|
|
||||||||
and R-848 Dependent Activation of Human Monocyte-Derived Dendritic Cells by Neisseria meningitidis Adhesin A1




* Centro Ricerche Interdipartimentale Biotecnologie Innovative and Dipartimento di Scienze Biomediche Sperimentali, Università di Padova, Padova, Italy;
Dipartimento di Patologia, Sezione di Immunologia, Università di Verona, Verona, Italy;
Istituto Veneto Medicina Molecolare and Dipartimento di Scienze Biomediche Sperimentali, Università di Padova, Padova, Italy;
Istituto Veneto Medicina Molecolare and Dipartimento di Biologia, Università di Padova, Padova, Italy; and
¶ Research Centre, Novartis Vaccines and Diagnostics, Siena, Italy
| Abstract |
|---|
|
|
|---|
351–405), proposed as a constituent of anti-meningococcal B vaccines, is here shown to specifically interact with and immune-modulate human monocyte-derived dendritic cells (mo-DCs). After priming with IFN-
and stimulation with NadA
351–405, mo-DCs strongly up-regulated maturation markers CD83, CD86, CD80, and HLA-DR, secreted moderate quantities of TNF-
, IL-6, and IL-8, and produced a slight, although significant, amount of IL-12p70. Costimulation of mo-DCs with NadA
351–405 and the imidoazoquinoline drug R-848, believed to mimic bacterial RNA, increased CD86 in an additive way, but strongly synergized the secretion of IL-12p70, IL-1, IL-6, TNF-
, and MIP-1
, especially after IFN-
priming. CD86/CD80 overexpression correlated with the occupation of high-(kd
80 nM) and low-(kd
4 µM) affinity binding sites for NadA
351–405. Alternatively, secretion of IL-12p70 and TNF-
, IL-6, and IL-8 corresponded to the occupation of high- or low-affinity receptors, respectively. Mo-DCs matured by IFN-
and NadA
351–405 supported the proliferation of naive CD4+ T lymphocytes, inducing the differentiation of both IFN-
and IL-4 producing phenotypes. Our data show that NadA not only is a good immunogen but is as well endowed with a proimmune, self-adjuvating, activity. | Introduction |
|---|
|
|
|---|
Dendritic cells (DCs)4 are the APCs essential to initiate primary immune response. Present in several tissues, they capture Ags and, matured by typical microbial molecules or pathogen-associated molecular patterns (PAMPs), migrate to the closest lymphoid tissue where they present Ags to T lymphocytes, which proliferate, differentiate, and begin the adaptive immune response. Differentiation of naive CD4+ T lymphocytes into effector cells, producing a selective pattern of cytokines, has a deep influence on the kind of immune response which is set up. IFN-
produced by Th1 cells, favors cell-mediated immunity and the production of opsonizing and complement-fixing Abs, whereas IL-4 produced by Th2 cells promotes humoral immunity with the production of neutralizing Abs (4, 5). The differentiation pathway entered by naive T cells is determined by the cytokine milieu generated by activated DCs, with IL-12 acting as the most powerful Th1-promoting factor, by the degree of DCs maturation and by their expression of costimulatory molecules (6). Such differentiation signals generated by DCs are, in turn, dictated by microbial factors and by local mediators released by other immune and inflammatory cells. One of the most powerful DCs potentiating agent is IFN-
, a cytokine produced by NK and by Th1 memory cells (7, 8). Priming with IFN-
strongly increases LPS-induced production of IL-12 (9, 10). Meningococcal endotoxin is regarded as a major stimulus converting immature DCs into fully functional APC, characterized by a large secretion of soluble mediators like chemokines and cytokines (11). T lymphocytes activated by LPS-treated DCs strongly polarize toward the IFN-
-producing Th1 phenotype, which favors the inflammatory response and cell-dependent immunity. However, activation of mo-DCs by LPS-deficient meningococcal strains suggests that other surface bacterial components are also effective. Interestingly, it has been observed that, although mo-DCs engaged with LPS+ N. meningitidis strains supported a prevalent Th1 differentiation, cells stimulated with LPS– ones also induced a significant Th2 population (12). These data suggest that molecules other than LPS present on meningococcal cells may influence the process of anti-meningococcal immune reaction. In agreement with this hypothesis, a study showed that mo-DCs stimulated with PorA (porin A) of N. meningitidis secrete negligible IL-12p70 and drive T cell differentiation toward the Th2 phenotype (13).
Bioinformatic analysis of the genome of a virulent N. meningitidis B strain (3, 14) identified the 45 KDa Neisseria adhesin A (NadA). Structure prediction and homology comparison suggest that NadA is an OCA (oligomeric coiled-coil adhesin), such as YadA (Yersinia adhesin A) of Yersinia enterocolitica and UspA2 (ubiquitous surface protein A) of Moraxella catarrhalis (15). These homotrimeric outermembrane proteins contain three structural regions: 1) a conserved –COOH-terminal membrane anchor, having a
structure; 2) an intermediate coiled-coil stalk comprising a leucine-zipper; and 3) a –NH2-terminal region, forming the binding site(s) for target cell receptors (16). Expression of NadA is a risk factor for the development of meningococcal disease, because it was found in
50% of N. meningitidis strains isolated from patients, whereas it was found only in
5% of strains from healthy individuals (17). Accordingly, NadA enhances bacterial adhesion to and invasion of mucosal cells and NadA
351–405, a soluble recombinant mutant lacking the membrane anchor, binds to Chang human conjunctival cells (18). All these observations support that NadA is implicated in local mucosal infection by N. meningitidis B. NadA is also a good immunogen, selected for a formulation of a vaccine to meningococcus B, and it has been shown that, in animal models, Abs to NadA can kill meningococcal cells through a complement-dependent mechanism (3, 19). In this study, we used NadA
351–504 to test the hypothesis that NadA is active on monocyte-derived DCs (mo-DCs). Data proved that NadA specifically binds to mo-DCs and induces a mature phenotype depending on priming with IFN-
, associated with a low production of chemokines and cytokines, and in particular of IL-12p70. However, costimulation with NadA
351–504 and R-848, the antiviral drug with adjuvant properties believed to mimic bacterial RNA and interacting with TLR7/8 and cytosolic cryopyrin (20, 21), induced a synergic strong production of IL-12p70, IL-1, IL-6, TNF-
, and MIP-1
by IFN-
primed mo-DCs, whereas only an additive effect on their CD86 up-regulation. NadA-matured mo-DCs are competent APC cells able to stimulate allogenic naive CD4+ T lymphocytes, inducing their differentiation into both IFN-
and IL-4 producing T cells.
| Materials and Methods |
|---|
|
|
|---|
Soluble recombinant NadA was designed as previously described and purified to clinical trial standard (15). In brief, the DNA sequence of nadA allele 3, cloned from the hypervirulent N. meningitidis B strain 2996, encoding the deletion mutant NadA
351–405, with no outer membrane anchor, was cloned into a pET21b vector (Novagen). The protein secreted in the extracellular medium of the transformed Escherichia coli BL21(DE3)-NadA
351–405 strain was purified by Q Sepharose XL, Phenyl Sepharose 6 Fast Flow (Pharmacia) and Hydroxyl apatite ceramic column (HA Macro- Prep BioRad) chromatographies. Preparations of purified NadA
351–405 showed a single 35 KDa band after SDS-PAGE and silver staining, consistent with the predicted m.w., and is a homotrimer, as assessed by light scattering analysis (18). Reverse-phase separation of NadA
351–405 preparation in denaturating conditions shows a single peak homogeneously corresponding to the 1–315 sequence of mature NadA protein, as determined by MALDI-TOFF mass spectrometry analysis. LPS contamination (tested by Limulus test kit from Sigma-Aldrich) was <0.005 EU/µg of protein. Bacterial DNA contamination (determined by an enzymatic assay) was 0.6–0.7 pg/µg of protein. No E. coli Ags were detected by Western immunoblot analysis with a rabbit polyclonal Ab risen against whole E. coli cells (DakoCytomation). Aliquots of protein solution (2 mg/ml in PBS, pH 7.4) were frozen in liquid nitrogen and stored at –80°C. NadA concentration was expressed based on the monomer m.w.
Labeling of NadA
351–405
NadA
351–405 was conjugated to the fluorescent probe Alexa 488 using a N-hydroxysuccinimidyl derivative (Molecular Probes) according to the manufacturers instructions. Alexa-NadA
351–405 was separated from left reagents by size exclusion chromatography using Sephadex G25 (Sigma-Aldrich) columns pre-equilibrated and eluted with PBS at room temperature.
Cell isolation and culture conditions
All reagent used in this study were tested for low endotoxin contamination using the Limulus amoebocyte assay (Sigma-Aldrich). DCs were generated from human PBMC as described previously (22). In brief, PBMC were isolated from buffy coats of healthy donors by Ficoll-Paque Plus density gradient centrifugation (Pharmacia Biotech). Separate monocyte and T cell fractions were obtained from PBMCs by Percoll density gradient centrifugation (Pharmacia Biotech). Residual T and B cells were removed from monocyte fraction by plastic adherence of 3 x 106 cells/well in 6-well plates (Costar) resulting in CD14+ monocyte populations of >95% purity (determined by flow cytometry). DCs were obtained by 6-d culture adherent monocytes in medium with 20 ng/ml IL-4 (5 x 106 U/mg; PeproTech) and 50 ng/ml GM-CSF (1 x 107 U/mg; PeproTech). Cytokines were added again on day 4 in RPMI 1640 medium supplemented with 10% FBS. Following this procedure >90% cells belonged to the immature DCs phenotype (CD1a+, HLADRlow, CD14–, CD83–, CD86low, and CD80low). On day 5, cells were treated with nothing or with recombinant human 1000 U/ml IFN-
(Roussel-Uclaf Pharmaceutical Laboratories) for 18 h before stimulation with NadA (0.0375–5 µM), LPS from E. coli serotype 026:B6 (1 µg/ml; Sigma-Aldrich), flagellin (0.1–10 µg/ml; Invitrogen Life Technologies), CpG2216 (GGGGGACGATCGTCGGGGGG) oligodeoxynucleotide (0.1–10 µg/ml; provided by MWG Biotec), poly(I:C) (10 µg/ml; InvivoGen) PAM2CSK4 (50 ng/ml; InvivoGen), muramyl dipeptide MDP (10 µg/ml; InvivoGen) in absence or presence of R-848 (1 µM; Invitrogen Life Technologies) costimulation. After 24 h, cells were harvested and analyzed. Culture supernatants were collected frozen in liquid nitrogen and conserved at –80°C for cytokine analysis. For generation of mDCs, iDCs were exposed for a further two days to a new medium containing a mixture of the maturative cytokines TNF-
(10 ng/ml), PGE-2 (1 µg/ml), IL-1
(1 ng/ml), and IL-6 (1000 U/ml).
For naive Th cell purification frozen aliquots of PBMC were thawed and depleted of memory CD45RO+ by magnetic depletion using Ab against CD45RO (BD Pharmingen), goat anti-mouse IgG microbeads (Miltenyi Biotec), LD separation columns (Miltenyi Biotec) and a VarioMACS magnet (Miltenyi Biotec) according to the manufacturers instructions. CD45RO– cells were further incubated with human CD4 microbeads (Miltenyi Biotec) for positive magnetic selection of highly pure T naive helper cells with MS colums (Miltenyi Biotec) and a MiniMACS magnet (Miltenyi Biotec). T cell fractions were >95% CD4+CD45RA+ as assessed by flow cytometry. All cultures were performed in endotoxin-free RPMI 1640 (Invitrogen Life Technologies) supplemented with 10% heat inactivated FBS (Euroclone).
Chang epithelial (Wong-Kilbourne derivative, clone 1–5c-4, from human conjunctiva) were maintained in DMEM (Invitrogen Life Technologies) supplemented with 50 µg/ml gentamicin (Invitrogen Life Technologies) and 10% (v/v) heat-inactivated FBS.
Chinese hamster ovary (CHO)-K1 cells were maintained in F12/DMEM medium supplemented with 50 µg/ml gentamicin (Invitrogen Life Technologies), 10% FBS, and 2 mM L-glutamine. PMNs were isolated from buffy coats by Ficoll-Hypaque sedimentation and hypotonic shock. All cells were kept at 37°C in a humidified atmosphere containing 5% (v/v) CO2, unless otherwise specified.
Microscopy
DCs cultured for 5 days in 6-well plates (Costar) were treated with recombinant human IFN-
(1000 U/ml) for 18 h before NadA (1.5 µM) or LPS (1 µg/ml) stimulation for 4 h. Control cultures were untreated cells or treated with IFN-
alone. Cells morphology was analyzed by light microscopy (Leica DM IRE2
).
Flow cytometry analysis
After differentiation DCs were routinely stained with phycoerytrin conjugated mAbs to human CD14, CD1a, CD83, CD86 (B7.2), CD80 (B7.1), and MHC II (HLA-DR), purchased from BD Pharmingen and Caltag Laboratories. In parallel, cells were stained with the isotype matched control mAb. Cells were immunostained with the proper dilution of PE-conjugated anti-human mAbs at 4°C for 30 min in 100 µl of PBS (pH 7.2) (PBS; Invitrogen Life Technologies) containing 1% FBS and 0.1% NaN3 (FACS buffer). After washing, propidium iodide was added to exclude dead cells and cell fluorescence intensities of the gated populations were measured with a EPICS XL-MCL (Corixa) flow cytometer and analyzed with EXPO 32ADCs XL 3COLOR or WinMDI 2.8. software. Data were collected on 10000–20000 events.
Cell binding experiments
Chang epithelial and CHO-K1 cells were nonenzymatically detached using Cell dissociation solution (Sigma-Aldrich), harvested, and resuspended in RPMI 1640 medium supplemented with 2% FBS. PMNs were maintained in the same medium. In some cases, DCs primed or not with IFN-
were treated at 37°C for 1 h with FBS/RPMI 1640 containing Bafilomycin A1 200 nM (Sigma-Aldrich), incubated at 37°C (in RPMI 1640 medium supplemented with 2% FBS and Bafilomycin A1) or 0°C (in PBS supplemented with 2% FBS) for 3 h with different concentrations (0.0375–5 µM) of Alexa-NadA
351–405 or NadA. Afterward, cells were washed and suspended in FACS buffer for FACS analysis. Scatchard plots were constructed from data obtained from cell-associated mean fluorescence intensities due to cell-bound Alexa-NadA. The dissociation constant Kd and maximal binding capacities were then determined by Scatchard analyses.
Bio-Plex multiplex cytokine assays
All Ab pairs used, directed against different noncompeting epitopes of a given cytokine, were purchased from BioRad and Upstate Biotechnology. Calibration curves from recombinant cytokine standard were prepared with four-fold dilution steps in RPMI 1640 medium containing 10% FBS. All assays were conducted in 96-well sterile prewetted filter plates at room temperature and protected from light. A mixture containing 5000 microspheres/cytokine was incubated together with standard or sample in a final volume of 50 µl for 30 min, under continuous shaking (300 rpm). After three washes by vacuum filtration with Bio-Plex washing buffer a mixture of biotinylated Abs diluted in Bio-Plex detection Ab diluent was added (25 µl to each well). After a 30-min incubation and washing, streptavidin-PE diluted in Bio-Plex assay buffer was added (50 µl/well). At the end of a 10-min incubation under continuous shaking and after washing the fluorescence intensity of the beads was measured in a final volume of 125 µl of Bio-Plex assay buffer. Data analysis was done with Bio-Plex manager software using a five-parametric-curve fitting. The detection limit of the assay for all Ags is 1 pg/ml.
IL-12(p40) and IL-12(p70) ELISA
IL-12(p40) and p70 were measured by capture enzyme-linked immunosorbent assay (ELISA) with Ab pairs and cytokine standard purchased from Bender MedSystems. The concentrations of IL-12(p40) and p70 in the cell-free supernatants were determined with ELISA kits according to the manufacturers instructions. The detection limit of the assay is 31.25 pg/ml (p40) and 1 pg/ml (p70).
Real-time PCR analysis
Mo-DCs were pretreated or not with IFN-
1000 U/ml and stimulated with NadA 1.5 µM and LPS 1 µg/ml for 3, 5, and 8 h. Treated and untreated cells were pelleted and used for RNA isolation. Total RNA was extracted using the TRIzol reagent (Invitrogen Life Technologies) according to the manufacturers instruction, precipitated and resuspended in 6–8 µl of RNase free water (Invitrogen Life Technologies). RNA was quantified with a fluorescence spectrophotometer (Beckman DU 530). First strand cDNA was prepared from 4 µg of total RNA by using the Superscript II Reverse Transcriptase (Invitrogen Life Technologies) with oligo(dT) primers (Sigma-Aldrich). The concentrations of cDNA for IL-12p35, IL-12p40, IL-23p19, TNF-
, and IL-6 were quantified by real time quantitative PCR using a qPCRTM Core Kit for SYBR Green I (Eurogentec) with a GeneAmp 5700 Sequence Detection System according to the manufacturers instructions (Applied Biosystems). After an initial denaturation step at 95°C for 10 min, temperature cycling was initiated. Each cycle consisted of 30 s at 95°C and 30 s at 60°C (TNF-
at 61°C and p19 at 63°C); in total 40 cycle were performed. The following primers were used: IL-12p35 sense 5'-ATGGCCCTGTGCCTTAGTAGT-3', IL-12p35 antisense 5'-CGGTTCTTCAAGGGAGGATTTT-3' (primerBankID 24430219a2); IL-12p40 sense 5'-ACAAAGGAGGCGAGGTTCTAA-3', IL-12p40 antisense 5'-CCCTTGGGGGTCAGAAGAG-3' (primerBankID 24497438a3); IL-23p19 sense 5'-TCCACCAGGGTCTGATTTTT-3', IL-23p19 antisense 5'-TTGAAGCGGAGAAGGAGACG-3'; TNF-
sense 5'-ATGAGCACTGAAAGCATGATCC-3', TNF-
antisense 5'-GAGGGCTGATTAGAGAGAGGTC-3' (primerBankID 25952111a1); IL-6 sense 5'-AACCTGAACCTTCCAAAGATGG-3', IL-6 antisense 5'-TCTGGCTTGTTCCTCACTACT-3' (primerBankID 10834984a2); hydroxymethylbilane synthase (HMBS) sense 5'-GGCAATGCGGCTGCAA-3', HMBS antisense 5'-GGGTACCCACGCGAATCAC-3'. All amplification products were cloned into a TOPO TA vector (Invitrogen Life Technologies) and quantified by Beckman DU 530 spectrophotometer. To obtain standard curves, samples from MiniPrep were serially diluted to concentrations ranging from 0.5 x 10–2 to 0.5 x 10–6 fmol/µl. Amplified products (20 µl) together with a DNA ladder (Invitrogen Life Technologies) as a size standard were resolved on a 2% agarose in the presence of ethidium bromide.
The cDNA quantities during the linear phase of amplification were normalized against HMBS (23). Each run was completed with a melting curve analysis to confirm the specificity of amplification and lack of primers dimers. CT (cycle threshold) values were determined by the GeneAmp 5700 SDS software using fluorescence threshold manually set and exported into Excel for analysis.
Allogenic MLR and naive CD4+ T cell proliferation
Allogenic MLR was performed with irradiated (3000 rads from a 137Cs source) mo-DCs and purified allogenic naive T cells. Graded numbers of DCs cultured for 18–24 h with NadA (1.5 µM), LPS (1 µg/ml) (positive control) or non stimulated DCs (negative control) pretreated or not with IFN-
(1000 U/ml) were washed and cultured with allogenic CD4+ naive T lymphocyte (0.3 x 105 cells/well) for 5 days at 37°C in a humidified CO2 incubator in round-bottom 96-well microtiter plates (Costar). Proliferation was measured by pulse-labeling triplicate wells for 6 h with 1 µCi of [3H]thymidine per well (Amersham Biosciences). Negative controls included T naive cells or DCs incubated alone.
[3H]Thymidine incorporation was measured by harvesting cells onto glass fiber filter paper (Pall Corporation, Life Sciences) using a 96-well semiautomatic cell harvester (MultiWash 2000; Dynatech) and counting by liquid scintillation in a
-counter (Wallac 1409 liquid scintillation counter).
Intracellular detection of IFN-
and IL-4 by flow cytometry
Mo-DCs pretreated in various conditions were cocultured with naive T cells for five days and restimulated with ionomycin (1 µg/ml; Calbiochem) and PMA (10 ng/ml; Sigma-Aldrich) for 2.5 h and for 3 h in the presence of a Brefeldin-A (10 µg/ml; Calbiochem). Cells were then washed and fixed for 15 min (Fix and Perm cell permeabilization kit; Caltag Laboratories). After one washing step cells were permeabilized and stained with FITC-conjugated anti IFN-
mAb (BD Pharmigen) and PE-conjugated anti IL-4 mAb (Caltag Laboratories) or with irrelevant isotype control for 30 min. Then cells were washed again, resuspended, and analyzed by flow cytometry, gating the cells on side scatter and forward scatter parameters corresponding to those of alive small T lymphocytes and T cell blasts. In this region, the contribution of irradiated mono-DCs at the end of the 5 days of culture was irrelevant.
Statistical analysis
Results were expressed as mean ± SEM. Significance (p
0.05) of differences with respect to control values were calculated by two-populations t tests.
| Results |
|---|
|
|
|---|
Expression of full length NadA on the outer membrane increases the adhesion of an E. coli model to the human conjunctival cell line Chang (18). Consistently, soluble isolated NadA
351–504 has been shown to bind to Chang cells (15). Data shown in Fig. 1 demonstrate that binding of Alexa-labeled NadA
351–504 to Chang cells is competed by nonlabeled NadA
351–504 in a dose dependent manner. Signal decrease indicates a low-affinity interaction with specific receptors, compatible with the binding curve reported by Comanducci et al. (15). The specificity of NadA displacement in Chang cells is confirmed by experiments conducted with CHO-K1 cells, showing a significant association of Alexa-labeled NadA
351–504 that is, however, not modified by nonlabeled NadA
351–504. Similar experiments performed with mo-DCs demonstrated the existence of a specific binding to these cells, but not to other leukocytes like PMNs. As in Chang cells, Alexa-NadA
351–504 binding to mo-DCs is competed by nonlabeled NadA
351–504, suggesting the existence of similar receptors able to associate with NadA at low affinity, but specifically. Specific binding sites with similar affinity are also present on human monocytes and on macrophages differentiated in vitro from monocytes (data not shown; S. Franzoso, C. Mazzon, M. Sztukowska, P. Cecchini, T. Kasic, B. Capecchi, R. Tavano, and E. Papini, manuscript in preparation). At variance, association of NadA to PMNs appears nonspecific. NadA binds to specific receptors present on Chang epithelial cells, monocytes, macrophages, and mo-DCs. In this study, we decided to focus on DCs because of their importance in primary immune response.
|
Alteration of cell morphology and distribution is a good indicator of DCs activation. Optical microscopy suggested that NadA
351–405 (1.5 µM) activated immature mo-DCs, only when they were subjected to a priming (18 h) with IFN-
(1000 U/ml). In such case, after a short incubation (3 h) with the meningococcal protein, some cells became elongated and tended to cluster, although less intensely than after stimulation by maximally active LPS (1 µg/ml) (data not shown).
The effect of NadA
351–405 on mo-DCs was further investigated by measuring the expression of typical maturation markers (Fig. 2). CD83 was not increased after a 24-h exposition to NadA
351–405 (1.5 µM). However, after IFN-
priming, NadA stimulation boosted CD83 to
50% of the amount induced by LPS. IFN-
priming also influenced the expression of CD86, the costimulatory molecule associated with DCs maturation. CD86 amount on mo-DCs treated with NadA was greatly enhanced after IFN-
priming and reached the same value observed in LPS-treated cells. IFN-
priming alone scarcely affected LPS-induced expression of CD83 and CD86. The expression pattern of CD80, the other costimulatory molecule necessary to T lymphocyte activation, was very similar to that of CD86 (data not shown). Control plasma membrane HLA-DR, a marker of T epitope-presenting MHC-II proteins, already expressed in immature cells, was partially increased by NadA and roughly doubled by LPS. Although IFN-
priming was per se sufficient to up-regulate surface HLA-DR, subsequent stimulation with NadA or LPS further increase such basal value, in a similar way.
|
Measurements of surface maturation markers suggested that NadA
351–405 induces a mo-DCs phenotype competent for Ag presentation, only after IFN-
priming. Quantitative RT-PCR was used to determine NadA effect on the transcription of cytokine encoding genes. RNA extracts from mo-DCs treated with no agonists, NadA, or LPS for 3, 5, and 8 h, without or with IFN-
priming, were retrotranscribed and m-RNA copies encoding for cytokines or a housekeeping protein, were measured by SYBR Green real-time amplification (Fig. 3). Data confirmed that IFN-
priming significantly augmented (p < 0.05) NadA-induced transcription of TNF-
and IL-6 genes. We as well quantified IL-12p40, IL-12p35, and of IL-23p19 transcripts, with the goal of gaining information on the transcription of the subunits forming IL-12p70, but also IL-23, which is composed by p40 and p19. IL-23 has an activity overlapping, although not completely, with that of IL-12 (24). Results showed that IL-12p40, IL-12p35, and IL-23p19 transcriptions were all significantly increased (p < 0.05) by NadA if cells were primed with IFN-
. The transcription activities of genes encoding for IL-6, TNF-
, p40, p35, and p19 induced by NadA
351–405 in IFN-
primed mo-DCs were nevertheless estimated to be very low (<1%) compared with the one observed in LPS-activated cells.
|
351–405 on cytokine secretion by mo-DCs
Quantification of the actual release of local mediators, with or without IFN-
priming, was investigated at the Ag level (Fig. 4). The secretion of inflammatory cytokines TNF-
and IL-6, of chemokine IL-8 and of the regulatory cytokines IL-12p70 and IL-10 was measured with a Bio-Plex suspension array in the extracellular medium from mo-DCs stimulated for 24 h. NadA
351–405 (1.5 µM) induced a production of TNF-
and IL-6, which was increased by IFN-
priming to
24% of maximal LPS production. IL-8 secretion, measurable also in nonstimulated cells, was further increased by NadA
351–405 in the absence of priming. In contrast with what seen for TNF-
and IL-6 secretion, IFN-
priming slightly inhibited NadA-induced IL-8 secretion, which was in both cases
24% of that induced by LPS. In no condition was NadA able to induce IL-10 production.
|
priming. It is to be noted, however, that such IL-12p70 secretion was very low compare with the one induced by LPS (<0.5%). IL-12p40, the subunit that assembles with IL-12p35 to form biologically active IL-12p70, is detectable in the extracellular medium from NadA-treated cells and its concentration was further increased by IFN-
priming. Also, in this case, maximal secretion was
2% of that induced by LPS. Comparison of NadA effect on mo-DCs with other common PAMP stimuli
NadA effect on mo-DCs was compared with the action of known classical PAMP stimuli, typical of Gram bacteria: flagellin, nonmethylated DNA, and LPS (Fig. 5). High flagellin doses (10 µg/ml) determined a significant increase of CD86 expression, which was further enhanced by IFN-
priming to a value comparable to that induced by NadA 1.5 µM. CpG, a ligand resembling nonmethylated bacterial DNA, is ineffective on CD86 induction at concentrations up to 10 µg/ml, also after IFN-
priming. LPS up to 0.1 ng/ml had no effect in the absence of IFN-
priming and a slight one after priming. Maximal stimulation with LPS (0.1 µg/ml) determined a strong effect, which was doubled by IFN-
priming. A few IL-12p70 secretion, comparable the one induced by both 0.25 µM (9 µg/ml) and 1.5 µM (50 µg/ml) NadA, was observed with high flagellin dose (10 µg/ml), after IFN-
priming. CpG at high doses (10 µg/ml) had an even weaker effect and LPS up to 100 pg/ml was ineffective. Maximal LPS stimulation resulted in a much higher secretion of IL-12p70 after IFN-
priming. These data exclude that the effect seen with our NadA preparations is due to contamination by nonmethylated bacterial DNA, which can be in any case estimated to be <36 pg/ml (1.5 µM NadA) in the assay. In addition, they exclude that LPS, measured to be <18 pg/ml (1.5 µM NadA) in the assay, is responsible for NadA preparations activity, because even after IFN-
priming, both CD86 and IL-12p70 were poorly or not increased by LPS up to 100 pg/ml.
|
R-848 costimulation enhances cytokine secretion by NadA treated mo-DCs
Although the Ag presentation machinery is optimally up-regulated even by single agonist stimulation, multiple microbial stimuli are required to obtain an activated mo-DCs phenotype with efficient cytokine secretion (25). Therefore, main PAMP molecules were added together with NadA, in the absence or in the presence of priming with IFN-
. Data (Fig. 6) demonstrate that only the antiviral drug R-848 (a TLR7/TLR8/cryopyrin agonist) is effective in boosting IL-12p70 secretion by mo-DCs to high levels after IFN-
priming. R-848 is indeed known to interact with immune cells (26, 27) and is believed to mimic the physiological action of free bacterial RNA (21). Interestingly, no other ligands to: TLR9 (CpG 2216 and CpG 2006, data not shown), TLR5 (flagellin), TLR3 poly(I:C), TLR2/TLR6 (PAM2), and TLR2/TLR1 (28) (PAM3, data not shown), NOD2 (MDP), and TLR4 (LPS) were synergic with NadA. CD86 expression induced by NadA were not synergized by any of these ligands, included R-848, with or with no IFN-
priming (data not shown).
|
priming, R848 alone (1 µM) determined a weak CD86 increase in mo-DCs. Costimulation with NadA (1.5 µM) and R-848 resulted in an addition of the two effects, a situation which was observed also when cells were costimulated with flagellin (10 µg/ml) and R-848. CpG and LPS 0.1 ng/ml were without effect also with R-848 costimulation, and R-848 did not increase the strong effect of 0.1 µg/ml LPS. After IFN-
priming, R-848 alone strongly increased control CD86 reaching a value corresponding to about half maximal LPS effect. Again, costimulation with NadA and R-848 determined a sum of the two separate effects, leading to maximal CD86 expression. In the case of flagellin, and of LPS 0.1 µg/ml, a strong CD86 level was observed after IFN-
priming, which was not further increased by costimulation with R-848. CpG and LPS 100 pg/ml were without effect even after costimulation with R-848.
|
In fact, flagellin and LPS 100 pg/ml were ineffective in inducing IL-12 secretion in the presence of R-848 costimulation, even after IFN-
priming. On the contrary, mo-DCs costimulated with NadA and R-848 released a quantity of IL-12 (2 ng/ml), which was increased 20-folds (45 ng/ml) after IFN-
priming. A high dose of LPS (0.1 µg/ml) was very effective when administered to cells with R-848 in both priming and nonpriming conditions, but a significant activity was seen even without R-848 costimulation (0.2 ng/ml with no priming and 6 ng/ml with priming). CpG was ineffective in any condition. These data further excluded flagellin, bacterial DNA, and LPS contamination as the cause of the observed activity of NadA preparations. A multiplex analysis extended to 22 most common cytokines and chemokines (Fig. 8) showed that IFN-
priming and R-848 costimulation are also sufficient to induce a NadA-dependent secretion of IL-1
, IL-1
, TNF-
, IL-6, and MIP-1
. Interestingly, RANTES and eotaxin are effectively induced by NadA only after IFN-
priming but these effect are scarcely synergized by R-848. IL-10 was not induced by NadA in any costimulatory condition, whereas IL-8 production was poorly increased by IFN-
and R-848. IL-7, IL-2, IL-3, IL-4, IL-5, IL-13, IL-15, IFN-
, and GM-CSF were present in nondetected levels in our assay (data not shown).
|
priming (data not shown).
Collectively, our data proved a rather specific reciprocal synergy between NadA, and R-848, leading to a significant increase of IL-1, IL-12, IL-6, TNF-
, and MIP-1
secretion by IFN-
primed mo-DCs.
Correlation of NadA
351–405 effects on mo-DCs with cell binding
To further prove that activation of mo-DCs is due to a specific interaction with NadA
351–405 we characterized its binding to mo-DCs, and compared it with induced biological effects. Binding of Alexa-labeled NadA
(351–405) to mo-DCs, measured at 37°C by flow-cytometry, was substantially unaltered by IFN-
priming (Fig. 9A). NadA-cell association was evident in the submicromolar range and did not reach a complete saturation at concentrations up to 5 µM, in agreement with competition experiments (see Fig. 1). Scatchard plot analysis (Fig. 9B) showed that the majority of binding sites (70–80%) associates to NadA with a low affinity (3–5 µM) but as well revealed a minor fraction of high-affinity binding sites (20–30%) with an apparent Kd around 50–100 nM. The existence of two kinds of binding sites on mo-DCs was confirmed at 0°C, a condition that prevents endocytosis, although in this case binding capacity was reduced. The analysis of the fluorescence distribution due to Alexa-NadA
351–405 cell binding at submicromolar and micromolar concentrations suggested an heterogeneous distribution of high-affinity sites within the cellular population, whereas low-affinity ones are more homogeneously expressed (Fig. 9C).
|
(10 ng/ml), IL-1
(1 ng/ml), IL-6 (10 ng/ml), and PGE2 (1 µg/ml) showed that NadA can bind also to matured cells with similar property at 0°C, whereas at 37°C the adhesin cell association is 80% inhibited due to down-regulation of cell endocytosis (Fig. 9D).
Altogether these experiments demonstrated the existence of high- and low-affinity binding sites for NadA on mo-DCs, and this Ag is as well endocytosed at physiological temperature by these important APCs. They also exclude that the synergic effect of IFN-
priming results from an increased association of NadA to mo-DCs.
To further characterize NadA action on mo-DCs, we attempted to correlate, within the same cell population the extent of Alexa-NadA signal with the intensity of the induced biological effects: intracellular cytokine expression IL-12p40 (whose level is much higher than that of IL-12p70) and increase of surface CD86. Because Alexa-NadA signal was found to be altered or modified by endocytosis and degradation (our unpublished observations) we included a V-ATPase inhibitor in our assay and therefore we performed the assays after a maximal time of 6 h, because prolonged incubation of cells in the presence of bafilomycin led to cell suffering and apoptosis. However, after early incubation times, the intracellular cytokine signal was still too poor, whereas CD86 levels were only partially induced, making this correlation study problematic and scarcely reproducible (data not shown). For this experimental reasons, we opted for a whole-population dose-response analysis of CD86 over expression and on cytokine secretion after 24 h, compared with cell binding after 3 h in separate but homogeneous cells samples (Fig. 10).
|
priming, CD86 was not different from control cells below 1 µM NadA and increased almost linearly at higher concentrations. On the contrary, after IFN-
priming, NadA effectively induced CD86 also in the submicromolar concentration range. Comparison with the NadA binding curve in the same conditions showed that CD86 induction correlated with occupation of low-affinity sites in nonprimed cells, whereas of both high- and low-affinity sites in primed ones. IFN-
potentiation of NadA effect was stronger at low concentrations (from no effect to a sensible one) than at higher concentrations (a relative 2- to 3-fold increase; Fig. 10A). Analysis of the cellular distribution of CD86 expression revealed that, after IFN-
priming, a fraction of mo-DCs was very responsive to NadA at concentrations corresponding to the occupation of high-affinity binding sites (Fig. 10B).
In parallel, we measured cytokine secretion in the extracellular medium, using a Bio-Plex suspension array (Fig. 10A). IL-6, TNF-
, and IL-8 were evident in samples from nonprimed cells treated with NadA
351–405 only at concentrations higher than 1 µM. After IFN-
priming, very low quantities of IL-6, TNF-
, and IL-8 were detected below 1 µM NadA. On the contrary, IFN-
priming potentiated IL-6 and TNF-
secretion, whereas partially inhibited IL-8 production, at concentrations higher than 1 µM. IL-12p70, undetected until up to 5 µM NadA in the absence of IFN-
priming, became evident and reached a plateau below 1 µM NadA, after IFN-
priming. IL-10 secretion was not observed until up to 5 µM NadA, without or with IFN-
priming.
Using a 22-Plex cytokine/chemokine suspension array, we found that LPS and IL-1/IL-6/TNF-
/PGE2 matured mo-DCs, although still able to bind NadA, become completely irresponsive to this and to other stimuli like LPS (data not shown), presumably because this treatment led to cytokine secretion per se and hence to cell exhaustion.
Our data support that the biological effects observed in mo-DCs are the consequence of NadA binding to these cells through two distinct receptor types and prove that there is a mean direct proportion between the extent of occupation of these sites and the intensity of cell response.
Induction of naive CD4+ T lymphocyte proliferation and differentiation
Mixed lymphocyte reaction experiments performed with isolated allogenic naive T CD4+ cells, showed that NadA
351–405 (1.5 µM), in the absence of IFN-
priming, was not able to induce a mo-DCs phenotype competent for T lymphocyte activation (Fig. 11). On the contrary, mo-DCs primed with IFN-
and then stimulated with NadA induced a significant T cell proliferation (p < 0.05). IFN-
priming alone did not increase the ability of LPS-matured mo-DCs to activate T lymphocytes (Fig. 11A). The differentiation of T lymphocytes cultured with IFN-
-primed NadA- or LPS-matured mo-DCs was determined by measuring intracellular IFN-
and IL-4. The pattern of IFN-
and IL-4 expression obtained after culture at 1:30 stimulator:responder ratio in one of two donors tested (Fig. 11B) and percent values of IFN-
+, IL-4+, and IFN-
+/IL-4+ obtained at 1/300, 1/100, and 1/30 stimulator/responder ratios from two different donors (Fig. 11C) are shown. After IFN-
priming, LPS-activated mo-DCs strongly polarized T cells toward the IFN-
+ phenotype (36–65%), whereas IFN-
+/IL-4+ and IL-4+ cells were few. Within T cells induced by NadA-matured mo-DCs, the IFN-
+ phenotype, although still predominant (13–31%), was as well associated with a fraction of IFN-
+/IL-4+ (3–18%) and IL-4+ (4–12%) cells.
|
| Discussion |
|---|
|
|
|---|
. NadA-matured DCs express quantities of CD83, CD86, CD80, and MHC-II molecules similar to those seen in maximally stimulated LPS-matured DCs. Consistently, NadA-matured mo-DCs are competent for T lymphocyte proliferation. Cytokine production patterns determined both at the transcription and translation level, highlights the peculiar property of NadA-matured DCs phenotype. In fact, inflammatory mediators like TNF-
, IL-6, and IL-8 are secreted less efficiently compared with maximally LPS-stimulated cells. Additionally, no IL-10 synthesis could be detected even after IFN-
priming, a condition that, on the contrary, determines a 5-fold increase of IL-10 secretion by LPS-matured mo-DCs. In agreement with this tendency, IL-12p70 production, although clearly detected in NadA-matured mo-DCs, was much lower compared with the one observed in LPS-matured cells. IL-23 mRNA expression pattern was similar to that of IL-12.
Surprisingly, however, mo-DCs costimulated with NadA and R-848, but not with other common TLR/NOD agonists, supported a very strong IL-12p70 production which was
50 and
100% of the ones induced by LPS in the same conditions, without or with IFN-
priming, respectively. Also IL-1, IL-6, TNF-
, and MIP-1
secretion was increased by R848 costimulation. Such a switch of IL-12p70 production from values just above background values (<20–50 pg/ml) to nearly maximal ones (
50 ng/ml), appears a specific feature of NadA. In fact, costimulation with R-848 did not enhance IL-12 production by mo-DCs treated with CpG and flagellin, and low doses of LPS, whereas high dose LPS-treated mo-DCs secrete a strong IL-12p70 secretion also in the absence of R-848.
Consistent with functional data, we showed that NadA, which is already known to bind to epithelial cells (15), can also associate in a specific way to DCs, independently on priming by IFN-
, and on maturation with LPS or a mixture of cytokines and PGE2. Accurate binding studies showed that there are two modalities of NadA-DCs interaction: one characterized by high-affinity receptors, half-saturated at 70–90 nM NadA, and one characterized by low-affinity sites (half-saturation 4–5 µM). Although, considering the total binding capacity of the cell population, high-affinity receptors are less represented (20–30%), we observed that they are not equally distributed, so that they are particularly enriched in a subfraction of DCs. This means that at concentrations titrating high-affinity receptors (30–75 nM NadA), some DCs bind a quantity of NadA similar to the one which is reached by the occupation of low-affinity sites, for example at 3–5 µM NadA.
The analysis of the functional effect of NadA
351–405 at different concentrations allowed to further characterize the action of this meningococcal adhesin on mo-DCs. It appeared that at low doses, corresponding to cell-binding through high-affinity receptors, mo-DCs primed by IFN-
respond by up-regulating CD86 and CD80, and by activating a tiny but significant IL-12p70 secretion. At such low concentrations the other major inflammatory cytokines and chemochines, are virtually not produced. Interestingly, when NadA
351–405 concentration allows the occupation of low-affinity sites, mo-DCs not only further up-regulate T lymphocyte costimulatory molecules, but also start to secrete increasing significant amounts of proinflammatory cytokines, with the exception of IL-12p70, whose level remains more or less constant. Matured DCs were not responsive to NadA both in terms of cytokine/chemokine secretion.
Our observations suggest that the presence of IFN-
in the tissue, a condition not rare during inflammation, makes mo-DCs able to sense the presence of low amounts of meningococcal adhesin bound to their high-affinity receptors. As a consequence, they up-regulate the Ag-presenting machinery and secrete a limited amount of IL-12p70, becoming able to support T lymphocyte proliferation and differentiation. Only when adhesin concentration is high, mo-DCs participate to the inflammatory reactions by releasing cytokines and chemokines.
Although our data cannot predict the reciprocal interaction and the relative weight of all bacterial stimuli, included NadA, during meningococcal infection, the strong ability of R-848 to trigger IL-12p70 secretion upon NadA binding, suggests that some may act in synergy.
Why is R-848 the only PAMP costimulus able to boost NadA affects? We suggest that R-848 adds to the simple stimulation by NadA an extra-information on the localization of the infecting meningococcal cells relatively to DCs. In fact, it has been shown that guanine-resembling R-848 activates proteins which, in physiological conditions, monitor the presence bacterial RNA or DNA in acidic endocytic compartment, such as TLR7/TLR8, or in the cytosolic compartment, such as the IL-1 converting complex cryopyrin (30, 21). It can be speculated that the combination of meningococcal RNA/DNA released by bacterial cells engulfed by DCs, and of NadA adhesin, represents a strong alarm signal, which leads to an enhanced cell mediated responses thanks to the triggering of an efficient secretion of a Th1 differentiating cytokine like IL-12p70, of IL-1, IL-6, TNF-
, and MIP-1
. In other words, the engagements of cytoplasmic sensors, like TLR7/TLR8 (phagosomes) and cryopyrin (cytosol), would indicate to the DCs the actual engulfment of the pathogenic bacterium against whom the immune response has to be mounted, and not only the presence of released factors, and this would explain the development of such a synergy with an adhesin, like NadA which, in turn, signals the presence of hypervirulent meningococcal strains. Given that NadA is as well present on OMVs released from N. meningitidis cells during infection, the contemporaneous engagement of R-848 receptors would inform that indeed whole bacteria, with their content of RNA/DNA, have been captured and damaged within DCs endocytic compartments.
It has been clarified that, in natural infection, DCs receive multiple signals, elicited by distinct general microbial patterns, which act synergically to achieve and differentiate their T-activating functions (25). Our data, showing a synergy between IFN-
, R-848 and NadA in inducing a fully matured DCs, suggest that this parasite-specific agonists may act together with general PAMP and immune mediators to modulate the immune response to meningococcal cells. In conclusion, our observations suggest that NadA
351–405 not only is an effective immunogen, which has an intrinsic ability to bind and be endocytosed by DCs, but also, in proper conditions, an adjuvant with moderate proinflammatory side-effects, and is therefore an interesting immunological tool and an excellent candidate for vaccine formulations.
| Acknowledgments |
|---|
351–405, with the personnel of the Centro Trasfusionale of the Hospital of Padua (Unitá Locale Socio Sanitaria 16) and Verona (Policlinico G. B. Rossi) for providing buffy coats from human donors, with Dr. Josè Lapinet for assistance in Bio-Plex analysis, with Dr. Patrizia Polverino de Laureto and Prof. Oriano Marin (Centro Ricerche Interdipartimentale Biotecnologie Innovative, University of Padova, Padova, Italy) for reverse-phase and mass-spectrometry analysis and for peptide synthesis, with Prof. Lina Matera (University of Torino, Torino, Italy) for the protocol for inducing mono-DCs maturation with cytokines and Dr. Loris Bertazza (Dipartimento di Biologia, University of Padova, Italy) for help in graphic representations of data. | Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by PRIN 2002 and 2003 grants from Italian Ministero Universitá e Ricerca, from Progetto dAteneo of the University of Padova and from Fondazione CARIVERONA (bandi 2003, 2004, and 2006). ![]()
2 F.G. and E.P. contributed equally to the work. ![]()
3 Address correspondence and reprint requests to Dr. Emanuele Papini, Padua University, Via G. Colombo 3, Padua, Italy. E-mail address: emanuele.papini{at}unipd.it ![]()
4 Abbreviations used in this paper: DCs, dendritic cell; CHO, Chinese hamster ovary; HMBS, hydroxymethylbilane synthase; PAMP, pathogen-associated molecular pattern; MFI, mean fluorescence intensity. ![]()
Received for publication October 31, 2006. Accepted for publication June 18, 2007.
| References |
|---|
|
|
|---|
production by memory CD4+ T cells. J. Immunol. 175: 1551-1557.
production. J. Immunol. 175: 1636-1642.
in monocytic cells. J. Exp. Med. 183: 147-157.
. J. Exp. Med. 179: 1109-1118. This article has been cited by other articles:
![]() |
R. Tavano, S. Franzoso, P. Cecchini, E. Cartocci, F. Oriente, B. Arico, and E. Papini The membrane expression of Neisseria meningitidis adhesin A (NadA) increases the proimmune effects of MenB OMVs on human macrophages, compared with NadA- OMVs, without further stimulating their proinflammatory activity on circulating monocytes J. Leukoc. Biol., July 1, 2009; 86(1): 143 - 153. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Franzoso, C. Mazzon, M. Sztukowska, P. Cecchini, T. Kasic, B. Capecchi, R. Tavano, and E. Papini Human monocytes/macrophages are a target of Neisseria meningitidis Adhesin A (NadA) J. Leukoc. Biol., May 1, 2008; 83(5): 1100 - 1110. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |