The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


The Journal of Immunology, 2007, 179, 4435 -4443
Copyright © 2007 by The American Association of Immunologists, Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, M.
Right arrow Articles by Clark, M. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, M.
Right arrow Articles by Clark, M. R.
Right arrowPubmed/NCBI databases
*Substance via MeSH

Ubiquitinylation of Igbeta Dictates the Endocytic Fate of the B Cell Antigen Receptor1

Miao Zhang*,{ddagger}, Margaret Veselits*, Shannon O’Neill*, Ping Hou*, Alagarsamy L. Reddi#, Ilana Berlin§, Masato Ikeda||, Piers D. Nash§, Richard Longnecker||, Hamid Band#,** and Marcus R. Clark2,*,{dagger},{ddagger}

* Section of Rheumatology, Department of Medicine, {dagger} Committee on Immunology, {ddagger} Department of Pathology, § Ben May Institute for Cancer Research, and Biochemistry and Molecular Biology, University of Chicago, IL 60637; || Department of Microbiology-Immunology, # Division of Molecular Oncology, Department of Medicine, Evanston Northwestern Healthcare Research Institute, Feinberg School of Medicine, and ** Department of Biochemistry, Molecular Biology and Cell Biology, and Robert H. Lurie Comprehensive Cancer Center, Northwestern University, Evanston, IL 60211


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
In both infection and autoimmunity, the development of high-affinity Abs and memory requires B cells to efficiently capture and process Ags for presentation to cognate T cells. Although a great deal is known about how Ags are processed, the molecular mechanisms by which the BCR captures Ag for processing are still obscure. In this study, we demonstrate that the Igbeta component of the BCR is diubiquitinylated and that this is dependent on the E3 ligase Itch. Itch–/– B lymphocytes manifest both a defect in ligand-induced BCR internalization and endocytic trafficking to late endosomal Ag-processing compartments. In contrast, analysis of ubiquitinylation-defective receptors demonstrated that the attachment of ubiquitins to Igbeta is required for endosomal sorting and for the presentation of Ag to T cells, yet, ubiquitinylation is dispensable for receptor internalization. Membrane-bound Igµ was not detectably ubiquitinylated nor were the conserved lysines in the mu cytosolic tail required for trafficking to late endosomes. These results demonstrate that ubiquitinylation of a singular substrate, Igbeta, is required for a specific receptor trafficking event. However, they also reveal that E3 ligases play a broader role in multiple processes that determine the fate of Ag-engaged BCR complexes.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The ability of B lymphocytes to capture, process, and present Ags to T cells is requisite for normal humoral immune responses (1) and contributes to the pathogenesis of both B and T cell-mediated autoimmune diseases (2). B lymphocytes preferentially capture polyvalent Ags which, by aggregating the BCR and initiating signaling cascades, elicit a coordinated series of cellular responses which ensure that even low-affinity Ags are productively captured (3). Among these responses is the accelerated endocytosis and delivery of engaged receptors to MHC class II-enriched late endosomes (3). Most commonly, the MHC class II containing compartment resembles late endosomes with a complex structure consisting of a limiting membrane studded with Lamp-1 and a lumen containing MHC class II-bearing intraluminal multivesicular bodies (IMBs)3 (4) derived from BCR-laden transport vesicles (5). Following Ag processing and the loading of MHC class II with peptide, the IMBs are either transported to the cell surface, where they define the interface with cognate T cells (6), or secreted as exosomes (7). Despite the importance of delivering Ag to the late endosomal-processing compartments, little is known about how this occurs.

IMBs are not unique to lymphocytes but are a characteristic feature of late endosomes/lysosomes in both yeast and select mammalian cells. Recent advances in these systems have identified how proteins are targeted for inclusion in IMBs (8, 9). Receptors labeled with single ubiquitin (Ub) molecules are recognized in early endosomes by Hrs/Vps27p and ESCRT I complexes which sort receptors toward late endosomes (10). At the limiting membrane of targeted vesicles, components of the ESCRT II/III complex (11, 12) segregate ubiquitinylated molecules into IMBs (13, 14). In some cases ubiquitinylation of receptors, or of components of the endocytic machinery, can initiate sorting into clathrin-coated pits and receptor endocytosis (15, 16).

Labeling receptors with Ub requires the successive activities of three classes of enzymes. Ub-activating enzyme (E1) binds Ub and mediates transfer to a Ub-conjugating enzyme (E2). Final substrate specificity is determined by an Ub protein ligase (E3) which transfers Ub to the {epsilon}-amino group of a lysine in the targeted protein. Of the over 100 E3 ligases that have been identified (17), most can be classified into two families based on shared catalytic domains: the homologous to the E6-associated protein C terminus (HECT) and really interesting new gene (RING) families. RING-type E3 ligases such as C-cbl and cbl-b function as adaptor proteins between Ub-E2 conjugates and substrates, whereas HECT-type E3 ligases such as Itch, Nedd4, and AIP4 accept activated Ub from an E2 and transfer it to the targeted substrate (18).

In this report, we demonstrate that the HECT family E3 ligase Itch mediates the constitutive ubiquitinylation of the BCR Igbeta chain and that this is required for normal sorting through the endocytic pathway. In the absence of either Itch or Igbeta ubiquitinylation, internalized BCRs arrest in early endosomes and do not traffic to late endosomal Ag-processing compartments. In contrast, comparison of Itch–/– B lymphocytes and ubiquitinylation-defective BCR complexes revealed that Itch plays an additional role in mediating BCR internalization. These results began to define the molecular events mediating the capture of Ag by B cells for processing and presentation to cognate T cells.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Cell lines

The murine B cell lymphoma A20IIA1.6 (IgG2a+, FcR, I-Ad+, and I-Ed+) was cultured in DMEM (Invitrogen Life Technologies) containing 10% FBS (Sigma-Aldrich), 2 mM glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin at 37°C in 7.5% CO2.

Signal-transducing adaptor molecule (STAM) fusion proteins

The tandem Vps27-h-STAM (VHS)-Ub-interacting motif (UIM) domains from adaptor proteins STAM1 and STAM2, corresponding to amino acid positions 1–213 and 1–192, respectively, were cloned into the pGEX-2TK bacterial expression vector (Amersham Biosciences). GST-VHS-UIM fusion proteins were expressed in Escherichia coli strain BL21 and purified on glutathione-conjugated agarose beads (Pierce). The ability of eluted soluble GST-VHS-UIM protein fragments to bind Ub was confirmed in binding assays with Ub-conjugated agarose beads (Boston Biochem) (data not shown).

Derivation of 3-83µ-expressing cell lines

RNA was isolated from 3-83µ-transgenic splenic B cells (D. Nemazee, The Scripps Research Institute, La Jolla, Ca) with TRIzol (Invitrogen Life Technologies). RT-PCR was conducted using the SuperScript II Reverse Transcriptase kit (Invitrogen Life Technologies) followed by PCR (Pfu Turbo; Stratagene) with primers to amplify the open reading frame encoding wild-type (WT) 3-83µ (mu WT, forward: CGAGGTACCACCATGGAATGGCTGTGGAACTTG, reverse: ATAAGAATGCGGCCGCTCATTTCACCTTGAACAGGGTGAC) or 3-83µ in which the two cytosolic lysines had been mutated to arginines K{Delta}R, reverse: ATAAGAATGCGGCCGCTCACCTCACTCTGAACAGGGTGACGGTG). The resulting PCR products were sequenced and then subcloned into pcDNAneo (Invitrogen Life Technologies). A20IIA1.6 cells were transfected with each plasmid (Amaxa Nucleofection) and stable cell lines were derived by limiting dilution and G418 selection (1 mg/ml; Invitrogen Life Technologies). Cell lines expressing similar levels of surface mu, as ascertained by flow cytometry, were selected for further analysis.

Derivation and analysis of chimeras

The methods for construction, expression, and activation of the platelet-derived growth factor receptor (PDGFR) chimeras have been previously described (19). The three lysines of the cytoplasmic tail of Igbeta were mutated to alanines using complementary primers and PCR. The mutated cDNA PDGFR{alpha}/IgbetaK{Delta}A was inserted into the retroviral vector MIGR1 (H. Singh, University of Chicago, Chicago, IL). Virus was produced in the packaging cell line GP293 (BD Clontech). Forty-eight hours later, supernatants were collected and transferred into A20IIA1.6 cells expressing PDGFRbeta/Ig{alpha} alone (19). Infected cells expressing enhanced green fluorescent protein were isolated by flow cytometric sorting (FACS; FACScan; BD Biosciences). To assess surface expression of each chimeric receptor, cells were labeled with mouse anti-PDGFR{alpha} and anti-PDGFRbeta Abs (R&D Systems) followed by PE-conjugated anti-mouse IgG1 (BD Biosciences). Samples were then examined by flow cytometry (FACScan; BD Biosciences).

Confocal microscopy

Purified B splenocytes were stained with FITC-conjugated goat anti-mouse IgG plus IgM F(ab)2 (Jackson ImmunoResearch Laboratories) at 10 µg/ml on ice for 15 min. For A20IIA1.6 cells, the BCR was labeled by incubation with 10 µg/ml goat anti-mouse IgG2a (Southern Biotechnology Associates) on ice for 15 min, followed by Cy5-conjugated donkey anti-goat IgG (Jackson ImmunoResearch Laboratories) at 10 µg/ml. The chimeras were labeled as described (19) by sequential incubation of cells on ice with PDGF-BB ligand (Sigma-Aldrich) for 3 min, mouse anti-PDGFRbeta Abs (Genzyme) for 15 min, and finally PE-conjugated rabbit anti-mouse IgG1 (BD Biosciences) for 15 min. Labeled cells were stimulated by warming to 37°C for the indicated times. Samples were then fixed in 100% methanol for 5 min at –20°C and then permeabilized with PBS containing 0.1 mM Bis-(sulfosuccinimidyl) suberate (BS3; Pierce) and 0.1% n-octyl-beta-D-glucopyranoside (OGP; Sigma-Aldrich) at 25°C for 15 min. Excess BS3 was quenched with 100 mM ethylenediamine (pH 7.5; Sigma-Aldrich) at 25°C for 15 min. Samples were then blocked in 1% nonfat powdered milk/PBS/0.1% OGP and stained with ID4B (American Type Culture Collection) as described previously (20). For transferrin receptor staining, cells were incubated in serum-starved medium (0.5% FCS) for 48 h, loaded with 10 µg/ml Alexa 594-transferrin (Molecular Probes) at 37°C for 10 min, then stimulated with Alexa 647-conjugated Abs (Molecular Probes) for 30 min and fixed as described above. Images were collected using a Leica TCS SP2 AOBS confocal microscope (Leica). Where indicated, strong colocalization was defined as >50% overlap in the distribution of two different markers in a single cell while weak colocalization was defined as between 1 and 10% overlap. For each experimental time point, 50 cells were counted and all experiments were done in triplicate.

B splenocyte purification

The studies described in this article have been reviewed and approved by the University of Chicago Institutional Review Board. Spleens were isolated from BALB/c WT mice, Itch–/– C57BL/6 mice or Itch+/+ littermate controls. All mice were 6–10 wk old. Following hypotonic lysis, splenocytes were incubated with biotinylated anti-CD11b, anti-CD11C, anti-Grl, anti-CD3, anti-CD4, anti-CD8, anti-NK1.1, and anti-TER 119 (BD Biosciences) on ice for 30 min, washed, then incubated with streptavidin microbeads (Miltenyi Biotec) for 30 min at 4°C. Following separation by MACS column (Miltenyi Biotec), purity of B cells was assayed by flow cytometry. Only populations of >90% purity were used in experiments.

Receptor internalization

Purified splenic B or A20IIA1.6 cells were stained for either the BCR or chimeric receptor as described above. Cells were then incubated at 37°C for the indicated intervals and then placed on ice. To remove surface-bound Abs, 300 µl of stripping buffer (100 mM glycine, 100 mM NaCl (pH 2.5)) was added to each sample at room temperature for 2 min. Cells were then washed twice with ice-cold FACS buffer (3% FBS in PBS) and examined by flow cytometry (FACScan; BD Biosciences). The percentage of internalized receptors was calculated using the following formula: percent SRt = 100 x (ARFt – AF)/(SF AF) where SRt is the percent of surface receptor internalized at time "t", ARFt is the acid-resistant fluorescence at time "t", AF indicates cellular autofluorescence of cells (median fluorescence of unstained cells or cells that were stained and then acid-stripped), and SF refers to the median fluorescence of cells that were stained for 30 min at 4°C.

Immunoprecipitation and immunoblotting

Purified splenocytes or A20IIA1.6 cells were stimulated via the BCR or chimeric receptor as described above. Following stimulation, cells were lysed with 1% Nonidet P-40 lysis buffer on ice, precleared with protein A-Sepharose (Amersham Biosciences) and immunoprecipitated with the murine mAb P4D1 (Santa Cruz Biotechnology) at 4°C overnight. Samples were resolved by SDS-PAGE (10%) and transferred to nitrocellulose filters (VWR Scientific). The filters were then blocked with 3% BSA-TBS (pH 8.0) with 1% Triton X-100. Filters were then incubated with either affinity purified anti-Ig{alpha} or anti-Igbeta rabbit antisera (19). As these Abs were raised to GST fusion proteins, antisera were extensively preabsorbed with GST-agarose before use. Filters were then incubated with HRP-conjugated secondary Abs. Washed filters were developed using ECL (Amersham Bioscience).

Ag presentation to T cells

To assess Ag presentation by the PDGFR chimeras, the receptors on aliquots of cells (105/sample) were first aggregated as described above and then targeted with serial dilutions of rabbit anti-rat IgG1 at 37°C for 45 min. Cells were then washed and used as APCs in assays with the T cell hybridoma 2R50 which is specific for a rabbit IgG-derived peptide (21) (3 x 104 T cells/assay in a final volume of 200 µl). After 36 h, IL-2 production was measured by ELISA (OptEIA; BD Biosciences). To measure Ag presentation by the 3-83 receptors, cell aliquots (105/sample) were incubated with serial dilutions of rabbit anti-mouse mu-specific Abs at 37°C for 45 min and then cocultured for 36 h with 2R50 cells and IL-2 production assayed as above.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Igbeta is diubiquitinylated

Studies in both mammalian and yeast cells have demonstrated that ubiquitinylation is a signal for receptor internalization, intracellular trafficking, and lysosome-mediated degradation (9). To investigate whether ubiquitinylation contributes to BCR endocytosis and endocytic trafficking, we first determined whether endogenous Ig{alpha} and/or Igbeta were ubiquitinylated. Lysates from resting purified splenic B lymphocytes from 6- to 10-wk-old BALB/c WT mice were precleared with protein A-Sepharose and then immunoprecipitated with anti-Ub or isotype control Abs. Samples were then resolved by SDS-PAGE, transferred to nylon membrane, and immunoblotted with anti-Igbeta Abs (19). As a loading control, a fraction of each sample lysate was also immunoblotted for actin. As seen in Fig. 1A, one prominent band with a relative molecular mass of 54 kDa was reactive with both anti-Igbeta and anti-Ub Abs (n = 5). Following stimulation of the BCR with rabbit anti-IgM plus IgG F(ab)2 Ab, the intensity of this immunoreactive species decreases over time (Fig. 1B). Reciprocal immunoprecipitation and immunoblot experiments yielded similar results (data not shown). The relative molecular mass of murine Igbeta is ~37 kDa (22) while that of Ub is 8 kDa. Therefore, the molecular mass and immunoreactivity of the 54-kDa species was consistent with diubiquitinylated Igbeta.


Figure 1
View larger version (25K):
[in this window]
[in a new window]

 
FIGURE 1. Ubiquitinylation of Igbeta in splenic B lymphocytes. A, Lysates from resting splenic B lymphocytes (107/sample) were precleared with protein A-Sepharose and then immunoprecipitated with mouse anti-Ub or isotype control Abs. Precipitations were resolved by SDS-PAGE and immunoblotted with rabbit anti-Igbeta Abs. As a control, aliquots of each lysate were resolved by SDS-PAGE and immunoblotted with anti-actin Abs. B, Splenic B cells (107/sample) were stimulated with anti-IgM plus IgG F(ab)2 Ab(10 µg/ml) for the indicated times (minutes), precleared, and then immunoprecipitated with anti-Ub Abs. Precipitations were then analyzed as in A. C, Lysates from aliquots of splenic B cells (107/sample) were stimulated with anti-IgM plus IgG F(ab)2 Ab for the indicated times (minutes) then precipitated with the indicated GST-STAM1 fusion proteins bound to glutathione-agarose. Precipitations were resolved by SDS-PAGE and then immunoblotted with rabbit anti-Igbeta Abs. D, Lysates from aliquots of splenic B cells (107/sample) were precipitated with indicated GST-STAM1 or GST-STAM2 fusion proteins bound to glutathione-agarose and immunoblotted as in C. The GST-STAM 1 and GST-STAM 2 fusion proteins are faintly visible with relative molecular masses of 48 and 40 kDa, respectively.

 
To confirm that Igbeta was ubiquitinylated, we next examined whether Igbeta could be precipitated with monoubiquitin-binding domains. The STAM 1 is involved in recognizing and sorting ubiquitinylated receptor complexes (9, 23, 24). For both STAM 1 and the family member STAM 2, Ub binding is mediated by tandem Vps27-h-STAM (VHS) and Ub-interacting motif (UIM) domains. We constructed a GST fusion protein containing the STAM 1 or STAM 2 VHS and UIM domains and used these in pull-down assays with splenic B cell lysates. As seen in Fig. 1C, the STAM 1 fusion protein precipitated a 54-kDa species that was reactive with anti-Igbeta Abs. Interestingly, the interaction with STAM1 was specific, as the corresponding STAM2 fusion protein did not precipitate ubiquitinylated Igbeta (Fig. 1D). From these data, we conclude that Igbeta is ubiquitinylated.

We next examined whether Igbeta was ubiquitinylated in the B cell lymphoma cell line A20IIA1.6 (IgG2a+, FcR, I-Ad+, I-Ed+) (25). Aliquots of cells either were left unstimulated or were stimulated with rabbit anti-mouse IgG Abs for the indicated times (Fig. 2A). Samples were immunoprecipitated with anti-Ub Abs and immunoblotted with anti-Igbeta Abs as described above. As was observed in splenic B cells, a single immunoreactive band with a relative molecular mass of 54 kDa was observed. In contrast to splenic B lymphocytes, the amount of detectable material rapidly decreased following BCR stimulation (n = 5).


Figure 2
View larger version (45K):
[in this window]
[in a new window]

 
FIGURE 2. Igbeta is ubiquitinylated at the cell surface. A, Aliquots of A20IIA1.6 cells (107/sample) were stimulated with anti-IgG Abs (10 µg/ml) for the indicated times (minutes). Cell lysates were immunoprecipitated with anti-Ub Abs, resolved by SDS-PAGE, transferred to nylon membrane, and immunoblotted with anti-Igbeta Abs. As a control, aliquots of each lysate were resolved by SDS-PAGE and immunoblotted with anti-actin Abs. B, A20IIA.6 cells were stimulated as in A. Anti-Ub immunoprecipitates were Western blotted with anti-Ig{alpha} Abs.

 
To examine whether Ig{alpha} was ubiquitinylated, anti-Ub immunoprecipitations were immunoblotted with anti-Ig{alpha} Abs. As demonstrated in Fig. 2B, prolonged exposures (~20 times greater than those used in the previous experiments) revealed an ubiquitinylated protein with a relative molecular mass of 50 kDa, consistent with diubiquitinylated Ig{alpha} (22). The intensity of this band increased after 15 min and a higher molecular mass species consistent with triubiquitinylated Ig{alpha} was detected at 30 min. The delayed kinetics of Ig{alpha} ubiquitinylation indicates that it occurs after receptor endocytosis and sorting.

Itch is required for Igbeta ubiquitinylation

We next sought to identify the E3 ligase(s) required for ubiquitinylating Igbeta. A hint of which ligase might be involved was provided by studies demonstrating that Itch ubiquitinylated the EBV protein latent membrane protein 2A (LMP 2A) (26). As LMP 2A has structural and functional homology with the BCR, we examined whether Itch ubiquitinylated Igbeta.

Itch–/– mice and WT littermate controls were sacrificed and aliquots of purified B splenocytes either were left unstimulated or were stimulated with F(ab)2 anti-IgM plus IgG Abs for 30 min. Cells were immunoprecipitated with anti-Ub Abs, resolved by SDS-PAGE, transferred to nylon membrane, and immunoblotted with anti-Igbeta Abs. Total cell lysates were immunoblotted with anti-Ig{alpha} to assess the total amount of BCR expressed in each cell population and with anti-actin Abs as a loading control. Below each anti-Igbeta and anti-Ig{alpha} immunoreactive species is shown the relative density of that band divided by the relative density of the corresponding actin band. As can be seen in Fig. 3A, the amount of ubiquitinylated Igbeta in Itch–/– splenocytes was reduced ~5-fold in activated cells, and 10-fold in resting cells, when compared with littermate controls (n = 4). Although there was significantly less ubiquitinylated Igbeta in Itch–/– splenocytes, they expressed more BCR. Examination of total cell lysates for Ig{alpha} indicated that ~3-fold more BCR was available for immunoprecipitation from the lysates of resting Itch–/– splenocytes. This corresponded to a 3-fold higher BCR surface density on Itch–/– splenocytes compared with WT littermate controls (Fig. 3B, n = 3). Therefore, the fraction of Igbeta ubiquitinylated in Itch–/– splenocytes is <5–10% of that observed in WT cells. From these data, we conclude that Itch is required for normal Igbeta ubiquitinylation.


Figure 3
View larger version (23K):
[in this window]
[in a new window]

 
FIGURE 3. Igbeta ubiquitinylation is mediated by Itch. A, Purified B splenocytes from Itch–/– or Itch+/+ littermate controls were lysed, immunoprecipitated with anti-Ub Abs, and immunoblotted with anti-Igbeta Abs (upper panel). Corresponding total cell lysates were immunoblotted with anti-Ig{alpha} (middle panel) and anti-actin Abs (lower panel). Below each anti-Igbeta and -Ig{alpha} immunoreactive species is shown the relative density of that band divided by the relative density of the corresponding actin band. B, Purified splenocytes from WT (filled curve) or Itch–/– splenocytes (open curve) were stained with anti-IgM plus IgG F(ab)2 Abs and analyzed by flow cytometry.

 
Itch is required for normal BCR internalization and endocytic trafficking

We next determined whether Itch played a role in BCR internalization. The BCR complexes on splenic B cells from Itch–/– or WT littermate controls were labeled with PE-conjugated anti-IgM/IgG F(ab)2 Abs on ice for 15 min. Cells were then warmed to 37°C for the indicated times after which surface-retained Abs were stripped from the cell surface (27). Samples were then examined by flow cytometry and the percentage of internalized receptors was calculated as described in Materials and Methods. As demonstrated in Fig. 4A, aggregation-induced BCR internalization was attenuated in Itch–/– B splenocytes (n = 4).


Figure 4
View larger version (30K):
[in this window]
[in a new window]

 
FIGURE 4. Aberrant BCR trafficking in Itch–/– splenocytes. A, Ligand-induced BCR internalization on Itch–/– ({blacktriangleup}, lower curve) or littermate control ({diamondsuit}) splenocytes. Cells were labeled with PE-conjugated F(ab)2 anti-IgM plus IgG Abs on ice, washed, and warmed to 37°C for the indicated times. Samples were then stripped with glycine buffer to remove surface retained Abs and assayed by flow cytometry. B, Splenic Itch–/– or littermate control splenic B cells were stimulated with FITC-conjugated F(ab)2 anti-IgM plus IgG Abs (green) for 20 min, loaded with Alexa 594-conjugated transferrin (red) for 10 min at 37°C, fixed, and then visualized by confocal microscopy. C, Itch–/– or littermate control splenic B cells were stimulated with FITC-conjugated F(ab)2 anti-IgM plus IgG Abs (green) for 30 min. Cells were then fixed and counterstained with PE-conjugated ID4B (red) and visualized by confocal microscopy.

 
We next examined whether sorting of the ligated BCR out of early endosomes was dependent upon Itch. Cell aliquots were first loaded with Alexa 594-conjugated transferrin (Tf) to label early endosomes and then stimulated with FITC-conjugated anti-IgM plus IgG F(ab)2 Abs for 30 min. Samples were then fixed and visualized by confocal microscopy. In WT splenic B cells, there was essentially no detectable colocalization of the internalized BCR with Tf+ early endosomes (2 of 50 cells per experiment ± 2, n = 3) (Fig. 4B). In contrast, in the Itch–/– B splenocytes, the internalized BCR strongly colocalized with Tf+ early endosomes (44/50 ± 4, n = 3).

It is possible that the observed differences in BCR trafficking between WT and Itch–/– splenic B cells were due to changes in the kinetics of endocytic transport rather than absolute differences in endocytic trafficking. Internalized BCR complexes normally rapidly transit through early endosomes. Indeed, after 15 min of BCR stimulation, internalized BCRs strongly colocalized with Tf+ early endosomes in WT cells (60% of cells, data not shown). However, even after 60 min of stimulation, in Itch–/– B lymphocytes, endocytosed BCRs were still retained in Tf+ early endosomes (data not shown). These data indicate that mutation of the Igbeta cytosolic lysines imposes a block in sorting between early and late endosomes.

It would be anticipated that BCR complexes arrested in early endosomes could not gain access to late endosomes. To assess this prediction directly, the BCR on splenic B cells from Itch–/– or littermate controls was ligated with FITC-conjugated anti-IgM plus IgG F(ab)2 Abs for 30 min and then cells were fixed, permeabilized, and counterstained with the anti-LAMP-1 Ab ID4B. As seen in Fig. 4C, in WT splenic B cells, most internalized BCR complexes colocalized with Lamp-1+ late endosomes (41/50 ± 2, n = 3). In contrast, in Itch–/– cells none of the internalized BCRs strongly colocalized with Lamp-1+ late endosomes while a few demonstrated weak colocalization (5/50 ± 3, n = 4). Similar results were obtained if cells were stimulated for 60 min (data not shown). From these data, we conclude that Itch is required for both normal BCR internalization and for normal sorting through early endosomes.

Igbeta ubiquitinylation is not required for receptor internalization

We next sought to determine which Itch-dependent BCR functions could be ascribed to Igbeta ubiquitinylation. There are three lysines in the cytoplasmic tail of Igbeta that could serve as ubiquitinylation sites. As ubiquitinylation is often promiscuous, a cDNA was constructed encoding an Igbeta cytosolic tail in which all three lysines were mutated to alanines. This DNA fragment was assembled with one encoding the extracellular and transmembrane domains of PDGFR{alpha} (IgbetaK{Delta}A) in the retroviral vector MIGRI (20). Following packaging, viral supernatants were used to infect A20IIA1.6 cells already expressing PDGFRbeta/Ig{alpha} (20). GFP+ infectants were isolated using FACS and expression of each chimera was confirmed by flow cytometry and immunoblotting (Fig. 5, A and B, n = 3). Immunoblotting anti-Igbeta immunoprecipitations with anti-Ub Abs demonstrated that mutation of the three cytosolic lysines ablated Igbeta ubiquitinylation (Fig. 5C). In this chimeric system, Ig{alpha}/Igbeta heterodimers are formed by adding PDGF-BB. These heterodimers can then be aggregated with anti-receptor Abs (19). Previous experiments have demonstrated that this system accurately recapitulates the signaling and trafficking properties of the endogenous BCR (19).


Figure 5
View larger version (32K):
[in this window]
[in a new window]

 
FIGURE 5. Characterization of ubiquitinylation-defective receptors. A, Expression of PDGFR{alpha} chimeric receptors containing the cytosolic tail of either WT Igbeta or IgbetaK{Delta}A on A20IIA1.6 cells coexpressing PDGFRbeta/Ig{alpha} was determined by immunoprecipitating each complex from transfected cells with anti-Ig{alpha}/Igbeta Abs and Western blotting with anti-Igbeta Abs. B, Flow cytometric analysis with anti-PDGFR{alpha} (left panel) and beta Abs (right panel) confirmed that each clone expressed similar surface levels of each chimera. For each panel, cells expressing Igbeta are shown as a filled curve and IgbetaK{Delta}A as an open curve. C, Lysates from cells expressing either WT Igbeta or IgbetaK{Delta}A (107/sample) were immunoprecipitated with anti-Ig{alpha}/Igbeta Abs and Western blotted with anti-Ub Abs. D, A20IIA1.6 cell aliquots (106/sample) expressing chimeras containing Ig{alpha} and either WT Igbeta or IgbetaK{Delta}A were stimulated with anti-IgG Abs for the indicated times (minutes) and total cell lysates were probed with 4G10 in Western blot assays.

 
We first assessed whether mutating the lysines in Igbeta altered global receptor signaling. A20IIA1.6 cells expressing either Ig{alpha}/Igbeta or Ig{alpha}/IgbetaK{Delta}A were stimulated as indicated and total cell lysates were resolved by SDS-PAGE and immunoblotted with anti-phosphotyrosine Abs (4G10). As can be seen in Fig. 5D, there was no significant difference between the two populations (n = 3).

We next determined whether Igbeta ubiquitinylation contributed to receptor internalization. Chimeric receptors were stained on the cell surface (20) with PE-conjugated Abs on ice for 15 min. Cells were then warmed to 37°C for indicated times after which surface retained Abs were stripped from the cell surface, analyzed by flow cytometry, and the fraction of internalized receptors was determined. As demonstrated in Fig. 6A, the kinetics and magnitude of Ig{alpha}/Igbeta or Ig{alpha}/IgbetaK{Delta}A internalization were nearly identical (n = 3). These results indicate that Igbeta ubiquitinylation is not required for receptor endocytosis.


Figure 6
View larger version (25K):
[in this window]
[in a new window]

 
FIGURE 6. Igbeta ubiquitinylation is dispensable for receptor endocytosis but is required for normal endocytic trafficking and Ag presentation. A, Internalization of Igbetawt ({diamondsuit}) or IgbetaK{Delta}A ({blacksquare}) containing complexes assayed as in Fig. 4A. B, Indicated receptor complexes were stimulated with Alexa 647-conjugated Abs (red) for 30 min, following loading with Alexa 594-conjugated transferrin (green) for the last 10 min of stimulation at 37°C. After fixation, samples were visualized by confocal microscopy. C, Indicated receptor complexes were stimulated with Cy5-conjugated Abs (green) for 30 min, counterstained with anti-Lamp-1 Abs (ID4B, red) and then visualized by confocal microscopy. D, Receptor complexes containing either Igbetawt (•) or IgbetaK{Delta}A ({blacksquare}) were aggregated as described in Materials and Methods and then targeted with serial dilutions of rabbit anti-rat IgG1. After incubation for 45 min at 37°C, cells were washed and then cocultured with the T cell clone 2R50 for ~36 h. ELISA was used to measure IL-2 production. Each graph shows the mean values of samples done in triplicate from a representative single experiment (n = 4).

 
Igbeta ubiquitinylation is required for sorting from early endosomes to late endosomes

We next examined whether Igbeta ubiquitinylation played a role in endocytic sorting through Tf+ early endosomes (20). Cells expressing Ig{alpha}/Igbeta or Ig{alpha}/IgbetaK{Delta}A were preloaded with Alexa 594-conjugated Tf and then stimulated with PE-conjugated anti-receptor Abs for 30 min. As demonstrated in Fig. 6B, visualization by confocal microscopy revealed that Ig{alpha}/IgbetaK{Delta}A strongly colocalized with Tf in 90% of cells (45/50 ± 2, n = 3). In contrast, Ig{alpha}/Igbeta was excluded from Tf+ early endosomes (1/50 ± 1 with any colocalization, n = 3). Similar results were obtained if cells were stimulated for 60 min (data not shown).

We next compared Ig{alpha}/Igbeta and Ig{alpha}/IgbetaK{Delta}A in their ability to colocalize with Lamp-1+ vesicles (20). For these experiments, chimeric receptors were stimulated with PE-conjugated Abs as described (20) (pseudocolor green) for 30 min at 37°C. Samples were then fixed, permeabilized, and counterstained with ID4B. Photomicrographs of a typical result are shown in Fig. 6C. Compared with Ig{alpha}/Igbeta, in which 80% cells (40/50 ± 2, n = 3) demonstrated strong colocalization with Lamp-1+ vesicles, in cells expressing Ig{alpha}/IgbetaK{Delta}A, 14% of cells demonstrated weak colocalization with Lamp-1+ vesicles (7/50 ± 3, n = 3) and no cells demonstrated strong colocalization. The pattern of colocalization observed with the Ig{alpha}/IgbetaK{Delta}A mutant is similar to that observed with receptors containing only Ig{alpha} which arrest in early endosomes (Fig. 5C, lower panel) (22).

Igbeta ubiquitinylation is required for receptor-facilitated Ag presentation to T cells

Ag is usually processed and loaded onto newly synthesized MHC class II in specialized Lamp-1+ late endosomes (28). As receptor ubiquitinylation appeared to be necessary for entry into late endosomes, we next examined whether it was also required for the processing and presentation of receptor-targeted Ags to T cells. Chimeric receptors were stimulated as above and then pulsed with serial dilutions of rabbit anti-rat IgG1 Abs at 37°C for 45 min. Cells were then washed and used as APCs in assays with the processed rabbit Ig-specific T cell clone 2R50 (21). After 36 h, IL-2 production was assayed by ELISA. As demonstrated in Fig. 6D (n = 4), mutation of the Igbeta ubiquitinylation sites completely abrogated the ability of the receptor to facilitate the processing and presentation of Ags to cognate T cells.

Membrane-bound Igµ (mIgµ) as a potential ubiquitinylation substrate

Recently, it has been reported that mIgµ is ubiquitinylated and that this may be involved in BCR trafficking (29). However, in several experiments using either anti-Ub Abs or STAM 1/2 fusion proteins, we could not detect either mIgµ or mIg{gamma} ubiquitinylation (n = 6, data not shown). As this negative result did not preclude a potential role for mIgµ ubiquitinylation in endocytic trafficking, we derived A20IIA1.6 cell lines expressing similar surface levels of either WT 3-83 mIgµ or a 3-83 mIgµ molecule in which the two cytosolic lysines (underlined) (KVK) were mutated to arginines (mIgµK{Delta}R) (Fig. 7A and data not shown). Using these transfected cell lines, we examined whether the conserved lysines in the cytosolic tail of mIgµ were involved in BCR internalization and targeting to late endosomes. As can be seen in Fig. 7B, receptor complexes containing either mIgµ or mIgµK{Delta}R were efficiently internalized from the cell surface following aggregation by PE-conjugated anti-Igµ F(ab)2 Abs (n = 3).


Figure 7
View larger version (38K):
[in this window]
[in a new window]

 
FIGURE 7. Role of Igµ cytosolic lysines in BCR trafficking and Ag presentation. A, Transmembrane and intracellular sequence of WT mIgµ and mIgµ in which cytosolic lysines have been mutated to arginines. B, Internalization assay of A20IIA1.6 3–83 WT or 3–83K{Delta}R. Cells were assayed as in Fig. 4A. C, Indicated IgM receptor complexes were stimulated with Alexa 594-conjugated Abs (red) for the indicated times, then counterstained with anti-Lamp1 Abs (ID4B, green) then visualized by confocal microscopy. D, Samples represented in C were scored for the percent of cells demonstrating strong BCR colocalization with Lamp-1+ late endosomes ({square}, 3-83 WT; {blacksquare}, 3-83K{Delta}R). E, IgM receptor containing either 3-83 WT ({blacksquare}) or 3-83K{Delta}R (•) were targeted with serial dilutions of rabbit anti-mouse IgM, mu-specific Abs then cocultured with the T cell hybridoma 2R50. IL-2 production was assayed by ELISA as described (n = 3).

 
We next examined whether the mIgµ cytosolic lysines were required for BCR endocytic sorting. Either mIgµ- or mIgµK{Delta}R-expressing cells were stimulated with Alexa 594-conjugated anti-Igµ F(ab)2 Abs for the indicated times and then fixed and counterstained with anti-Lamp-1 Abs. As demonstrated in Fig. 7C, the mIgµK{Delta}R mutant receptor could efficiently traffic to late endosomes by 30 min. However, examination of the kinetics of BCR trafficking revealed that the bulk endocytic transit of mIgµK{Delta}R was delayed with ~50% less cells demonstrating strong colocalization of mIgµK{Delta}R receptors with Lamp-1+ endosomes at 15 min (Fig. 7, C and D). At later time points, colocalization of mIgµ and mIgµK{Delta}R receptors was comparable. These data indicate that while the lysines in the mIgµ cytosolic tail are not absolutely required for BCR endocytic trafficking, they may enhance the rapidity of endocytic transit.

We next examined whether the mIgµ cytosolic lysines were required for receptor facilitated Ag presentation to T cells. Either mIgµ or mIgµK{Delta}R receptors were incubated with serial dilutions of rabbit anti-mouse mu-specific Abs. Cells were then cocultured with the T cell clone 2R50 and IL-2 production was measured by ELISA (n = 3). As can be seen in Fig. 7E, the mIgµK{Delta}R receptor was less efficient at capturing Ag for processing and presentation to T cells with an ~50% decrease in T cell stimulation at each concentration of Ag (n = 3).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
In the periphery, recognition of polyvalent Ags by the BCR initiates two processes requisite for normal humoral responses. One is the activation of signaling cascades leading to clonal expansion and differentiation. The other is the capture of ligating Ags for processing and presentation to cognate T cells (30). In this study, we demonstrate that Itch-mediated Igbeta ubiquitinylation is required for sorting of endocytosed BCR complexes to the late endosomal Ag-processing compartments. These studies reveal a fundamental mechanism governing the fate of endocytosed BCR complexes. Furthermore, they demonstrate that the molecular events determining endocytic trafficking in both yeast and mammalian cells are conserved in lymphocytes and contribute to processes central to normal immune responses.

Although Igbeta ubiquitinylation is required for endocytic sorting, it is dispensable for receptor endocytosis. In contrast, the E3 ligase responsible for Igbeta ubiquitinylation is required for both processes. A similar relationship between receptor ubiquitinylation and the responsible E3 ligase has been reported for the epidermal growth factor receptor (31, 32). However, there are also clear examples where receptor ubiquitinylation is required for internalization (33), indicating that ubiquitinylation can mediate different receptor-specific functions.

In the case of the BCR, we and others have demonstrated receptor internalization is dependent upon conserved tyrosine-based signaling motifs within the cytosolic tail of Ig{alpha}/Igbeta (34, 35). Different motifs for endocytosis and trafficking are consistent with the known biological functions of the BCR. Successful signaling induces the phosphorylation of the tyrosine-based Ig{alpha}/Igbeta internalization motifs preventing internalization (35). Selective retention of phosphorylated BCRs on the cell surface is predicted to prolong signaling responses and enhance cellular responses to low-avidity ligands.

In contrast to the inductive phosphorylation that characterizes BCR signaling and determines receptor endocytosis, resting BCRs are constitutively ubiquitinylated. This premarking for endocytic sorting is consistent with previous observations that, once internalized, monomeric and multimerized receptor complexes transverse a common endocytic route to late endosomes (36). Although receptor ligation is not required for Igbeta ubiquitinylation, BCR signaling might be required as mutation of the Igbeta cytosolic tyrosines diminishes Igbeta ubiquitinylation (34).

Although receptor complexes share a common endocytic route, it is well-known that receptors bound to polyvalent Ags target to late endosomes much more rapidly (28). Such targeting has been demonstrated to ensure the productive and preferential capture of low-affinity Ags encountered in polyvalent arrays (3). As the mechanisms of endocytic sorting are similar, we postulate that polyvalent Ags are preferentially captured because they are more rapidly internalized (37).

It has recently been reported that mIgµ is ubiquitinylated and this was correlated with the effects of proteasome inhibition on BCR trafficking and degradation (29). However, under conditions in which we readily detected Igbeta ubiquitinylation, we never detected mIgµ ubiquitinylation. The reasons for this are not clear. However, subsequent mutagenesis demonstrated that even if mIgµ is ubiquitinylated, it was not the primary determiner of BCR intracellular trafficking.

Mutating the mIgµ cytosolic lysines did diminish receptor-facilitated Ag presentation and this correlated with a modest delay in BCR trafficking to late endosomes. This could reflect undetectable changes in BCR ubiquitinylation. However, preliminary evidence indicates that the mIgµ cytosolic lysines regulate the stability of the surface BCR complex (data not shown). This would also be predicted to alter the efficiency of receptor-facilitated Ag presentation.

Both our data and recently published observations (38) indicate that Ig{alpha} is a substrate for ubiquitinylation by Cbl. However, the delayed kinetics and low level of Ig{alpha} ubiquitinylation suggest that this ubiquitinylation event does not play a role in BCR endocytic trafficking. In support of this conclusion, mutation of the potential Ig{alpha} cytosolic ubiquitinylation sites did not affect BCR endocytic trafficking (Dr. A.-M. Lennon-Dumenil, unpublished observation). Furthermore, Igbeta, but not Ig{alpha}, is required for sorting out of early endosomes and for targeting to late endosomes/lysosomes (20).

It is unclear how Itch mediates Igbeta ubiquitinylation. In EBV-infected B cells, LMP 2A interacts with Itch through proline-rich PY motifs (39, 40). However, no such motifs are present in the BCR. Furthermore, the constitutive ubiquitinylation of Igbeta makes it unlikely that molecules recruited to the activated BCR are furnishing Itch recruitment domains. Itch constitutively colocalizes with endophilin A1 and clathrin H chain (41). As internalization of the BCR is dependent upon clathrin (42), residence on these membrane-associated structures may be sufficient for Itch to ubiquitinylate the BCR.

There are several mechanisms by which Itch could contribute to endocytosis independent of receptor ubiquitinylation. Itch could function to ubiquitinylate and regulate components of the endocytic machinery (43), such as endophilin A1, which controls local membrane curvature (16, 44) and constitutively colocalizes with Itch (41). It is possible that Itch clusters endocytic adaptor proteins, as has been demonstrated for Cbl (45), and recruits receptors into clathrin-coated pits (46). In addition to the molecules that directly mediate endocytosis, genome-wide functional analyses have revealed that several interrelated signaling pathways regulate receptor endocytosis (47). Significantly, among these are the JNK/MAPK pathways, components of which regulate Itch (48, 49).

Although it is clear that Itch is required for ubiquitinylating Igbeta, our results indicate that other E3 ligases can inefficiently mediate this function. Other members of the HECT family of E3 ligases, including Nedd4, are expressed in lymphocytes (39, 40). These ligases share several conserved domains and it is therefore likely that they can ubiquitinylate similar substrates. However, the presence of these E3 ligases was not sufficient to functionally compensate for Itch as Itch–/– splenocytes manifested a severe block in endocytic sorting (Fig. 4).

The constitutive ubiquitinylation of the BCR contrasts with the inducible ubiquitinylation of the TCR. In the case of the TCR, C-Cbl is recruited to the phosphorylated TCR through an intermediate, the Src-like adaptor protein (SLAP) (50). Ubiquitinylation likely occurs in early endosomes thereby preferentially targeting internalized phosphorylated receptors for degradation. Although SLAP expression is primarily limited to thymocytes, low levels of expression in B lymphocytes may also modulate BCR-dependent responses (51). However, the expression of C-Cbl is primarily restricted to developing lymphocytes (52) (M. Zhang and M. R. Clark, unpublished observations) and therefore it is unlikely that SLAP/C-Cbl play a major role in regulating peripheral AgR expression. Another Cbl family member, Cbl-b, is expressed in peripheral B cells. However, examination of Cbl-b–/– splenocytes reveals that Cbl-b has no role in either Igbeta ubiquitinylation or in sorting of the BCR through early endosomes (M. Zhang and M. R. Clark, unpublished observations).

In summary, our findings reveal molecular mechanisms that control the endocytic fate of the Ag-engaged BCR and the presentation of ligand-derived peptides to cognate T cells. Central to these processes is the ubiquitinylation of Igbeta and the sorting of internalized BCR complexes through early endosomes. The functional specificity of Igbeta ubiquitinylation contrasts with the multiple roles played by the requisite E3 ligase Itch. Understanding the biological importance of Igbeta ubiquitinylation will provide insights into how BCR endocytic transit both determines peripheral B cell fate and contributes to B cell-mediated immune responses.


    Acknowledgments
 
We thank Lorrie Elliott (Northwestern University, Evanston, IL) and Sarah Powers (University of Chicago, Chicago, IL) for their editorial assistance and helpful discussions.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by grants from the National Institutes of Health (to M.R.C.: GM52736, GM067772; to H.B.: CA87986, CA76119, CA99900, CA99163) and the Arthritis Foundation (to M.R.C.). H.B. acknowledges support from the Jean Ruggles-Romoser Chair for Cancer Research. Back

2 Address correspondence and reprint requests to Dr. Marcus R. Clark, Section of Rheumatology, Department of Medicine, University of Chicago, 5841 South Maryland Avenue, Room N005B, Chicago, IL 60637. E-mail address: mclark{at}medicine.bsd.uchicago.edu Back

3 Abbreviations used in this paper: IMB, intraluminal multivesicular body; Ub, ubiquitin; HECT, homologous to the E6-associated protein C terminus; RING, really interesting new gene; STAM, signal-transducing adaptor molecule; WT, wild type; PDGF, platelet-derived growth factor; BS3, Bis-(sulfosuccinimidyl) suberate; OGP, n-octyl-beta-D-glucopyranoside; mIg, membrane-bound Ig; VHS, Vps27-h-STAM; UIM, Ub-interacting motif; LMP, latent membrane protein; Tf, transferrin; SLAP, Src-like adaptor protein. Back

Received for publication January 24, 2007. Accepted for publication July 26, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Watts, C.. 1997. Capture and processing of exogenous antigens for presentation on MHC molecules. Annu. Rev. Immunol. 15: 821-850. [Medline]
  2. Noorchashm, H., Y. K. Lieu, N. Noorchashm, S. Y. Rostami, S. A. Greeley, A. Schlachterman, H. K. Song, L. E. Noto, A. M. Jevnikar, C. F. Barker, A. Naji. 1999. I-Ag7-mediated antigen presentation by B lymphocytes is critical in overcoming a checkpoint in T cell tolerance to islet beta cells of nonobese diabetic mice. J. Immunol. 163: 743-750. [Abstract/Free Full Text]
  3. Aluvihare, V. R., A. A. Khamlichi, G. T. Williams, L. Adorini, M. S. Neuberger. 1997. Acceleration of intracellular targeting of antigen by the B-cell antigen receptor: importance depends on the nature of the antigen-antibody interaction. EMBO J. 16: 3553-3562. [Medline]
  4. Ferrari, G., A. M. Knight, C. Watts, J. Pieters. 1997. Distinct intracellular compartments involved in invariant chain degradation and antigenic peptide loading of major histocompatibility complex (MHC) class II molecules. J. Cell. Biol. 139: 1433-1446. [Abstract/Free Full Text]
  5. Riberdy, J. M., R. R. Avva, H. J. Geuze, P. Cresswell. 1994. Transport and intracellular distribution of MHC class II molecules associated with invariant chain in normal and antigen processing mutant cell lines. J. Cell. Biol. 125: 1215-1237.
  6. Kropshofer, H., S. Spindeldreher, T. A. Rohn, N. Platania, C. Grygar, N. Daniel, A. Wolpl, H. Langen, V. Horejsi, A. B. Vogt. 2001. Tetraspan microdomains distinct from lipid rafts enrich select peptide-MHC class II complexes. Nat. Immunol. 3: 61-68. [Medline]
  7. Stoorvogel, W., M. J. Kleijmeer, H. J. Geuze, G. Raposo. 2002. The biogenesis and functions of exosomes. Traffic 3: 321-330. [Medline]
  8. Slagsvold, T., K. Pattni, L. Malerod, H. Stgenmark. 2006. Endosomal and non-endosomal functions of ESCRT proteins. Trends Cell. Biol. 16: 317-326. [Medline]
  9. Bilodeau, P. S., J. L. Urbanowski, S. C. Winistorfer, R. C. Piper. 2002. The Vps27p-Hse1p complex binds ubiquitin and mediates endosomal sorting. Nat. Cell. Biol. 4: 534-539. [Medline]
  10. Longva, K. E., F. D. Blystad, E. Stang, A. M. Larsen, L. E. Johannessen, I. H. Madshus. 2002. Ubiquitination and proteasomal activity is required for transport of the EGF receptor to inner membranes of multivesicular bodies. J. Cell. Biol. 156: 843-854. [Abstract/Free Full Text]
  11. Katzmann, D. J., G. Odorizzi, S. D. Emr. 2002. Receptor downregulation and multivesicular-body sorting. Nat. Rev. Mol. Cell. Biol. 3: 893-905. [Medline]
  12. Lu, Q., L. W. Hope, M. Brasch, C. Reinhard, S. N. Cohen. 2003. TSG101 interaction with HRS mediates endosomal trafficking and receptor down-regulation. Proc. Natl. Acad. Sci. USA 100: 7626-7631. [Abstract/Free Full Text]
  13. Amerik, A. Y., J. Nowak, S. Swaminathan, M. Hochstrasser. 2000. The Doa4 deubiquitinating enzyme is functionally linked to the vacuolar protein-sorting and endocytic pathways. Mol. Biol. Cell. 11: 3365-3380. [Abstract/Free Full Text]
  14. Bishop, N., A. Horman, P. Woodman. 2002. Mammalian class E vps proteins recognize ubiquitin and act in the removal of endosomal protein-ubiquitin conjugates. J. Cell. Biol. 157: 91-101. [Abstract/Free Full Text]
  15. Petrelli, A., G. F. Gilestro, S. Lanzardo, P. M. Comoglio, N. Migone, S. Giordano. 2002. The endophilin-CIN85-Cbl complex mediates ligand-dependent downregulation of c-Met. Nature 416: 187-190. [Medline]
  16. Soubeyran, P., K. Kowanetz, I. Szymkiewicz, W. Y. Langdon, I. Dikic. 2002. Cbl-CIN85-endophilin complex mediates ligand-induced downregulation of EGF receptors. Nature 416: 183-187. [Medline]
  17. Mueller, D. L.. 2004. E3 ubiquitin ligases as T cell anergy factors. Nat. Immunol. 5: 883-890. [Medline]
  18. Weissman, A. M.. 2001. Themes and variations on ubiquitylation. Nat. Rev. Mol. Cell. Biol. 2: 169-178. [Medline]
  19. Luisiri, P., Y. J. Lee, B. J. Eisfelder, M. R. Clark. 1996. Cooperativity and segregation of function within the Ig{alpha}/beta heterodimer of the B cell antigen receptor complex. J. Biol. Chem. 271: 5158-5163. [Abstract/Free Full Text]
  20. Siemasko, K., B. J. Eisfelder, C. Stebbins, S. Kabak, A. J. Sant, W. Song, M. R. Clark. 1999. Ig-{alpha} and Ig-beta are required for efficient trafficking to late endosomes and to enhance antigen presentation. J. Immunol. 162: 6518-6525. [Abstract/Free Full Text]
  21. Mitchell, R. N., K. A. Barnes, S. A. Grupp, M. Sanchez, Z. Misulovin, M. C. Nussenzweig, A. K. Abbas. 1995. Intracellular targeting of antigens internalized by membrane immunoglobulin in B lymphocytes. J. Exp. Med. 181: 1705-1714. [Abstract/Free Full Text]
  22. Campbell, K. S., E. J. Hager, R. J. Friedrich, J. C. Cambier. 1991. IgM antigen receptor complex contains phosphoprotein products of B29 and mb-1 genes. Proc. Natl. Acad. Sci. USA 88: 3982-3986. [Abstract/Free Full Text]
  23. Bilodeau, P. S., S. C. Winistorfer, W. R. Kearney, D. Robertson, R. C. Piper. 2003. Vps27-Hse1 and ESCRT-I complexes cooperate to increase efficiency of sorting ubiquitinated proteins at the endosome. J. Cell. Biol. 163: 237-243. [Abstract/Free Full Text]
  24. Kobayashi, H., N. Tanaka, H. Asao, S. Miura, M. Kyuuma, K. Semura, N. Ishii, K. Sugamura. 2005. Hrs, a mammalian master molecule in vesicular transport and protein sorting, suppresses the degradation of ESCRT proteins signal transducing adaptor molecule 1 and 2. J. Biol. Chem. 280: 10468-10477. [Abstract/Free Full Text]
  25. Kim, K. J., C. Kanellopoulos-Langevin, R. M. Merwin, D. H. Sachs, R. Asofsky. 1979. Establishment and characterization of BABL/c lymphoma lines with B cell properties. J. Immunol. 122: 549-554. [Abstract/Free Full Text]
  26. Ikeda, A., R. G. Caldwell, R. Longnecker, M. Ikeda. 2003. Itchy, a Nedd4 ubiquitin ligase, downregulates latent membrane protein 2A activity in B-cell signaling. J. Virol. 77: 5529-5534. [Abstract/Free Full Text]
  27. Chambers, J. D., S. I. Simon, E. M. Berger, L. A. Sklar, K. E. Arfors. 1993. Endocytosis of beta2 integrins by stimulated human neutrophils analyzed by flow cytometry. J. Leukocyte Biol. 53: 462-469. [Abstract]
  28. Clark, M. R., D. Massenburg, K. Siemasko, P. Hou, M. Zhang. 2004. B-cell antigen receptor signaling requirements for targeting antigen to the MHC class II presentation pathway. Curr. Opin. Immunol. 16: 382-387. [Medline]
  29. Drake, L., E. M. McGovern-Brindisi, J. R. Drake. 2006. BCR ubiquitination controls BCR-mediated antigen processing and presentation. Blood 108: 4086-4093. [Abstract/Free Full Text]
  30. Kelsoe, G.. 1996. Life and death in germinal center (redux). Immunity 4: 107-111. [Medline]
  31. Huang, F., D. Kirkpatrick, X. Jiang, S. P. Gygi, A. Sorkin. 2006. Differential regulation of EGF receptor internalization and degradation by multiubiquitinylation with the kinase domain. Mol. Cell 17: 737-748.
  32. Duan, L., Y. Miura, M. Dimri, B. Majumder, I. L. Dodge, R. A. Lakku, A. K. Ghosh, N. Fernandes, P. Shou, K. Mullane-Robinson, et al 2003. Cbl-mediated ubiquitinylation is required for lysosomal sorting of EGF receptor but is dispensable for endocytosis. J. Biol. Chem. 278: 28950-28960. [Abstract/Free Full Text]
  33. Belouzard, S., Y. Rouille. 2006. Ubiquitylation of leptin receptor OB-Ra regulates its clathrin mediated endocytosis. EMBO J. 25: 932-942. [Medline]
  34. Gazumyan, A., A. Reichlin, M. C. Nussenzweig. 2006. Igbeta tyrosine residues contribute to the control of B cell receptor signaling by regulating receptor internalization. J. Exp. Med. 203: 1785-1794. [Abstract/Free Full Text]
  35. Hou, P., E. Araujo, T. Zhao, D. Massenburg, M. Veselits, C. Doyle, A. R. Dinner, M. R. Clark. 2006. B cell antigen receptor signaling and internalization are mutually exclusive events. PLoS Biol. 4: 1147-1158.
  36. Song, W., H. Cho, P. Cheng, S. K. Pierce. 1995. Entry of B cell antigen receptor and antigen into class II peptide-loading compartment is independent of receptor cross-linking. J. Immunol. 155: 4255-4263. [Abstract]
  37. Patel, K. J., M. S. Neuberger. 1993. Antigen presentation by the B cell antigen receptor is driven by the {alpha}/beta sheath and occurs independently of its cytoplasmic tyrosines. Cell 74: 939-946. [Medline]
  38. Kitaura, Y., I. K. Jang, Y. Wang, Y.-C. Han, T. Inazu, E. J. Cadera, M. Schlissel, R. R. Hardy, H. Gu. 2007. Control of B cell-intrinsic tolerance programs by ubiquitin ligases Cbl and Cbl-b. Immunity 26: 567-578. [Medline]
  39. Ikeda, M., A. Ikeda, L. C. Longan, R. Longnecker. 2000. The Epstein-Barr virus latent membrane protein 2A PY motif recruits WW domain-containing ubiquitin-protein ligases. Virology 268: 178-191. [Medline]
  40. Winberg, G., L. Matskova, F. Chen, P. Plant, D. Rotin, G. Gish, R. Ingham, I. Ernberg, T. Pawson. 2000. Latent membrane protein 2A of Epstein-Barr virus binds WW domain E3 protein-ubiquitin ligases that ubiquitinate B-cell tyrosine kinases. Mol. Cell. Biol. 20: 8526-8535. [Abstract/Free Full Text]
  41. Angers, A., A. R. Ramjaun, P. S. McPherson. 2004. The HECT domain ligase Itch ubiquitinates endophilin and localizes to the trans-Golgi network and endosomal system. J. Biol. Chem. 279: 11471-11479. [Abstract/Free Full Text]
  42. Stoddart, A., A. P. Jackson, F. M. Brodsky. 2005. Plasticity of B cell receptor internalization upon conditional depletion of clathrin. Mol. Biol. Cell. 16: 2339-2348. [Abstract/Free Full Text]
  43. Szymkiewicz, I., K. Kowanetz, P. Soubeyran, A. Dinarina, S. Lipkowitz, I. Dikic. 2002. CIN85 participates in Cbl-b-mediated down-regulation of receptor tyrosine kinases. J. Biol. Chem. 277: 39666-39672. [Abstract/Free Full Text]
  44. Brodin, L., P. Low, O. Shupliakov. 2000. Sequential steps in clathrin-mediated synaptic vesicle endocytosis. Curr. Opin. Neurobiol. 10: 312-320. [Medline]
  45. Jozic, D., N. Cardenes, Y. L. Deribe, G. Moncalian, D. Hoeller, Y. Groemping, I. Dikic, K. Rittinger, J. Bravo. 2005. Cbl promotes clustering of endocytic adaptor proteins. Nat. Struct. Mol. Biol. 12: 972-979. [Medline]
  46. Kowanetz, K., I. Szymkiewicz, K. Haglund, M. Kowanetz, K. Husnjak, J. D. Taylor, P. Soubeyran, U. Engstrom, J. E. Ladbury, I. Dikic. 2003. Identification of a novel proline-arginine motif involved in CIN85-dependent clustering of Cbl and down-regulation of epidermal growth factor receptors. J. Biol. Chem. 278: 39735-39746. [Abstract/Free Full Text]
  47. Pelkmans, L., E. Fava, H. Grabner, M. Hannus, B. Habermann, E. Krausz, M. Zerial. 2005. Genome-wide analysis of human kinases in clathrin- and caveolae/raft-mediated endocytosis. Nature 436: 78-86. [Medline]
  48. Gao, M., T. Labuda, Y. Xia, E. Gallagher, D. Fang, Y. C. Liu, M. Karin. 2004. Jun turnover is controlled through JNK-dependent phosphorylation of the E3 ligase Itch. Science 306: 271-275. [Abstract/Free Full Text]
  49. Chang, L., H. Kamata, G. Solinas, J. L. Luo, S. Maeda, K. Venuprasad, Y. C. Liu, M. Karin. 2006. The E3 ubiquitin ligase itch couples JNK activation to TNF{alpha}-induced cell death by inducing c-FLIPL turnover. Cell 124: 601-613. [Medline]
  50. Myers, M. D., T. Sosinowski, L. L. Dragone, C. White, H. Band, H. Gu, A. Weiss. 2006. Src-like adaptor protein regulates TCR expression on thymocytes by linking the ubiquitin ligase c-Cbl to the TCR complex. Nat. Immunol. 7: 57-66. [Medline]
  51. Dragone, L. L., M. D. Myers, C. White, T. Sosinowski, A. Weiss. 2006. Src-like adaptor protein regulates B cell development and function. J. Immunol. 176: 335-345. [Abstract/Free Full Text]
  52. Naramura, M., I.-K. Jang, H. Kole, F. Huang, D. Haines, H. Gu. 2002. c-Cbl and Cbl-b regulate T cell responsiveness by promoting ligand-induced TCR down-modulation. Nat. Immunol. 3: 1192-1199. [Medline]



This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
S. K. O'Neill, M. L. Veselits, M. Zhang, C. Labno, Y. Cao, A. Finnegan, M. Uccellini, M.-L. Alegre, J. C. Cambier, and M. R. Clark
Endocytic sequestration of the B cell antigen receptor and toll-like receptor 9 in anergic cells
PNAS, April 14, 2009; 106(15): 6262 - 6267.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, M.
Right arrow Articles by Clark, M. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, M.
Right arrow Articles by Clark, M. R.
Right arrowPubmed/NCBI databases
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS