|
|
||||||||




* Lautenberg Center for General and Tumor Immunology, Hadassah Medical School, Hebrew University, Jerusalem, Israel;
Division of Cell and Molecular Biology, Imperial College, London, United Kingdom;
Ella Institute for Melanoma Research, Sheba Cancer Research Center, Sheba Medical Center, Tel Hashomer, Israel;
Department of Pediatrics, Hadassah University Hospital, Jerusalem, Israel;
¶ Gastroenterology Division, Brigham and Womens Hospital, Harvard Medical School, Boston, MA 02115; and
|| Department of Medical Microbiology, Vrije Universiteit Medical Center, Amsterdam, The Netherlands
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The CEA protein is overexpressed on a wide range of carcinomas and is commonly used as a tumor marker in the prognosis and management of many types of cancer (9, 10). It consists of an Ig V-like N-terminal domain followed by three pairs of Ig C2-like domains (11, 12). The CEA protein is heavily glycosylated and this glycosylation plays a critical role in its function (13). For example, it was demonstrated that immature dendritic cells interact with CEA through dendritic cell-specific ICAM-3-grabbing nonintegrin (DC-SIGN) (14). This recognition was based on the specificity of DC-SIGN for Lewisx (LeX) and Lewisy moieties on tumor-associated CEA (15).
In recent years, it became evident that an organized structure named the immunological synapse is formed between the effector cells and their targets (16). An interesting consequence of the formation of the immunological synapse in T, B, and NK cells is the observation that an effector cell acquires target cell membrane molecules and incorporates them in its own membrane, a process known as trogocytosis (17, 18, 19). NK cells have been shown, for example, to acquire MHC class I molecules from a variety of cells in vitro and in vivo (20, 21, 22).
Despite the extensive expression of CEA in many tumors, very little is known about its interaction with immune cells. In this study, we further characterize the interaction between NK cells and the CEA protein. We show that NK cells rapidly acquired CEA molecules from target cells and we demonstrate that this phenomenon is not mediated by the CEACAM1 receptor but instead requires a specific interaction with an unknown putative NK cell receptor.
Furthermore, we evaluated the role of cytotoxicity in the acquisition of CEA and demonstrated it to be mostly killing independent. Transfer of CEA to the surface of NK cells was evident either with freshly isolated NK cells or with NK clones derived from perforin-deficient patients; in both, the cytotoxic activity is drastically reduced. In addition, CEA transfer was also observed to freshly isolated T cells.
We demonstrate that the transfer is receptor specific and that carbohydrates are probably involved in the CEA acquisition by NK cells. Functionally, the killing of bulk NK cultures was inhibited by CEA-expressing cells, suggesting that the putative receptor that recognizes CEA is probably an inhibitory receptor.
| Materials and Methods |
|---|
|
|
|---|
The cell lines used were: the 1106mel melanoma cell line, the MHC class I-negative 721.221 (221). The generation of 221 cells stably expressing CEACAM1 (221/CEACAM1), CEA (221/CEA), and CEACAM6 (221/CEACAM6) was described previously (23). For generating 221/CEA/Cw6 and 221/major histocompatibility complex class I (MICA)-yellow fluorescent protein (YFP)/CEA cells, we used 221/Cw6 and 221/MICA-YFP cells that were described previously (24, 25) and cotransfected them with CEACAM5 cDNA subcloned into pcDNA3.1-containing hygromycin selection.
For the generation of 721.221 cells expressing the CEA protein fused to GFP, we used a GFP-GPI construct in pcDNA3.1 that was previously described (26). We amplified the extracellular portion of the CEA without the GPI-anchoring sequence using the 5' primer GGTACCGCCACCATGGAGTCTCCCTCGGCCC (including the KpnI restriction site) and the 3' primer CCGGAATTCAGATGCAGAGACTGTGATGCT (including the EcoRI restriction site). The amplified fragment was cloned into the GFP-GPI construct digested with KpnI and EcoRI. All transfectants were periodically monitored for expression by staining with the appropriate mAb.
Primary NK cells were isolated from PBL, using the human NK isolation kit II and the autoMACS instrument according to the manufacturers instructions (Miltenyi Biotec). NK cells were grown in culture as previously described (24).
Abs and fusion proteins
The Abs used in this work were mAb Kat4c (DakoCytomation), directed against CEACAM1,5,6,8, mAb 5F4 directed against CEACAM1 (27), mAb MCA1744 directed against CEA (Serotec). mAb 6H3 anti-LeX and mAb 4D2 anti-H type I (used as an IgM control) have been previously described (28); these mAbs are both of the IgM isotype. 12E7 an anti-CD99 mAb was used as an IgG control.
For the transfer studies, the following fluorochrome-conjugated mAbs were used: the PE-conjugated anti-human CD56 mAb (BD Pharmingen), the PE-conjugated anti-human CD8 mAb (DakoCytomation), a biotinylated anti-CD4 (OKT4; American Type Culture Collection) followed by streptavidin-Cy5 (Jackson ImmunoResearch Laboratories) as a second reagent, the FITC-conjugated anti-CEACAM (Kat4C; DakoCytomation).
For degranulation assay, FITC-conjugated anti-human CD56 mAb (Sigma-Aldrich) was used together with biotinylated anti-CD107 mAb (BD Pharmingen), followed by streptavidin-PE (Jackson ImmunoResearch Laboratories) as a second reagent.
The generation and production of CEA-Ig and CD99-Ig was previously described (8, 29). Briefly, the extracellular portion of the CEA and CD99 protein were amplified by PCR and the fragments were cloned into a mammalian expression vector containing the Fc portion of human IgG1. COS-7 cells were transiently transfected with these plasmids using FuGENE6 reagent (Roche) according to the manufacturers instructions, and supernatants were collected and purified on a protein G column. To assay for the CEA-Ig binding, NK cells were incubated with 50 µg/ml fusion protein for 2 h on ice. The cells were washed and incubated with Fc fragment-specific (minimal cross-reaction to bovine, horse, and mouse serum proteins), PE-conjugated affinity-purified F(ab')2 of goat anti-human IgG (Jackson ImmunoResearch Laboratories). Incubation was performed for 1 h and analyzed by flow cytometry.
Transfer experiments
In all transfer experiments 100,000 target cells were coincubated with 100,000 NK cells in 96U plate. Cells were coincubated for 2 h (unless indicated differently in the figure legend) at 37°C/5% CO2 in 0.2 ml of complete RPMI 1640. Cells were then washed in 5% BSA/0.02% azide/PBS and incubated for 30 min on ice with 10% human serum (Sigma-Aldrich) to block nonspecific binding. Cells were then incubated with the various Abs for 1 h at 4°C, washed twice with 5% BSA/0.02% azide/PBS, and analyzed by flow cytometry.
Fucosidase and sodium periodate treatments
Cells were incubated with 10 mU/ml fucosidase (Calbiochem) in 50 mM sodium phosphate at 37°C for 30 min. Cells were then washed and the efficiency of the treatment was verified by FACS analysis. Cells were incubated with 30 mM sodium periodate (NaIO4) at 37°C for 10 min. The cells were then washed five times with complete RPMI 1640 medium supplemented with 10% FCS, nonessential amino acids, L-glutamine, and sodium pyruvate. The cells were then used for transfer experiment.
Cytotoxicity assays
The cytotoxic activity of NK cells against the various targets was assessed in 5-h 35S-labeled release assays as previously described (24). In all presented cytotoxicity assays, the spontaneous release was <25% of maximal release.
Confocal microscopy
The 221/CEA cells and bulk culture NK cells (5 x 105 of each) were coincubated, to form conjugates, for 10 min at 37°C/5% CO2 in 0.5 ml of complete RPMI 1640, after which the medium was removed and the cells were fixed in Cytofix/Cytoperm (BD Pharmingen) for 15 min at 4°C. The fixed cells were then washed twice in 0.1% Tween 20/PBS and incubated in a blocking solution comprising 5% horse serum (Sigma-Aldrich) and 3% BSA in perm/wash buffer (BD Pharmingen) for 1 h at 4°C. Cells then were incubated with anti-CEA mAb diluted in blocking solution for 45 min at 4°C following incubation with IgG anti-Alexa Fluor 488 for 1 h at 4°C. Stained cells were then washed three times in 0.1% Tween 20/PBS and 7 µl of the pellet was placed between a microscope slide and a 24 x 24-mm coverslip. Cell conjugates were imaged under a x63 oil immersion objective using a confocal laser scanning microscope (TCS SP2; Leica). Conjugates were scanned in the xy direction every 0.3 µm throughout the z plane.
| Results |
|---|
|
|
|---|
We have previously demonstrated that a small percentage of NK cells derived from melanoma patients that are in direct contact with CEACAM1-positive melanoma tumors express CEACAM1, whereas no CEACAM1 expression is observed among NK cells derived from patients in which their melanoma tumors did not express the CEACAM1 protein (5). To test whether the expression of CEACAM1 on target cells might directly influence its expression on NK cells, we generated a series of transfectants that expresses high levels of different CEACAM molecules. 721.221 (221) cells were transfected with CEACAM1, CEA (CEACAM5), and CEACAM6 cDNA, thus generating 221/CEACAM1, 221/CEA, and 221/CEACAM6 cells, respectively. In addition, because our previous observations were obtained with melanoma tumors (5), we also used the melanoma cell line 1106mel, which endogenously expresses high levels of CEACAM1. The expression level of CEACAM in these cells was monitored with the Kat4c mAb that recognizes all CEACAM family proteins (Fig. 1A).
|
As can be seen in Fig. 1B, weak or no staining of CEACAM expression was observed on NK cells that were incubated with no cells or with the parental 221 cells. Surprisingly, an elevation in the percentages of NK cells expressing CEACAM proteins was observed when NK cells were coincubated with the various CEACAM-expressing cells. The most significant elevation was observed on NK cells coincubated with the 221/CEA cells (34.5%, Fig. 1B). Interestingly, the increase in CEACAM expression was observed on both CD56dim and CD56bright populations demonstrating that the elevation is not dependent on a specific NK cell subpopulation.
To further test whether the observed elevation of CEACAM expression on NK cells requires direct contact between the NK and target cells, we repeated the same experiment; wherein this time the NK cells were separated from the target cell by transwell chamber (5-µm pore). No elevation in CEACAM on NK cells surface was observed when cells were separated by a transwell membrane. In contrast, a high level of CEACAM was detected when cells were incubated together in the same well (Fig. 1C compare
to
). This demonstrates that the elevation in CEACAM is not due to the presence of soluble factors but requires direct contact between the cells.
Intercellular transfer of CEA to NK cells
To further characterize the mechanism accountable for the increase in CEACAM expression, we tested the kinetics of this process. Intercellular transfer of proteins is a rapid process such that transferred molecules can be observed on the NK cell surface after 10 min (20). In agreement with these observations, when NK cells were coincubated with 221/CEACAM1, 221/CEA, or 221/CEACAM6 cells, the various proteins could be detected on the NK cells surface, as soon as 10 min after coincubation (Fig. 2A). The percentage of NK cells that were positive for CEACAM steadily increased and reached saturation within 1 h of incubation (Fig. 2A). As described above, the most efficient elevation was observed with the CEA protein.
|
To examine this hypothesis, we used a set of mAbs that recognize specifically various CEACAM molecules. The specificity of these Abs was confirmed by staining the 221, 221/CEA, and 1106mel cells. The MCA1744 detected only the 221/CEA cells; the 5F4 mAb detected only the 1106mel, while the Kat4C mAb detected both the 1106mel and the 221/CEA cells (Fig. 2B).
To directly demonstrate that NK cells acquire CEACAM proteins from target cells, we incubated bulk NK cultures with 221, 221/CEA, or 1106mel cells for 2 h and stained with anti-CD56 and with the various conjugated anti-CEACAM mAb (Kat4C, 5F4, MCA1744). We used the 1106mel cells in this assay and not the 221/CEACAM1 cells because CEACAM1 expression on 1106mel cell is the strongest and consequently higher percentages of CEACAM1 can be detected on NK cells after coincubation with 1106mel (Fig. 1).
In agreement with our hypothesis, NK cells coincubated with 221/CEA were stained with MCA1744 mAb but not with 5F4 mAb, demonstrating that NK express the CEA protein on their surface (Fig. 2C). In contrast, NK cells coincubated with 1106mel cells were stained with 5F4 mAb but not with MCA1744 mAb, demonstrating that NK express the CEACAM1 protein on their surface (Fig. 2C).
These results and the fact that CEA is not expressed on hemopoietic cells (10) led to the conclusion that the CEACAM increase on NK cells result from intercellular protein transfer.
To further verify that, indeed, the CEA appearance on NK cells resulted from intercellular transfer of CEA from target cells, we generated 221 transfectants that express CEA fused to GFP (221/CEA-GFP) (Fig. 2D). When these cells were coincubated with NK cells, a significant amount of CEA-GFP was detected on NK cells (Fig. 2E), indicating that NK cells acquire the CEA molecules from the 221/CEA target cells.
Because little transfer of other CEACAM proteins were observed, we concentrated our efforts on the CEA protein. To directly visualize the transfer of CEA to NK cells, we used confocal microscopy. The 221/CEA target cells were coincubated for 10 min with bulk NK cells culture. Cells were then fixed and stained with anti-CEA mAb and conjugates were imaged by laser scan confocal microscopy. In 20 of the 50 conjugates that were analyzed, patches of CEA were observed on the NK cell surface. In Fig. 3A, three peripheral blood NK cells interacting with 221/CEA cells, and patches of CEA protein that has been transferred to NK cells surface, can clearly be observed.
|
Intercellular transfer of either MHC class I proteins (20, 21, 22) or NKG2D ligands, MICA and MICB to NK cells was previously described (32).
To test whether the CEA transfer rate would be similar to that of major histocompatibility complex class I-related chain A (MICA), we generated transfectants of 221 cells expressing YFP-tagged MICA together with CEA (221/MICA-YFP/CEA). As can be seen in Fig. 3C, both proteins transferred to the NK cell surface concurrently, suggesting that in each intercellular contact between target cells and NK cells, both CEA and MICA transfer to the NK cell surface and that the transfer of CEA and MICA occur at similar rates.
The acquisition of CEA is not dependent on NK killing
The efficiency of CEA transfer to NK cells varied between different experiments and, frequently, when NK cells were grown for a long period of time in culture, the CEA transfer was less efficient. We therefore tested whether the efficiency of CEA transfer depended on the NK activation state. Bulk-cultured NK cells were stimulated with IL-2 and the transfer of CEA to NK cells was then tested at different time points after the IL-2 stimulation. CEA transfer was maximal when NK cells were highly activated (3 days after IL-2 stimulation, Fig. 4A). From day 3 after IL-2 stimulation, the transfer efficiency gradually decreased reaching the lowest levels (15.9%) 10 days after IL-2 stimulation (Fig. 4A).
|
In addition, we tested the transfer of the CEA protein to freshly isolated PBL. PBL were isolated from healthy donors, incubated either with 221 or 221/CEA for 1 h at an E:T ratio of 1:1 and stained for CD4 or CD8 together with CEA. Efficient transfer of CEA to the CD8+ and to CD4+ T cell surface was observed (Fig. 4C). Because both CD4+ T and CD8+ T cells do not kill the 221 or the 221/CEA cells (data not shown), these results demonstrate that the CEA transfer to T cells is killing independent and therefore further imply that intercellular transfer of CEA to NK cells might also be mostly independent of killing.
To further establish that most of the CEA transfer to NK cells is not associated with the killing, we used NK clones isolated from a perforin-deficient patient. These clones still manifest the full interactions between receptors and their appropriate ligands and the signaling machinery is intact, with only one missing element: the final killing. We tested the cytotoxicity activity of these perforin-deficient clones in a killing assay against 221/CEA cells at an E:T ratio of 2:1. As expected, killing of the 221/CEA by the perforin-deficient NK clones did not exceeded 10% (Fig. 4D), while the control NK clones derived from healthy donors efficiently killed these cells (>30%, data not shown). The residual NK killing observed in the perforin-deficient clones could be attributed to other killing mechanisms such as Fas/Fas-ligand interactions (33). The same perforin-deficient NK clones were then incubated with either 221 or 221/CEA at an E:T ratio of 1:1. A significant transfer of the CEA protein to the perforin-deficient NK clones was observed (Fig. 4D). The CEA transfer varied among the different clones but there was no correlation between the observed minimal killing and the CEA transfer. Thus, it can be concluded that CEA transfer to NK cells is largely killing independent.
The transfer of CEA to the perforin-deficient NK clones was somewhat lower than the CEA transfer to "normal" NK clones tested in the same assay (data not shown). To further investigate whether NK killing might be minimally involved in the transfer, we tested whether inhibition of the killing through MHC class I molecules affects the observed CEA transfer. For this, we generated double transfectants expressing HLA-Cw6 molecules together with the CEA protein (221/Cw6/CEA) (Fig. 5A). NK clones expressing the KIR2DL1 receptor were tested for their cytolytic activity against the 221/CEA and 221/Cw6/CEA transfectants incubated with or without anti-HLA mAb. As expected, lysis of 221/Cw6/CEA is reduced compared with lysis of 221/CEA cells due to an inhibitory interaction of the KIR2DL1 receptor with the HLA-Cw6 molecule. Indeed, preincubation of the target cells with an anti-HLA mAb restored NK killing (Fig. 5B). Next, to asses the impact of the protective KIR2DL1/HLA-Cw6 interaction on the intercellular CEA transfer, we compared transfer from either 221/CEA or 221/Cw6/CEA to the KIR2DL1-positive NK clone after coincubation with or without anti-HLA mAb. Although the CEA levels of 221/Cw6/CEA were similar to that of 221/CEA (Fig. 5A), the percentage of NK cells that acquired CEA molecules was slightly reduced when coincubated with 221/Cw6/CEA cells, compared with 221/CEA (Fig. 5C). Adding anti-HLA mAb restored some of the CEA transfer. This moderate restoration in CEA transfer repeated in three independent experiments and was statistically significant (p < 0.01 by paired t test), demonstrating that a limited fraction of the CEA transfer is affected by HLA-Cw6 KIR2DL1 interactions. It is therefore possible that some of the observed CEA intercellular transfer is killing dependent or that the inhibitory interaction between HLA-Cw6 and KIR2DL1 interrupt the CEA transfer by a different mechanism such as different immunological synapse structure or direct effects of the inhibitory signaling on the transfer process.
|
Intercellular transfer is dramatically augmented upon receptor recognition (34). We assumed that observed CEA transfer was also specific because the transfer of other CEACAM proteins was significantly lower then the CEA transfer (Figs. 1 and 2). We have previously demonstrated that CEA on target cells interacts with CEACAM1 on the surface of NK cells (8), however, CEACAM1 is expressed exclusively on activated CD16-negative NK cells (Ref. 27 and Fig. 1A), whereas the observed CEA transfer was not limited to a certain subpopulation (Fig. 1A). In addition, the transfer was observed with fresh NK cells that do not express CEACAM1 (Fig. 4B). Finally, CEACEAM1 was never expressed on >2.5% of the population of activated bulk NK cultures used in this manuscript (data not shown). Thus, we concluded that receptors other than CEACAM1 are involved in the CEA intercellular transfer.
The CEA protein consists of an Ig V-like N-terminal domain (crucial for its function; Refs. 8 and 35), followed by six Ig-C2 like domains (11). We have previously generated mutated constructs of CEA that lacks the N domain (CEA
N) and a CEA protein that lacks the N domain and the first two Ig C2-like domains (CEA D4-D7) (8). To test whether a specific recognition of CEA through its N-domain is involved in the observed intercellular transfer of CEA, 221 cells that express the truncated CEA proteins (Fig. 6A) were tested in transfer assays. Although the expression levels of the truncated CEA proteins and the full protein were similar (compare Figs. 1A to 6A), the percentage of NK cells that acquired the CEA molecules was significantly reduced when 221/CEA
N or CEA D4-D7 cells were used (Fig. 6B). These results indicate that the N-domain of CEA is important for the recognition and transfer to the putative unknown receptor.
|
The carbohydrate structures on CEA are probably essential for the transfer
It was demonstrated that the CEA protein is recognized by DC-SIGN (14) via the unique LeX glycans expressed on the CEA protein. Because we could not block the CEA transfer with any of the anti-CEA Abs we tested, such as rabbit polyclonal anti-CEA (DakoCytomation), anti-CEA MCA1744 (Serotec), Kat4C (DakoCytomation), CBL578 (Chemicon International) (data not shown), we hypothesized that the recognition of the CEA protein by NK cells might also be mediated by carbohydrates. We therefore examined whether CEA expressed on 221 cells indeed express the special LeX glycans. 221 and 221/CEA cells were stained with anti-LeX 6H3 mAb and although other proteins on 221 express LeX, a considerable staining of LeX glycans was observed on the 221/CEA cells (Fig. 7A) demonstrating that the CEA protein on these cells was likely to harbor the LeX glycans.
|
To test whether the fucose group of the LeX glycan on CEA was directly involved in the observed transfer, we incubated the 221/CEA cells for 1 h with
1–3,4-fucosidase, an enzyme that specifically removes the fucose moiety from LeX. This treatment was very effective and the binding of the anti-LeX mAb was completely abolished (Fig. 7C). The enzyme treatment did not disrupt the integrity of CEA on the 221 cells as the Kat4C mAb still efficiently stained the treated and untreated cells equally well (Fig. 7C) and in addition, the binding of CEA-Ig and CEACAM1-Ig to the 221/CEA was not impaired (data not shown). Next, we tested whether the removal of the fucose group from the CEA affected the observed transfer. NK cells were incubated with 221/CEA cells treated or not with
1–3,4-fucosidase. Surprisingly, the fucosidase treatment did not affect the amount of CEA transferred (Fig. 7D), indicating that the fucose group on the CEA is not important for the CEA recognition and acquisition by NK cells. Thus, we concluded that the partial blockade of the transfer by the anti-LeX mAb was probably due to a steric hindrance exerted by the IgM anti-LeX Ab and that glycans other than fucose moiety on the LeX (which are present on CEA; Refs. 13 , 36 , 37) are probably involved in the CEA transfer. Unfortunately, we could not specifically test the effect of the other carbohydrate structures of CEA on its transfer as Abs against these other glycan are not commercially available. We therefore used 30 mM sodium periodate, which destroys carbohydrate structures. This treatment did not disrupt the integrity of CEA on the 221 cells as the Kat4C mAb still efficiently stained the treated cells (data not shown). This removal of carbohydrate completely diminished CEA transfer to NK cells (Fig. 7E), demonstrating that the carbohydrate moieties are important for the observed transfer.
Modulation of NK cells killing by CEA
We have previously demonstrated that the CEA protein on target cells inhibits NK cytotoxicity via interaction with the CEACAM1 protein on the NK cells (8). In healthy subjects, CEACAM1 is expressed only on the cell surface of the activated, CD16-negative NK cell subset (5, 27), which is present in low amounts in the peripheral blood but can be found at high percentages in secondary lymphoid tissues (38). Because, the CEA transfer was observed in the absence of CEACAM1 and was contact, carbohydrate, and N-domain dependent it indicates for the existence of an unknown, putative CEA receptor, which is broadly expressed on fresh and activated NK and T cells.
Our next aim was to determine whether this unknown putative receptor is involved in regulating NK cytotoxicity. We therefore tested bulk cultures of NK cells that do not express CEACAM1 (data not shown) in killing assays against 221 and 221/CEA, and observed a moderate but significant inhibition of NK cell killing in various E:T ratios (Fig. 8A).
|
To further demonstrate the inhibitory effect of CEA, we used another type of assay which examined NK degranulation, by staining for the CD107a (LAMP1) protein (39). A substantial reduction in NK degranulation was observed in NK cells when incubated with 221/CEA compared with 221 parental cells (Fig. 8C). The reduction in NK degranulation was more profound when more targets cells were used in the assay (Fig. 8C), i.e., three targets per one effector. These results further demonstrate that CEA is probably recognized by an inhibitory NK receptor.
| Discussion |
|---|
|
|
|---|
Multiple previous studies have shown intercellular transfer of surface proteins from the target to effector cell. MHC molecules transfer from APCs to T cells (18), B cells acquire Ags from targets leading to enhanced presentation of these Ags to T cells (17) and NK cells acquire either MHC class I proteins (20, 21, 22) or NKG2D ligands from their targets (Refs. 32 and 25).
The CEA transfer to NK cells resembles the MHC class I and MICA transfer in several aspects. The transfer of CEA is a rapid process and CEA molecules can be detected on NK cells within 10 min of cellular interaction. Similar to MHC class I transfer, we show that CEA transfer is mediated by receptor recognition. We demonstrate that deletion of CEA domains hamper some of the observed transfer, indicating that specific recognition is required. Furthermore, we show that the recognition of CEA by NK cells is probably mediated by unique carbohydrate structures on the CEA protein.
We demonstrate that the CEA transfer can be specifically blocked by anti-LeX mAb. However, removing the fucose group did not effect on the CEA transfer. The LeX glycans consist of three different carbohydrate moieties galactose and fucose which are bound to N-acetyl-D-glucosamine. The fucosidase treatment removes only the fucose group from the LeX, therefore it is possible that the partial blockade of the transfer by the anti-LeX mAb was due to a steric hindrance exerted by the IgM anti-LeX Ab and that glycans other than the fucose itself are involved in the transfer. To further support the involvement of carbohydrate in CEA transfer, we show that removing all carbohydrate structures completely diminished CEA transfer. Although we cannot preclude the possibility that sodium periodate treatment has an indirect effect on the transfer, these results strongly suggest that the carbohydrate structures are involved in the CEA recognition and transfer to NK cells. With regard to this, it was recently demonstrated that the LeX moieties on the CEA are important for the interaction with dendritic cells (14, 42), and besides LeX, several other special carbohydrate structures have been identified on the CEA (13, 36, 37).
It was reported that NK cells can capture pieces of target cell membranes (43). To exclude the possibility that the observed CEA transfer resulted from nonspecific NK scavenge of membrane fragments during killing, we examined the role of target cells lysis in the observed phenomenon. We show that perforin-deficient NK clones are still able to acquire CEA molecules from their targets (Fig. 4B). In addition, we show that freshly isolated NK cells and NK cells inhibited by MHC class I interactions are able to acquire CEA proteins from their target cells; finally, we show that that T cells could also acquire CEA molecules. Hence, the CEA transfer is largely independent of target cell lysis.
We show that the activation state of NK cells has an effect on the amount of CEA acquired and that highly activated NK cells acquired more CEA protein (Fig. 4A). The reasons for this are still unknown because it is hard to know whether this elevation in CEA transfer resulted from an intrinsic difference in the amount of protein that transfers to NK cells in a different state of activation or whether it is a secondary outcome of the difference in cell motility. It is known that activated cells move faster, thus they may make more intercellular contacts which will result in enhanced CEA transfer to these NKs.
Exploring the functional consequence of the interaction of CEA on target cells with NK cells, we demonstrate that the CEA protein can inhibit NK cytolytic activity independent of CEACAM1 expression. The observed CEA inhibition of the killing was not as prominent as the inhibition mediated by classical MHC class I proteins, but was similar to that exerted by CEA interaction with CEACAM1 (5, 8). In contrast, inhibition of NK cell degranulation by CEA was much more pronounced. This is because usual killing provides information only about the end-stage lysis of target cells while the CD107a staining provides data on the level of activation of the effector population. Thus, a moderate inhibition will be observed most effectively when effector cells are assayed directly and when more target cells are present.
Our results suggest that NK cells possess an inhibitory receptor that can recognize the CEA and that carbohydrates are probably involved in this recognition. Why do NK cells express such a receptor? An essential feature of the innate immune system is its ability to distinguish foreign from self. One way to prevent inappropriate autoreactivity against self would be for host-specific ligands to engage inhibitory receptors on effector cells, such as NK cells. It is possible that NK cells possess such an inhibitory self recognition receptor that recognizes self carbohydrate structures and that the CEA protein acquired similar structures to escape recognition by NK. One example for such lectin activity has been proposed for the inhibitory siglec receptors (44).
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by grants from The U.S.–Israel Bi-National Science Foundation (to O.M.), by grants from The Israeli Cancer Research Foundation (to O.M.), by a grant from The Israeli Science Foundation (O.M.), by grants from the European Consortium (MRTN-CT-2005 and LSCH-CT-2005-518178, to O.M.), and by a grant from the Association for International Cancer Research. N. S.-G. is supported by the Adams Fellowship Program of the Israil Academy of Sciences and Humanities. ![]()
2 Address correspondence and reprint requests to Dr. Ofer Mandelboim, Lautenberg Center for General and Tumor Immunology, Hadassah Medical School, Hebrew University, Jerusalem, Israel. E-mail address: oferm{at}ekmd.huji.ac.il ![]()
3 Abbreviations used in this paper: KIR, killer Ig-like receptor; CEA, carcinoembryonic Ag; CEACAM, CEA cell adhesion molecule; DC-SIGN, dendritic cell-specific ICAM-3-grabbing nonintegrin; LeX, Lewis X; YFP, yellow fluorescent protein; MICA, major histocompatibility complex class I-related chain A. ![]()
Received for publication January 30, 2007. Accepted for publication July 25, 2007.
| References |
|---|
|
|
|---|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |