDNA using the iScript cDNA synthesis kit (BioRad). CIS expression was measured by QPCR using the intron-spanning primer set: CIS forward 5'-CGTTGTCTCTGGGACATGGTC-3'; CIS reverse 5'-CAATTTGCTCCACAGCCAGC-3'. c-myc expression was determined with the intron-spanning primer set: c-myc forward TTTGTCTATTTGGGGACAGTGTT; c-myc reverse CATCGTCGTGGCTGTCTG. GAPDH was used as a reference gene, and transcript levels were assessed using the primers: GAPDH forward 5'-AAC TTTGGCATTGTGGAAGG-3'; GAPDH reverse 5'-ACACATTGGGGGTAGGA ACA-3'. QPCR was performed using the iCycler MyiQ real-time PCR detection system (Bio-Rad) with the following two-step protocol: initial denaturation at 95°C for 90 s, followed by 40 cycles of denaturation at 95°C for 10 s and 30 s extension at 55°C. After final denaturation at 95°C for 1 min, a melt curve analysis was performed starting at 55°C and increasing by increments of 1°C up to 95°C. Relative gene expression was calculated using the Bio-Rad Gene Expression Macro version 1.1 software. Expected product sizes were verified by standard agarose gel electrophoresis.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
An IL-2Rbeta mutant reported to exclusively activate Shc induces low levels of STAT5 activity

To assess the possibility that IL-2R mutants thought to exclusively activate Shc might also activate low levels of STAT5, we first re-evaluated a previously described IL-2Rbeta truncation mutant designated beta-Y338 (also known as betabeta{Delta}355) which contains the Shc docking site at Y338 but lacks all other cytoplasmic tyrosine residues, including all previously defined STAT5 activation sites (Fig. 1 and Refs. 8 and 13). In accord with prior reports, beta-Y338 induced robust activation of the Shc pathway, as evidenced by IL-2-induced phosphorylation of Shc, p70S6K, S6, and ERK (Fig. 2A), and this was associated with strong proliferation in the lymphocyte cell line BAF.GM, a derivative of Ba/F3 cells (Fig. 2B and Materials and Methods). Sensitive immunoblotting with phospho-specific Abs revealed that the beta-Y338 mutant also induced low-level tyrosine phosphorylation of the full-length isoform of STAT5, despite lacking all known STAT5 docking sites (Fig. 2A). Furthermore, QPCR analysis revealed low but reproducible induction of the STAT5-specific target gene CIS by beta-Y338 (Fig. 2C). Thus, previous studies concluding that the Shc pathway alone could induce lymphocyte proliferation may be confounded by low-level STAT5 activation by receptor mutants such as beta-Y338 (6, 13, 24, 42).


Figure 2
View larger version (25K):
[in this window]
[in a new window]

  		FIGURE 2. Shc is unable to sustain activation of the Akt/p70S6K pathway and promote lymphocyte proliferation in the absence of STAT5 activity. A, Phospho (P)-specific Western blot analysis of Shc (P-Shc, P-p70S6K, P-S6, and P-ERK) and STAT5 (P-STAT5) pathway activation by beta-wt, beta-Y338, and beta-Y338GG. BAF.GM cells stably expressing the indicated receptors were deprived of cytokine for 4 h, followed by a 1- or 12-h stimulation with 100 U/ml IL-2 before cell extracts were prepared and analyzed by SDS-PAGE and immunoblotting. IL-2 stimulation of beta-Y338GG does not activate STAT5 or sustain long-term (t = 12 h) activation of the Akt/p70S6K pathway. Total ERK serves as a loading control. B, beta-Y338GG fails to promote lymphocyte proliferation. BAF.GM cells stably expressing the indicated receptors were stimulated with 100 ng/ml GM-CSF (positive control), 100 U/ml IL-2, or medium alone (negative control), and BrdU incorporation was measured 48 h later. Data are plotted as a percent of the proliferation observed with the positive control cytokine, GM-CSF. C, Differential induction of the STAT5-specific target gene CIS by beta-Y338 and beta-Y338GG, assessed by quantitative PCR. D, Time course of Shc pathway activation by beta-Y338 and beta-Y338GG reveals a selective loss of p70S6K activity between 3 and 6 h. BAF.GM cells were treated and analyzed as in B. Data are representative of three or more independent experiments.

 
Activation of the Shc pathway alone does not sustain long-term Akt/p70S6K activity or lymphocyte proliferation and viability

To further reduce STAT5 activation while sparing the Shc pathway, a second IL-2R mutant was constructed, designated beta-Y338GG, in which two phenylalanine residues immediately C-terminal to the Shc docking site at Y338 were mutated to glycine and the C terminus was further truncated to residue 341 to eliminate any potential binding to Y338 by the SH2 domain of STAT5 (Fig. 1). We expected the phosphotyrosine binding domain of Shc to still bind to beta-Y338GG, because the phosphotyrosine binding domain recognizes residues N-terminal to Y338 (58). As intended, the beta-Y338GG mutant showed reduced STAT5 tyrosine phosphorylation and CIS induction in response to IL-2, whereas tyrosine phosphorylation of Shc still occurred (Fig. 2, A and C). Remarkably, this was associated with a major reduction in cell proliferation and viability, suggesting that the Shc signal, when isolated from STAT5, is not sufficient for mitogenesis and cell survival (Fig. 2B and data not shown). To understand the biochemical basis of this proliferative impairment, we evaluated key signaling events associated with the Shc pathway. At 1 h poststimulation, the beta-Y338GG mutant showed normal phosphorylation of Shc, ERK, p70S6K, and its substrate S6, suggesting that early Shc signaling was intact (Fig. 2A). However, by 12 h poststimulation, the beta-Y338GG mutant showed greatly impaired phosphorylation of p70S6K and S6, whereas Shc and ERK phosphorylation were only modestly diminished (Fig. 2A). A more refined time course revealed that p70S6K and S6 phosphorylation began to diminish 3–6 h after stimulation of beta-Y338GG, despite normal phosphorylation of Shc and ERK at these time points (Fig. 2D).

STAT5 and Shc cooperate to sustain Akt/p70S6K pathway activation and lymphocyte proliferation

The failure of beta-Y338GG to sustain p70S6K and S6 phosphorylation could result from reduced STAT5 activation by this mutant. Alternatively, the beta-Y338GG mutation could disrupt the interaction of Y338 with other unidentified signaling proteins that regulate p70S6K and S6. To distinguish these possibilities, we attempted to rescue p70S6K and S6 phosphorylation by restoring STAT5 activation through a second receptor. We chose a receptor that could be stimulated independent of beta-Y338GG and was structurally distinct from the IL-2R, such that STAT5 represented one of the few shared signaling elements. Specifically, we made a chimeric receptor that placed STAT5 under the control of a second cytokine, G-CSF. Several groups have described a chimeric G-CSF/gp130 receptor that generates an IL-6-like signal in response to G-CSF that is mediated by Jak1, Jak2, Tyk2, Shp2, and STAT3 (59, 60). We replaced the Shp2 and STAT3 activation sites of G-CSF/gp130 with the STAT5 activation site from IL-2Rbeta (Y510) to generate a chimeric receptor designated G-Y510 (Fig. 3A). As expected, G-Y510 induced STAT5 phosphorylation and CIS expression in response to G-CSF, without inducing phosphorylation of STAT3 and Shp2 (components of the IL-6 signal), or Jak3 and Shc (components of the IL-2 signal; Fig. 3B, Fig. 5B, and data not shown). The level of STAT5 phosphorylation was modest compared with the wild type-IL-2R, and consequently G-CSF-induced cell proliferation was weak (Fig. 3C). Nevertheless, when G-Y510 was coexpressed with beta-Y338GG, the combination of IL-2 + G-CSF induced a proliferative response equivalent to that of the wild-type IL-2R (Fig. 3C). Thus, the Shc and STAT5 pathways exhibit strong cooperativity even when triggered by heterologous receptors.


Figure 3
View larger version (29K):
[in this window]
[in a new window]

  		FIGURE 3. Shc and STAT5 pathways exhibit strong functional synergy even when triggered by heterologous receptors. A, Schematic diagram of the chimeric cytokine receptor G-Y510. G-Y510 is characterized by the G-CSFR extracellular domain fused to the gp130 intracellular domain modified to contain the STAT5 activation site (Y510) from IL-2Rbeta. B, Western blot analysis showing synergistic activation of the STAT5 (P-STAT5) and Shc (P-p70S6K and P-S6) pathways upon coactivation of beta-Y338GG and G-Y510. BAF.GM cells stably coexpressing the indicated receptors were deprived of cytokine for 4 h, followed by a 1- or 12-h stimulation with either 100 ng/ml G-CSF alone to activate STAT5, 100 U/ml IL-2 alone to activate Shc, or both cytokines to activate both Shc and STAT5. C, Synergistic effects of Shc and STAT5 on lymphocyte proliferation. BAF.GM cells stably coexpressing beta-Y338 + G-Y510 were stimulated for 48 h with medium alone (negative control), 100 ng/ml GM-CSF (positive control), 100 U/ml IL-2, 100 ng/ml G-CSF, or a combination of IL-2 and G-CSF and assayed for BrdU incorporation. Data are plotted as percent proliferation relative to the positive control, GM-CSF. D, Intracellular flow cytometry analysis showing the synergistic enhancement of phospho-S6 (P-S6) by STAT5 activation at t = 1 and 12 h after cytokine stimulation. Data are representative of three or more independent experiments. E, Intracellular flow cytometric analysis of phospho-S6 (P-S6) to assess activation of the Akt/p70S6K pathway in BAF.GM lymphocytes stably expressing beta-Y338GG (activates Shc), beta-Y510 (activates STAT5), or both beta-Y338GG and beta-Y510 (which together activate Shc and STAT5). Cells were washed, starved, and then stimulated with 100 U/ml IL-2 for 1–12 h. Unstimulated (Unstim) cells served as a negative control at each time point (shaded region). Max, Maximum; MFI, mean fluorescence intensity.

 

Figure 5
View larger version (19K):
[in this window]
[in a new window]

  		FIGURE 5. Costimulation of the Shc and STAT5 pathways results in enhanced phosphorylation of Akt, p70S6K, S6, and STAT5. A, Western blot analysis of Shc and STAT5 signaling events. BAF.GM cells stably coexpressing beta-Y338GG and G-Y510 were deprived of cytokine for 4 h, followed by a 1-, 6-, or 12-h stimulation with 100 ng/ml G-CSF alone to activate STAT5, 100 U/ml IL-2 alone to activate Shc, or both cytokines to activate Shc and STAT5. Total ERK is used as a loading control. B, QPCR analysis showing synergistic up-regulation of the STAT5 target genes CIS and c-myc upon activation of both Shc and STAT5. BAF.GM lymphocytes coexpressing beta-Y338GG and G-Y510 were unstimulated (Unstim; t = 0 h) or stimulated with 100 ng/ml G-CSF, 100 U/ml IL-2, or both cytokines for 6 h before RNA isolation, cDNA synthesis, and QPCR. GAPDH was used as the reference gene. Data are representative of three or more independent experiments.

 
We next evaluated G-Y510 and beta-Y338GG for synergistic effects on p70S6K and S6. As before, beta-Y338GG alone induced strong phosphorylation of p70S6K and S6 at 1 h, and this was greatly reduced by 12 h (Fig. 3B). By contrast, G-Y510 alone induced little or no p70S6K/S6 phosphorylation at 1 or 12 h (Fig. 3B). Importantly, when cells were costimulated with IL-2 + G-CSF, strong phosphorylation of p70S6K and S6 was observed at both 1 and 12 h (Fig. 3B). To quantify these results, we measured S6 phosphorylation by flow cytometry using the same cell cultures. Consistent with the immunoblotting results, the combination of IL-2 + G-CSF induced at least a 4-fold increase in the mean fluorescence intensity at 12 h relative to IL-2 alone (Fig. 3D). Thus, Shc and STAT5 cooperatively regulate p70S6K and S6, even when activated through heterologous receptors. The quantitative data obtained by flow cytometry demonstrate that this was a synergistic rather than an additive effect of the two cytokines.

To further demonstrate that STAT5 was the factor synergizing with the Shc pathway, we generated BAF.GM cells stably coexpressing beta-Y338GG and the IL-2 receptor mutant beta-Y510 (formerly known as betabeta{Delta}325 + Y510). This mutant has undergone extensive investigation to show that it signals exclusively through the activation of STAT5 by Y510 (27, 35, 61). Similar to the results observed with beta-Y338GG + G-Y510, IL-2-induced coactivation of beta-Y338GG and beta-Y510 also led to sustained phosphorylation of S6 at late time points, as assessed by intracellular flow cytometry (Fig. 3E). Together, these results imply an essential role for STAT5 in sustaining the Akt/p70S6K pathway.

caSTAT5 can independently induce S6 phosphorylation

In theory, the G-Y510 chimeric receptor, and even the well-characterized beta-Y510 IL-2 receptor, should exclusively activate STAT5. However, the possibility remained that these receptors might activate cellular proteins in addition to STAT5 which may in turn have effects on the Akt/p70S6K pathway. To ensure that STAT5 was indeed the factor responsible for sustaining the Akt/p70S6K pathway, we took advantage of a well-characterized, constitutively active form of STAT5, caSTAT5A1*6 (55). caSTAT5A1*6 harbors two amino acid substitutions that confer constitutive tyrosine phosphorylation, nuclear localization, and transcriptional activity (55). As expected, when transiently expressed in BAF.GM lymphocytes, caSTAT5A1*6 demonstrated strong, constitutive tyrosine phosphorylation (data not shown). This was associated with potent phosphorylation of S6 to levels exceeding that induced by beta-Y338GG or beta-wt (Fig. 4 and data not shown). Expression of wtSTAT5A did not affect S6 phosphorylation (Fig. 4); therefore, activated STAT5 is required for this process. Transient expression of caSTAT5A1*6 in the murine T cell lines CTLL-2 and HT-2 also induced phosphorylation of S6 (data not shown); therefore, the link between the STAT5 and Akt/p70S6K pathways is operant in multiple cell types.


Figure 4
View larger version (24K):
[in this window]
[in a new window]

  		FIGURE 4. Constitutive activation of STAT5 results in strong S6 phosphorylation. Intracellular flow cytometry for phospho-S6 to assess activation of the Akt/p70S6K pathway. BAF.GM lymphocytes stably expressing beta-Y338GG were transiently cotransfected with plasmids encoding caSTAT5A1*6 and GFP. Cells were rested overnight, starved for 4 h, and either stimulated for 1–10 h with IL-2 to activate Shc or left unstimulated (Unstim). Plasmids encoding GFP alone or wtSTAT5A served as negative controls. Data are gated on the GFP-positive population and are representative of three independent experiments.

 
STAT5 cooperates with the Shc pathway at the level of Akt

We examined other signaling events downstream of Shc to determine the point at which STAT5 synergizes with the Shc pathway. In cells coexpressing beta-Y338GG and G-Y510, IL-2 induced the phosphorylation of Shc, Gab2, Shp2, p85, and ERK, and these events were not enhanced by G-CSF at any time point (Fig. 5A). By contrast, G-CSF enhanced the phosphorylation of Akt and p70S6K at 6 and 12 h, and an even greater effect was seen on the downstream effector protein S6 (Fig. 5A). These results indicate that STAT5 acts at or near the level of Akt. Intriguingly, in addition to STAT5 facilitating Shc signaling, activation of the Shc pathway by beta-Y338GG enhanced the tyrosine phosphorylation of STAT5 as well as induction of the STAT5 target genes CIS and c-myc (Fig. 5). Thus, there appears to be bidirectional cooperative signaling between the Shc and STAT5 pathways.

Temporal dissociation of Shc and STAT5 signaling impairs S6 phosphorylation and cell proliferation

STAT5 has been reported to weakly activate the PI3K pathway through its conventional role as a transcription factor (26, 27). In addition, STAT5 can serve as an adaptor protein, forming a complex with Gab2 and the p85 regulatory subunit of PI3K (39). To investigate which of these mechanisms underlies the synergy between STAT5 and Shc, we determined how rapidly STAT5 could rescue the Shc signal, reasoning that this should occur immediately if STAT5 served as an adaptor protein or more slowly if STAT5 served as a transcription factor. Cells coexpressing beta-Y338GG and G-Y510 were stimulated with IL-2 alone for 9 h to allow the Shc signal to initiate and then decay. When G-CSF was added, STAT5 phosphorylation increased within 15 min whereas S6 phosphorylation increased over a 1- to 6-h period (Fig. 6). These results are consistent with STAT5 sustaining S6 phosphorylation by serving as a transcription factor rather than an adaptor protein. If cells were washed before the addition of G-CSF, such that the IL-2-induced Shc signal was extinguished before the initiation of the STAT5 signal, there was only negligible rescue of S6 phosphorylation (data not shown). This demonstrates that S6 phosphorylation is not regulated through a simple biphasic mechanism involving an initial Shc phase followed by a STAT5 phase. Rather, both pathways need to be simultaneously active to achieve maximal S6 phosphorylation. Similar to the results for S6 phosphorylation, cell proliferation was maximal only when the Shc and STAT5 pathways were both activated throughout the entire stimulation cycle (data not shown). Thus, continuous, simultaneous Shc and STAT5 signaling is required to achieve maximal S6 phosphorylation and cell proliferation, demonstrating an essential synergy between these pathways.


Figure 6
View larger version (14K):
[in this window]
[in a new window]

  		FIGURE 6. Rescue of S6 phosphorylation by G-Y510 is delayed relative to STAT5 phosphorylation. Intracellular flow cytometry analysis of P-STAT5 (A) and P-S6 (B) in BAF.GM cells harboring both beta-Y338GG and G-Y510 receptors. Cells were stimulated with 100U/ml IL-2 for 9 h followed by 100 ng/ml G-CSF for the indicated times. 9*, No G-CSF stimulation; MFI, mean fluorescence intensity. Data are representative of three independent experiments.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
We show here that STAT5 is essential for sustained activation of the Akt/p70S6K pathway, which was previously thought to be an exclusive function of Shc. At early time points after IL-2 stimulation, our results are consistent with the conventional model in which a complex containing Shc, Grb2, Gab2, Shp2, and p85 mediates activation of the Akt/p70S6K pathway (14, 15, 16). However, when concurrent STAT5 activity was absent, the Akt/p70S6K signal waned after 3–6 h of IL-2 stimulation, and this was associated with drastically impaired lymphocyte proliferation and viability. Restoration of STAT5 activity through a heterologous receptor rescued maximal Akt/p70S6K activity and lymphocyte proliferation. The Shc pathway further promoted these events by enhancing the transcriptional activity of STAT5. This bidirectional, cooperative signaling by Shc and STAT5 appears to operate throughout the proliferative cycle, as temporal dissociation of the Shc and STAT5 signals lead to suboptimal S6 phosphorylation and lymphocyte proliferation. Thus, the Shc and STAT5 pathways do not operate as independent signaling modules, as prior studies have suggested, but instead are intimately linked at the level of the Akt/p70S6K pathway and possibly other regulatory nodes as well. These findings likely explain the severe mitogenic defect seen in STAT5-deficient T cells (36), given that lack of STAT5 signaling would also impair the ability of Shc to activate the Akt/p70S6K pathway.

It has been recently demonstrated that STAT5 can serve as an adaptor protein in the Gab2/Shp2/p85 complex, which could potentially explain the observations reported here (39, 40, 41). However, the physiological relevance of this mode of signaling by STAT5 has yet to be fully established. In fact, constitutively active STAT5 mutants that are defective in trans-activating STAT5 target genes, but are theoretically capable of acting as adaptor proteins, were found incapable of inducing leukemia in mice (62, 63). By contrast, constitutively active STAT5 mutants capable of tetramerization and strong DNA binding efficiently induced leukemogenesis, which implicates an important role for STAT5 transcriptional activity, and not adaptor function, in oncogenesis (62, 63).

In this study, we provide four lines of evidence that STAT5 regulates the Akt pathway through a transcriptional mechanism: 1) time-course experiments showed a delayed (1- to 3-h) rescue of the Akt pathway by STAT5 (Fig. 6); 2) the cooperation between the Shc and STAT5 pathways occurred even in the context of heterologous receptors, suggesting that it involved signaling intermediaries rather than direct complex formation between Shc and STAT5; 3) short term (1-h) activation of the Akt pathway by Shc occurred in the absence of STAT5 activity, indicating that any adaptor function of STAT5 is not essential for formation of the Shc/Grb2/Gab2/p85 complex; and 4) expression of caSTAT5A1*6 alone (i.e., without coactivation of the Shc/Grb2/Gab2/p85 complex) strongly activated the Akt/p70S6K pathway (Fig. 4) and indeed promotes factor-independent proliferation of Ba/F3 cells (38, 55). Because caSTAT5A1*6 predominantly localizes to the nucleus, possesses strong transcriptional activity, and can bind DNA in the absence of cytokines (55), this is also consistent with a transcriptional mechanism. Attempts to directly confirm the transcriptional activity of STAT5 using the protein translation inhibitor cycloheximide were confounded by direct effects of this agent on p70S6K (data not shown), consistent with a prior report (64). Nevertheless, even though STAT5 can form a complex with Gab2, Shp2, and p85, the collective evidence strongly suggests that it regulates the Akt/p70S6K pathway predominantly by a transcriptional mechanism.

We found that STAT5 does not affect the IL-2-induced phosphorylation of Shc, Grb2, Gab2, Shp2, or p85. Rather, the effect of STAT5 is seen at the level of Akt and the downstream effectors p70S6K and S6 (Fig. 5A). Although Akt plays a central role in cell survival, growth, and proliferation, its mechanism of regulation remains unresolved (21). Maximal activation of Akt requires both translocation to the plasma membrane and phosphorylation of Thr308 and Ser473 (18, 21, 65). Akt is recruited to the plasma membrane by the PI3K product PIP3, which is bound by the pleckstrin homology domains of Akt and PDK1. Subsequently, PDK1 phosphorylates Thr308 and PDK2 phosphorylates Ser473. The precise identity of PDK2 remains controversial, although recent evidence suggests that it may consist of the Rictor/mTOR complex (66). Therefore, STAT5 could potentially promote Akt activation by up-regulating the activity of p110{alpha} (the catalytic subunit of PI3K), PDK1, PDK2, or other components of the mTOR pathway. Alternatively, STAT5 could activate Akt by transcriptionally repressing a negative regulator(s). To date, no Akt-specific phosphatase has been found (21). However, the C-terminal modulator protein negatively regulates Akt by preventing its phosphorylation (67). Finally, because Akt is downstream of PI3K, negative regulators of PI3K, such as the tumor suppressors PTEN and p53, could also oppose Akt activity (20). With these candidates in mind, we are currently attempting to identify the STAT5 target gene(s) that regulate the PI3K/Akt pathway.

In addition to showing that STAT5 is essential for sustaining the Akt/p70S6K pathway, we also found that optimal STAT5 transcriptional activity depends on concurrent Shc signaling. This suggests that the Shc pathway is regulating a kinase or phosphatase that controls the phosphorylation of STAT5. Time-course experiments revealed that the Shc pathway enhances STAT5 phosphorylation with delayed kinetics, which suggests a transcriptional mechanism (data not shown); however, the molecular basis of this finding remains to be elucidated.

Prior studies with the IL-2R mutant betabeta{Delta}325 + Y510 and the wild-type IL-7R have shown that STAT5 can activate Akt to a low level in the absence of Shc signaling (26, 27). Together with our current results, this might suggest a biphasic mode of Akt regulation, wherein initial activation of the PI3K/Akt pathway is mediated by the well-characterized Shc/Grb2/Gab2/p85 complex followed by a second phase of Akt activity mediated by STAT5. Indeed, the platelet-derived growth factor receptor activates the PI3K pathway through a biphasic mechanism (68). However, we do not believe the data support such a model for the IL-2R, simply because STAT5 alone is a very weak activator of Akt (26, 27). It is only when STAT5 is combined with Shc that strong phosphorylation of Akt, p70S6K, and S6 occurs. Instead, we propose a model in which Akt is predominantly regulated by the Shc/Grb2/Gab2/p85 complex, as indicated by prior studies, but that one or more unidentified factors downstream of this complex depend on STAT5 transcriptional activity for continued expression. Thus, further study of STAT5 target genes will shed new light on the mechanism of Akt regulation by cytokine receptors.

Activated STAT5 has been observed in a number of human cancers, including various leukemias and lymphomas as well as prostate, uterine, ovarian, breast, and head and neck cancers (29, 30, 31). STAT5 is traditionally thought to contribute to oncogenesis by trans-activating genes involved in cell cycle progression and survival, such as c-myc, pim-1, bcl-xL, mcl-1, and D-type cyclins (29, 30, 55). Our findings, together with others (39, 40, 41), indicate that the oncogenic properties of STAT5 may also be attributable to its ability to promote activation of the PI3K/Akt pathway, which is also widely implicated in oncogenesis (17, 18, 20). If so, then strategies aimed at inhibiting STAT5 activity may have the additional benefit of disrupting the PI3K/Akt pathway, thereby further promoting tumor cell apoptosis. Likewise, inhibitors of the PI3K/Akt pathway might prove efficacious against tumors with dysregulated STAT5 activity.


   Acknowledgments
 
We thank Dr. Toshio Kitamura for providing the caSTAT5A1*6 plasmid and James Lord, James Moon, and Bryan Carson for materials and advice.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This research was supported by National Institutes of Health Grant GM57931 and the British Columbia Cancer Foundation. E.T. was supported by a Canada Graduate Scholarship (CGS-M) from the National Sciences and Engineering Research Council of Canada. Back

2 H.M.L. and E.T. contributed equally to this study. Back

3 Address correspondence and reprint requests to Dr. Brad H. Nelson, 2410 Lee Avenue, Victoria, British Columbia, Canada. E-mail address: bnelson{at}bccancer.bc.ca Back

4 Abbreviations used in this paper: PIP3, phosphatidylinositol 3,4,5-triphosphate; PDK1, phosphoinositide-dependent kinase 1; caSTAT5, constitutively active mutant of STAT5; QPCR, quantitative PCR; wtSTAT5A, wild-type STAT5A. Back

Received for publication May 9, 2007. Accepted for publication August 6, 2007.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Anaya, J. P., J. J. Sias. 2005. The use of interleukin-2 in human immunodeficiency virus infection. Pharmacotherapy 25: 86-95. [Medline]
  2. Eklund, J. W., T. M. Kuzel. 2005. Interleukin-2 in the treatment of renal cell carcinoma and malignant melanoma. Cancer Treat. Res. 126: 263-287. [Medline]
  3. Smith, K. A.. 1988. Interleukin-2: inception, impact, and implications. Science 240: 1169-1176. [Abstract/Free Full Text]
  4. Nelson, B. H., D. M. Willerford. 1998. Biology of the interleukin-2 receptor. Adv. Immunol. 70: 1-81. [Medline]
  5. Leonard, W. J., J. J. O’Shea. 1998. Jaks and STATs: biological implications. Annu. Rev. Immunol. 16: 293-322. [Medline]
  6. Friedmann, M. C., T. S. Migone, S. M. Russell, W. J. Leonard. 1996. Different interleukin 2 receptor beta-chain tyrosines couple to at least two signaling pathways and synergistically mediate interleukin 2-induced proliferation. Proc. Natl. Acad. Sci. USA 93: 2077-2082. [Abstract/Free Full Text]
  7. Gaffen, S. L., S. Y. Lai, M. Ha, X. Liu, L. Hennighausen, W. C. Greene, M. A. Goldsmith. 1996. Distinct tyrosine residues within the interleukin-2 receptor beta-chain drive signal transduction specificity, redundancy, and diversity. J. Biol. Chem. 271: 21381-21390. [Abstract/Free Full Text]
  8. Evans, G. A., M. A. Goldsmith, J. A. Johnston, W. Xu, S. R. Weiler, R. Erwin, O. M. Howard, R. T. Abraham, J. J. O’Shea, W. C. Greene, et al 1995. Analysis of interleukin-2-dependent signal transduction through the Shc/Grb2 adapter pathway: interleukin-2-dependent mitogenesis does not require Shc phosphorylation or receptor association. J. Biol. Chem. 270: 28858-28863. [Abstract/Free Full Text]
  9. Ravichandran, K. S., S. J. Burakoff. 1994. The adapter protein Shc interacts with the interleukin-2 (IL-2) receptor upon IL-2 stimulation. J. Biol. Chem. 269: 1599-1602. [Abstract/Free Full Text]
  10. Fujii, H., Y. Nakagawa, U. Schindler, A. Kawahara, H. Mori, F. Gouilleux, B. Groner, J. N. Ihle, Y. Minami, T. Miyazaki, et al 1995. Activation of Stat5 by interleukin 2 requires a carboxyl-terminal region of the interleukin 2 receptor beta-chain but is not essential for the proliferative signal transmission. Proc. Natl. Acad. Sci. USA 92: 5482-5486. [Abstract/Free Full Text]
  11. Gaffen, S. L., S. Y. Lai, W. Xu, F. Gouilleux, B. Groner, M. A. Goldsmith, W. C. Greene. 1995. Signaling through the interleukin 2 receptor beta-chain activates a STAT-5-like DNA-binding activity. Proc. Natl. Acad. Sci. USA 92: 7192-7196. [Abstract/Free Full Text]
  12. Izquierdo Pastor, M., K. Reif, D. Cantrell. 1995. The regulation and function of p21ras during T-cell activation and growth. Immunol. Today 16: 159-164. [Medline]
  13. Lord, J. D., B. C. McIntosh, P. D. Greenberg, B. H. Nelson. 1998. The IL-2 receptor promotes proliferation, bcl-2 and bcl-x induction, but not cell viability through the adapter molecule Shc. J. Immunol. 161: 4627-4633. [Abstract/Free Full Text]
  14. Gadina, M., C. Sudarshan, R. Visconti, Y. J. Zhou, H. Gu, B. G. Neel, J. J. O’Shea. 2000. The docking molecule gab2 is induced by lymphocyte activation and is involved in signaling by interleukin-2 and interleukin-15 but not other common {gamma}-chain-using cytokines. J. Biol. Chem. 275: 26959-26966. [Abstract/Free Full Text]
  15. Gu, H., H. Maeda, J. J. Moon, J. D. Lord, M. Yoakim, B. H. Nelson, B. G. Neel. 2000. New role for Shc in activation of the phosphatidylinositol 3-kinase/Akt pathway. Mol. Cell. Biol. 20: 7109-7120. [Abstract/Free Full Text]
  16. Nishida, K., Y. Yoshida, M. Itoh, T. Fukada, T. Ohtani, T. Shirogane, T. Atsumi, M. Takahashi-Tezuka, K. Ishihara, M. Hibi, T. Hirano. 1999. Gab-family adapter proteins act downstream of cytokine and growth factor receptors and T- and B-cell antigen receptors. Blood 93: 1809-1816. [Abstract/Free Full Text]
  17. Bader, A. G., S. Kang, L. Zhao, P. K. Vogt. 2005. Oncogenic PI3K deregulates transcription and translation. Nat. Rev. Cancer 5: 921-929. [Medline]
  18. Luo, J., B. D. Manning, L. C. Cantley. 2003. Targeting the PI3K-Akt pathway in human cancer: rationale and promise. Cancer Cell 4: 257-262. [Medline]
  19. Cantley, L. C.. 2002. The phosphoinositide 3-kinase pathway. Science 296: 1655-1657. [Abstract/Free Full Text]
  20. Cully, M., H. You, A. J. Levine, T. W. Mak. 2006. Beyond PTEN mutations: the PI3K pathway as an integrator of multiple inputs during tumorigenesis. Nat. Rev. Cancer 6: 184-192. [Medline]
  21. Vivanco, I., C. L. Sawyers. 2002. The phosphatidylinositol 3-kinase AKT pathway in human cancer. Nat. Rev. Cancer 2: 489-501. [Medline]
  22. Seger, R., E. G. Krebs. 1995. The MAPK signaling cascade. FASEB J. 9: 726-735. [Abstract]
  23. Crawley, J. B., J. Willcocks, B. M. Foxwell. 1996. Interleukin-7 induces T cell proliferation in the absence of Erk/MAP kinase activity. Eur. J. Immunol. 26: 2717-2723. [Medline]
  24. Moon, J. J., B. H. Nelson. 2001. Phosphatidylinositol 3-kinase potentiates, but does not trigger, T cell proliferation mediated by the IL-2 receptor. J. Immunol. 167: 2714-2723. [Abstract/Free Full Text]
  25. Brennan, P., J. W. Babbage, B. M. Burgering, B. Groner, K. Reif, D. A. Cantrell. 1997. Phosphatidylinositol 3-kinase couples the interleukin-2 receptor to the cell cycle regulator E2F. Immunity 7: 679-689. [Medline]
  26. Lali, F. V., J. Crawley, D. A. McCulloch, B. M. Foxwell. 2004. A late, prolonged activation of the phosphatidylinositol 3-kinase pathway is required for T cell proliferation. J. Immunol. 172: 3527-3534. [Abstract/Free Full Text]
  27. Moon, J. J., E. D. Rubio, A. Martino, A. Krumm, B. H. Nelson. 2004. A permissive role for phosphatidylinositol 3-kinase in the Stat5-mediated expression of cyclin D2 by the interleukin-2 receptor. J. Biol. Chem. 279: 5520-5527. [Abstract/Free Full Text]
  28. Mui, A. L., H. Wakao, N. Harada, A. M. O’Farrell, A. Miyajima. 1995. Interleukin-3, granulocyte-macrophage colony-stimulating factor, and interleukin-5 transduce signals through two forms of STAT5. J. Leukocyte Biol. 57: 799-803. [Abstract]
  29. Wittig, I., B. Groner. 2005. Signal transducer and activator of transcription 5 (STAT5), a crucial regulator of immune and cancer cells. Curr. Drug Targets Immune Endocr. Metabol. Disord. 5: 449-463. [Medline]
  30. Debierre-Grockiego, F.. 2004. Anti-apoptotic role of STAT5 in haematopoietic cells and in the pathogenesis of malignancies. Apoptosis 9: 717-728. [Medline]
  31. Desrivieres, S., C. Kunz, I. Barash, V. Vafaizadeh, C. Borghouts, B. Groner. 2006. The biological functions of the versatile transcription factors STAT3 and STAT5 and new strategies for their targeted inhibition. J. Mammary Gland Biol. Neoplasia 11: 75-87. [Medline]
  32. Yoshimura, A., M. Ichihara, I. Kinjyo, M. Moriyama, N. G. Copeland, D. J. Gilbert, N. A. Jenkins, T. Hara, A. Miyajima. 1996. Mouse oncostatin M: an immediate early gene induced by multiple cytokines through the JAK-STAT5 pathway. EMBO J. 15: 1055-1063. [Medline]
  33. Matsumoto, A., M. Masuhara, K. Mitsui, M. Yokouchi, M. Ohtsubo, H. Misawa, A. Miyajima, A. Yoshimura. 1997. CIS, a cytokine inducible SH2 protein, is a target of the JAK-STAT5 pathway and modulates STAT5 activation. Blood 89: 3148-3154. [Abstract/Free Full Text]
  34. John, S., C. M. Robbins, W. J. Leonard. 1996. An IL-2 response element in the human IL-2 receptor {alpha}-chain promoter is a composite element that binds Stat5, Elf-1, HMG-IY, and a GATA family protein. EMBO J. 15: 5627-5635. [Medline]
  35. Lord, J. D., B. C. McIntosh, P. D. Greenberg, B. H. Nelson. 2000. The IL-2 receptor promotes lymphocyte proliferation and induction of the c-myc, bcl-2, and bcl-x genes through the trans-activation domain of Stat5. J. Immunol. 164: 2533-2541. [Abstract/Free Full Text]
  36. Moriggl, R., D. J. Topham, S. Teglund, V. Sexl, C. McKay, D. Wang, A. Hoffmeyer, J. van Deursen, M. Y. Sangster, K. D. Bunting, et al 1999. Stat5 is required for IL-2-induced cell cycle progression of peripheral T cells. Immunity 10: 249-259. [Medline]
  37. Dumon, S., S. C. Santos, F. Debierre-Grockiego, V. Gouilleux-Gruart, L. Cocault, C. Boucheron, P. Mollat, S. Gisselbrecht, F. Gouilleux. 1999. IL-3 dependent regulation of Bcl-xL gene expression by STAT5 in a bone marrow derived cell line. Oncogene 18: 4191-4199. [Medline]
  38. Nosaka, T., T. Kawashima, K. Misawa, K. Ikuta, A. L. Mui, T. Kitamura. 1999. STAT5 as a molecular regulator of proliferation, differentiation, and apoptosis in hematopoietic cells. EMBO J. 18: 4754-4765. [Medline]
  39. Nyga, R., C. Pecquet, N. Harir, H. Gu, I. Dhennin-Duthille, A. Regnier, V. Gouilleux-Gruart, K. Lassoued, F. Gouilleux. 2005. Activated STAT5 proteins induce activation of the PI 3-kinase/Akt and Ras/MAPK pathways via the Gab2 scaffolding adapter. Biochem. J. 390: 359-366. [Medline]
  40. Santos, S. C., V. Lacronique, I. Bouchaert, R. Monni, O. Bernard, S. Gisselbrecht, F. Gouilleux. 2001. Constitutively active STAT5 variants induce growth and survival of hematopoietic cells through a PI 3-kinase/Akt dependent pathway. Oncogene 20: 2080-2090. [Medline]
  41. Rosa Santos, S. C., S. Dumon, P. Mayeux, S. Gisselbrecht, F. Gouilleux. 2000. Cooperation between STAT5 and phosphatidylinositol 3-kinase in the IL-3-dependent survival of a bone marrow derived cell line. Oncogene 19: 1164-1172. [Medline]
  42. Van Parijs, L., Y. Refaeli, J. D. Lord, B. H. Nelson, A. K. Abbas, D. Baltimore. 1999. Uncoupling IL-2 signals that regulate T cell proliferation, survival, and Fas-mediated activation-induced cell death. Immunity 11: 281-288. [Medline]
  43. Wang, D., D. Stravopodis, S. Teglund, J. Kitazawa, J. N. Ihle. 1996. Naturally occurring dominant negative variants of Stat5. Mol. Cell. Biol. 16: 6141-6148. [Abstract]
  44. Oda, A., H. Wakao, H. Fujita. 2002. Calpain is a signal transducer and activator of transcription (STAT) 3 and STAT5 protease. Blood 99: 1850-1852. [Abstract/Free Full Text]
  45. Schuster, B., L. Hendry, H. Byers, S. F. Lynham, M. A. Ward, S. John. 2007. Purification and identification of the STAT5 protease in myeloid cells. Biochem. J. 404: 81-87. [Medline]
  46. Ramos, H. L., J. J. O’Shea, W. T. Watford. 2007. STAT5 isoforms: controversies and clarifications. Biochem. J. 404: e1-e2. [Medline]
  47. Mui, A. L., H. Wakao, T. Kinoshita, T. Kitamura, A. Miyajima. 1996. Suppression of interleukin-3-induced gene expression by a C-terminal truncated Stat5: role of Stat5 in proliferation. EMBO J. 15: 2425-2433. [Medline]
  48. Moriggl, R., V. Gouilleux-Gruart, R. Jahne, S. Berchtold, C. Gartmann, X. Liu, L. Hennighausen, A. Sotiropoulos, B. Groner, F. Gouilleux. 1996. Deletion of the carboxyl-terminal transactivation domain of MGF-Stat5 results in sustained DNA binding and a dominant negative phenotype. Mol. Cell. Biol. 16: 5691-5700. [Abstract]
  49. Yamashita, H., H. Iwase, T. Toyama, Y. Fujii. 2003. Naturally occurring dominant-negative Stat5 suppresses transcriptional activity of estrogen receptors and induces apoptosis in T47D breast cancer cells. Oncogene 22: 1638-1652. [Medline]
  50. Socolovsky, M., A. E. Fallon, S. Wang, C. Brugnara, H. F. Lodish. 1999. Fetal anemia and apoptosis of red cell progenitors in Stat5a–/–5b–/– mice: a direct role for Stat5 in Bcl-xL induction. Cell 98: 181-191. [Medline]
  51. Satoh, T., Y. Minami, T. Kono, K. Yamada, A. Kawahara, T. Taniguchi, Y. Kaziro. 1992. Interleukin 2-induced activation of Ras requires two domains of interleukin 2 receptor beta subunit, the essential region for growth stimulation and Lck-binding domain. J. Biol. Chem. 267: 25423-25427. [Abstract/Free Full Text]
  52. Hatakeyama, M., H. Mori, T. Doi, T. Taniguchi. 1989. A restricted cytoplasmic region of IL-2 receptor beta-chain is essential for growth signal transduction but not for ligand binding and internalization. Cell 59: 837-845. [Medline]
  53. Chatterjee-Kishore, M., K. L. Wright, J. P. Ting, G. R. Stark. 2000. How Stat1 mediates constitutive gene expression: a complex of unphosphorylated Stat1 and IRF1 supports transcription of the LMP2 gene. EMBO J. 19: 4111-4122. [Medline]
  54. Gunning, P., J. Leavitt, G. Muscat, S. Y. Ng, L. Kedes. 1987. A human beta-actin expression vector system directs high-level accumulation of antisense transcripts. Proc. Natl. Acad. Sci. USA 84: 4831-4835. [Abstract/Free Full Text]
  55. Onishi, M., T. Nosaka, K. Misawa, A. L. Mui, D. Gorman, M. McMahon, A. Miyajima, T. Kitamura. 1998. Identification and characterization of a constitutively active STAT5 mutant that promotes cell proliferation. Mol. Cell. Biol. 18: 3871-3879. [Abstract/Free Full Text]
  56. Kitamura, T., K. Hayashida, K. Sakamaki, T. Yokota, K. Arai, A. Miyajima. 1991. Reconstitution of functional receptors for human granulocyte/macrophage colony-stimulating factor (GM-CSF): evidence that the protein encoded by the AIC2B cDNA is a subunit of the murine GM-CSF receptor. Proc. Natl. Acad. Sci. USA 88: 5082-5086. [Abstract/Free Full Text]
  57. Nelson, B. H., J. D. Lord, P. D. Greenberg. 1996. A membrane-proximal region of the interleukin-2 receptor {gamma}c chain sufficient for Jak kinase activation and induction of proliferation in T cells. Mol. Cell. Biol. 16: 309-317. [Abstract]
  58. Ravichandran, K. S., V. Igras, S. E. Shoelson, S. W. Fesik, S. J. Burakoff. 1996. Evidence for a role for the phosphotyrosine-binding domain of Shc in interleukin 2 signaling. Proc. Natl. Acad. Sci. USA 93: 5275-5280. [Abstract/Free Full Text]
  59. Fukada, T., M. Hibi, Y. Yamanaka, M. Takahashi-Tezuka, Y. Fujitani, T. Yamaguchi, K. Nakajima, T. Hirano. 1996. Two signals are necessary for cell proliferation induced by a cytokine receptor gp130: involvement of STAT3 in anti-apoptosis. Immunity 5: 449-460. [Medline]
  60. Lai, C. F., J. Ripperger, K. K. Morella, Y. Wang, D. P. Gearing, G. H. Fey, H. Baumann. 1995. Separate signaling mechanisms are involved in the control of STAT protein activation and gene regulation via the interleukin 6 response element by the box 3 motif of gp130. J. Biol. Chem. 270: 14847-14850. [Abstract/Free Full Text]
  61. Burchill, M. A., J. Yang, C. Vogtenhuber, B. R. Blazar, M. A. Farrar. 2007. IL-2 receptor beta-dependent STAT5 activation is required for the development of Foxp3+ regulatory T cells. J. Immunol. 178: 280-290. [Abstract/Free Full Text]
  62. Harir, N., C. Pecquet, M. Kerenyi, K. Sonneck, B. Kovacic, R. Nyga, M. Brevet, I. Dhennin, V. Gouilleux-Gruart, H. Beug, et al 2007. Constitutive activation of Stat5 promotes its cytoplasmic localization and association with PI 3-kinase in myeloid leukemias. Blood 109: 1678-86. [Abstract/Free Full Text]
  63. Moriggl, R., V. Sexl, L. Kenner, C. Duntsch, K. Stangl, S. Gingras, A. Hoffmeyer, A. Bauer, R. Piekorz, D. Wang, et al 2005. Stat5 tetramer formation is associated with leukemogenesis. Cancer Cell 7: 87-99. [Medline]
  64. Price, D. J., R. A. Nemenoff, J. Avruch. 1989. Purification of a hepatic S6 kinase from cycloheximide-treated rats. J. Biol. Chem. 264: 13825-13833. [Abstract/Free Full Text]
  65. Du, K., P. N. Tsichlis. 2005. Regulation of the Akt kinase by interacting proteins. Oncogene 24: 7401-7409. [Medline]
  66. Sarbassov, D. D., D. A. Guertin, S. M. Ali, D. M. Sabatini. 2005. Phosphorylation and regulation of Akt/PKB by the Rictor-mTOR complex. Science 307: 1098-1101. [Abstract/Free Full Text]
  67. Maira, S. M., I. Galetic, D. P. Brazil, S. Kaech, E. Ingley, M. Thelen, B. A. Hemmings. 2001. Carboxyl-terminal modulator protein (CTMP), a negative regulator of PKB/Akt and v-Akt at the plasma membrane. Science 294: 374-380. [Abstract/Free Full Text]
  68. Jones, S. M., R. Klinghoffer, G. D. Prestwich, A. Toker, A. Kazlauskas. 1999. PDGF induces an early and a late wave of PI 3-kinase activity, and only the late wave is required for progression through G1. Curr. Biol. 9: 512-521. [Medline]



This article has been cited by other articles:


Home page
 Infect. Immun.Home page
K. J. Marr, G. J. Jones, C. Zheng, S. M. Huston, M. Timm-McCann, A. Islam, B. M. Berenger, L. L. Ma, J. C. D. Wiseman, and C. H. Mody
Cryptococcus neoformans Directly Stimulates Perforin Production and Rearms NK Cells for Enhanced Anticryptococcal Microbicidal Activity
Infect. Immun., June 1, 2009; 77(6): 2436 - 2446.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
J. A. Wofford, H. L. Wieman, S. R. Jacobs, Y. Zhao, and J. C. Rathmell
IL-7 promotes Glut1 trafficking and glucose uptake via STAT5-mediated activation of Akt to support T-cell survival
Blood, February 15, 2008; 111(4): 2101 - 2111.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lockyer, H. M.
Right arrow Articles by Nelson, B. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lockyer, H. M.
Right arrow Articles by Nelson, B. H.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS