The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

The Journal of Immunology, 2007, 179, 3896-3903
Copyright © 2007 by The American Association of Immunologists, Inc.
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vallois, D.
Right arrow Articles by Rogner, U. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vallois, D.
Right arrow Articles by Rogner, U. C.

The Type 1 Diabetes Locus Idd6 Controls TLR1 Expression1

David Vallois{dagger}, Christina H. Grimm2,*, Philip Avner*, Christian Boitard{dagger} and Ute Christine Rogner3,*

* Unité de Génétique Moléculaire Murine Centre National de la Recherche Scientifique, Unité de Recherche Associée 2578, Institut Pasteur, Paris, France; and {dagger} Institut National de la Santé et de la Recherche Médicale Unité 561, Hôpital Cochin St. Vincent de Paul, Paris, France


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The Idd6 locus on mouse chromosome 6, which controls the development of type 1 diabetes in the NOD mouse, affects proliferation rates of T cells and the activity of regulatory CD4+CD25+ T cells. Using a transcriptional profiling approach, we show that splenocytes and thymocytes from diabetes-resistant Idd6 NOD.C3H-congenic mouse strains exhibit a constitutive and specific down-regulation of Toll-like receptor 1 (Tlr1) gene expression compared with diabetes prone NOD mice. This phenotype correlates with a diminished proliferation capacity of both CD4+CD25– effector and CD4+CD25+ regulatory T cells upon in vitro stimulation of the TLR1/TLR2 pathway by the ligand palmitoyl-3-cysteine-serine-lysine 4, and with the constitutive down-regulation of Tnf-{alpha} and IL-6 in macrophages of Idd6- congenic mice. These data suggest that TLR1 is involved in the regulation of mechanisms that impinge on diabetes development in the NOD mouse.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Toll-like receptors are type I transmembrane proteins involved in innate immunity by recognizing conserved microbial structures. Signal transduction processes activated by TLRs include the important transcription factor NF-{kappa}B and the signals ultimately give rise to increased expression of a multitude of proinflammatory proteins. Recent studies revealed that TLRs also influence the development of adaptive immune responses with several members of the gene family being involved in autoimmune diseases such as lupus (1, 2, 3, 4) and type 1 diabetes (T1D)4 (5).

T1D is a multifactorial and polygenic inherited disorder characterized by the autoimmune destruction of the insulin producing beta cells of the pancreas. Genetic studies of the NOD mouse (6, 7), probably the best-characterized animal model for T1D, have revealed >30 murine insulin-dependent diabetes (Idd) susceptibility loci, including Idd20, Idd19, and Idd6 on mouse chromosome 6 (8). Recently, we have undertaken a detailed phenotypic analysis of the diabetes-resistant NOD.C3H-congenic strain 6.VIII, carrying C3H alleles at the 5.8 Mb Idd6 interval, and showed that its diabetes resistance is immune dependent. Splenocytes, CD4+CD62L+ T cells, and regulatory CD4+CD25+ T cells of 6.VIII strain mice all confer enhanced disease protection in diabetes transfer assays (9). Protection of the congenic strain has also been shown to involve a reduction in the number of lymphocytes infiltrating the 6.VIII islets, and this may modulate the aggressiveness of the autoimmune response to beta cells. The Idd6 locus overlaps in part with a candidate region defined for the control of apoptosis and the proliferation of immature T cells (10, 11, 12, 13).

In the present study, we have performed transcriptional analysis comparing splenocytes and CD4+ T cells from the 6.VIII-congenic strain and the NOD control (CO) strain. Our analysis revealed that the Toll-like receptor 1 (Tlr1) gene is strongly down-regulated in thymus and spleen of congenic 6.VIII mice compared with CO mice. Strong Tlr1 down-regulation was detected in macrophages, in which it was associated with the diminished expression of Tnf-{alpha} and IL-6, both known to be controlled by TLR1. In T cells, Tlr1 regulation was associated with lower in vitro proliferation rates of CD4+CD25– and CD4+CD25+ T cells. Decreased levels of IL-6 and low proliferation rates of CD4+CD25+ are known to correlate with increased activity of CD4+CD25+ regulatory T cells (Tregs), one of the subphenotypes previously identified in our studies of the Idd6 congenic NOD.C3H 6.VIII strain. Our data suggest that the Tlr1 pathway is involved in the inflammatory response and the development of T1D controlled by the Idd6 locus.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Congenic mouse strains were as described previously (8, 14). Strains were maintained in our animal house by brother-sister mating. The animal studies were approved by the relevant institutional review boards.

RNA preparation, cDNA synthesis, and microarray analysis

Total RNA from whole tissues, MACS-purified T cells (9),and peritoneal residual macrophages was prepared using RNABle (Eurobio). Random cDNA synthesis was conducted on 10 µg of total RNA using Moloney murine leukemia virus reverse transcriptase (Invitrogen Life Technologies) according to the manufacturer’s conditions. For microarray experiments, RNA quality was examined using an Agilent 2100 Bioanalyzer (Agilent). DNA microarrays (8k mouse cDNA; Agilent) were hybridized using 10 µg of total RNA transcribed in the presence of Cy3-dCTP or Cy5-dCTP, respectively. Data were analyzed using Feature Extraction and Rosetta resolver software and annotated using SOURCE software (provided by the Genetics Department, Stanford University) and Mouse Genomics Informatics and National Center for Biotechnology Information databases.

Quantitative PCR was performed on an Applied Biosystems PRISM 7700 Sequence detector using the SYBR Green PCR Master Mix (PE Biosystems) according to the manufacturer’s conditions. Primers were designed using PrimerExpress software (Applied Biosystems) and used at optimal concentration. Quantification of the amplification product was done using the {Delta}Ct method and Hprt or TCRbeta (for T cells only) as endogenous controls for normalization of the mRNA expression levels. Sequences of the oligonucleotides used were as follows (5'–3'): Tlr1 forward, TCTTCGGCACGTTAGCACTG, Tlr1 reverse, CCAAACCGATCGTAGTGCTGA; Tlr2 forward, TACAGGGATCCGGGTGGTAA, Tlr2 reverse, GCCGAGGCAAGAACAAAGAA; Tlr3 forward, CACGCAGTTCAGCAAGCTATTG, Tlr3 reverse, CGCAAACAGAGTGCATGGTT; Tlr4 forward, GTGATGTGACCATTGATGAGTTCA, Tlr4 reverse, CAGAGACATTGCAGAAACATTCG; Tlr5 forward, CGCTTCGTGTTTTGGACATAAC, Tlr5 reverse, GCCGAACAGGGTGACGTT; Tlr7 forward, ACAGAAATCCCTGAGGGCATT, Tlr7 reverse, TGGTTCAGCCTACGGAAGG A; Tlr8 forward, CACGTGTGACATAAGTGATTTTCG; Tlr8 reverse, TTTGATCCCCAGGATTGGAA; Tlr9 forward, ACAGGCTGTCAATGGCTCTCA, Tlr9 reverse, CACTGAACGATTTCCAGTGGTACA; Il6 forward, CCCAATTTCCAATGCTCTCC, Il6 reverse, CACTCCTTCTGTGACTCCAGCTT; Tnf{alpha} forward, ATGCTGGGACAGTGACCTGG, Tnf{alpha} reverse, CCTTGATGGTGGTGCATGAG; TCRbeta forward, GTTCTTCACCCTGCCATAGATTTT; TCRbeta reverse, TGTCAACGAGGAAGGATGGAT; and Hprt forward, TTGGTGGAGATGATCTCTCAACTT, Hprt reverse, GGTCCTTTTCACCAGCAAGCTT.

Antibodies

The following mAbs were used purified or conjugated to biotin or FITC: anti-CD4 (GK1.5), anti-CD8 (53-6.7), anti-CD25 (7D4), anti-Gr1 (RA3-8C5), anti-B220 (RA3.6B2), anti-Mac-1 (M1/70.15), and anti-Ly76 (TER-119). PE-anti-CD4, -anti-CD19 (1D3), -anti-TCRvbeta4 (KT4), PerCP-anti-CD4 (RM4-5), allophycocyanin-anti-CD4 (RM4-5), and -anti-CD25 (PC61) were purchased from BD Pharmingen Biosciences. Alexa Fluor 647 anti-TLR1 (eBioTR23) was purchased from eBioscience.

Immunofluorescence staining

Cells from thymus, spleen, pancreatic lymph nodes, and peritoneal macrophages were pelleted in 96-well plates and stained for 30 min at 4°C with optimal concentrations of biotin-, PE-, FITC-, PerCP-, or allophycocyanin-labeled reagents in 20 µl of PBS supplemented with 2% FCS and 5 mM sodium azide. Biotin labeling was followed by staining with streptavidin conjugated to the appropriate fluorochrome. Cells were then washed twice and resuspended in PBS containing 1% formaldehyde. Flow cytometric analysis was performed using a FACSCalibur and CellQuest software (BD Biosciences).

Cell proliferation assays

Cell proliferation assays were performed on 96-well plates precoated with 5 µg/ml anti-CD3 Abs using 2.5 x 104 CD4+CD25– or CD4+CD25+ T cells per well. In some cases, cells were costimulated with human (h) IL-2 (20 ng/ml; R&D Systems) and/or palmitoyl-3-cysteine-serine-lysine 4 (Pam3CSK4, 2 µg/ml; InvivoGen). [3H]Thymidine incorporation was measured in triplicate 72 h after treatment for each population and condition. CD4+ cells from spleen and lymph nodes were obtained using the mouse CD4-negative selection kit from Dynal Biotech. CD4+CD25– and CD4+CD25+ T cells were then separated by MACS sorting using biotin-anti-CD25 (7D4) Abs and streptavidin beads. Finally, cells were labeled with streptavidin-PE and anti-Ia-FITC and anti-CD8-allophycyanin Abs before FACS sorting.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
Down-regulation of Tlr1 in the Idd6 NOD.C3H-congenic strain 6.VIII

We recently reported that splenocytes from the diabetes-resistant congenic strain NOD.C3H 6.VIII (6.VIII) confer increased resistance to diabetes when cotransferred to NOD/SCID recipients along with diabetogenic cells. This led to the demonstration that splenocytes, CD4+CD62L+ T cells and CD4+CD25+ are involved in the diabetes protection mediated by C3H alleles at Idd6 (9).

To evaluate the global transcriptional changes mediated by the Idd6-congenic interval, we performed three independent profiling experiments using pooled RNA from spleens of four 8-wk-old prediabetic female mice of each strain on an 8k cDNA microarray set from Agilent (14). Technical replicates were performed for each experiment. 22 down-regulated and 42 up-regulated transcripts (~0.8% of the tested transcripts) were found in the 6.VIII-congenic strain compared with the NOD CO strain in all three experiments (p < 0.05, t test). Highest fold changes were found for the TLR1 (Tlr1) (3.15-fold for CO against 6.VIII, p = 0.0004) and the heat shock protein 1A (Hsp1A) (3-fold for CO against 6.VIII, p = 0.004) genes. All other genes showed average fold changes of <2.5. We did not observe chromosomal or functional clustering of the deregulated genes. This is probably not surprising given that the two mouse strains differ by a 5.8-Mb interval and the complexity of the splenic tissue which contains numerous different cell types (14).

We were able to identify in our data sets several moderately deregulated genes located in the Idd6 interval (Fig. 1B). Among those were the Kras oncogene-associated Sarcospan gene (1.6-fold for CO against 6.VIII), the Idd6.2 candidate gene lymphoid-restricted membrane protein (Lrmp) (1.7-fold for CO against 6.VIII) (15), and the LYR motif containing 5 (Lyrm5) gene (1.4-fold for 6.VIII against CO). Quantitative PCR results have however not confirmed the deregulation of these three genes in the 6.VIII strain (14).


Figure 1
View larger version (56K):
[in this window]
[in a new window]

  		FIGURE 1. A, Description of Idd6, Idd19, and Idd20 loci and chromosome 6 NOD.C3H-congenic and Idd6-subcongenic strains (B) used in this study. C3H-derived intervals are shown as gray bars.

 
When performing three microarray experiments using pools of CD4+-enriched T cells, each obtained from the spleens of six- to ten 8-wk-old females, only five genes and two unclassified transcripts were found to be significantly down-regulated in the 6.VIII strain (Table I). Six transcripts, including five known genes, were up-regulated in the 6.VIII strain compared with the NOD CO strain. Our results suggest that the previously described T cell subphenotypes are not related to global transcriptional changes in nonactivated CD4+ T cells.


View this table:
[in this window]
[in a new window]

  		Table I. Summary of the transcripts (p < 0.05) identified in three microarray experiments using pooled CD4+ T cells from CO and 6.VIII micea

 
Only two of these genes (Table I) appear to be associated with a known T cell-specific function: RhoG is a low-molecular-weight GTPase highly expressed in lymphocytes that activates gene transcription and promotes cytoskeletal reorganization in vitro (16). The Neutrophilic granule protein (Ngp) has been described as a Th2 T cell marker and a possible cytokine (17). Ngp and four other genes (Camp, Ltf, Chi3l3, and Tlr1) that were down-regulated in the 6.VIII strains are all known to be involved in immune response reactions to pathogens. Interestingly, not only the Tlr1 but also the cathelicidin antimicrobial peptide (Camp) and lactotransferrin (Ltf) genes are all involved in TLR-mediated immune responses (18, 19, 20, 21).

The Trl1 gene was the only gene down-regulated in both the 6.VIII spleen (p = 0.0004, ~3-fold) and enriched 6.VIII CD4+ T cells (p = 0.0005, ~2-fold) compared with the CO strain. Because the recent literature has strongly implicated the involvement of other TLR members in autoimmune disease, in particular TLR2 which forms a heterodimer with TLR1, we decided to investigate whether the expression control of the Tlr1 gene, mapping to mouse chromosome 5, is associated with the T1D locus Idd6 on chromosome 6.

Transcriptional down-regulation of Tlr1 is common to Idd6 NOD.C3H-congenic strains

To exclude the possibility that down-regulation of Tlr1 expression in the 6.VIII-congenic strain was due to a mutation in the Tlr1 gene itself, we tested its expression in two other NOD.C3H-congenic strains (6.VII and 6.I; Fig. 1A), both carrying C3H alleles at distal chromosome 6 (8, 22). Our quantitative PCR analysis using spleens and thymi of 8-wk-old females showed that all three Idd6 congenic strains had the same phenotype when compared with the NOD CO-congenic strain (p < 0.0001 in the Mann-Whitney U test; Fig. 2, A and B). Interestingly, the 6.I strain that carries C3H alleles at the Idd19 NOD resistance and at the Idd20 NOD susceptibility loci showed expression levels of Tlr1 comparable to those carrying NOD alleles at Idd19 and Idd20 (6.VIII and 6.VII; p > 0.6). Our results suggest that the Idd19 and Idd20 loci do not influence the control of Tlr1 expression by Idd6. We note however that Idd6 cannot account for the totality of the down-regulation of Tlr1 observed in C3H/HeJ mice (p = 0.01 for 6.VIII against C3H/HeJ, for both spleen and thymus) when compared with NOD CO mice (Fig. 2, A and B).


Figure 2
View larger version (27K):
[in this window]
[in a new window]

  		FIGURE 2. Quantitative Tlr1 expression in spleens and thymi of (A and B) 8-wk- old female mice of NOD CO, different NOD.C3H-congenic strains, and female C3H/HeJ mice (n = 5–8; p < 0.0001 for all groups against CO in the Mann-Whitney U test) and (C and D) of 4-wk-old female 6.VIII-subcongenic strain mice (6.VIII a, b, and c) and controls (n = 6; *, = p < 0.05; **, p < 0.0001). AU, Arbitrary units.

 
We further tested Tlr1 expression in six females of each of three recently constructed Idd6-subcongenic strains (6.VIIIa, b, and c; Fig. 1B) (14). None of the disease-protected subcongenic strains showed significant down-regulation of Tlr1 in spleen comparable to the original 6.VIII strain. Highest statistical significance was however obtained for strain 6.VIIIc (p = 0.04). Analysis of gene expression in thymus confirmed the Tlr1 down-regulation in strain 6.VIIIc (p < 0.0001 compared with the NOD CO strain). The intermediate results obtained for the subcongenic strains suggest that several cis-acting genetic elements within the Idd6 interval may be required for the control of Tlr1 expression in the 6.VIII strain (Fig. 2, C and D). However, the results obtained for 6.VIIIc point to a strong contribution of the 700-kb Idd6.3 interval (Fig. 1), recently shown to be associated with diabetes resistance in splenocyte transfer experiments.

Age-dependent expression differences of Tlr1

We next studied the effect of age on Tlr1 expression in NOD control and 6.VIII strain mice. Quantitative PCR on spleen and thymus samples from female animals showed that on average Tlr1 expression was increased in the CO mice compared with 6.VIII animals at 4, 8, and 15 wk of age (p < 0.02 for all ages and tissues; Fig. 3, A and B). The analysis of the thymus suggests that the differences in Tlr1 expression are not restricted to the peripheral immune system, although Tlr1 expression levels appear in general much lower in the thymus than in the spleen. Our result also suggests that Tlr1 expression increases with age (p < 0.002 for comparison of both CO spleen and thymus at 4 and 15 wk). Tlr1 expression also becomes more variable with age and the differences between the two strains tend to become less marked. For example, in thymus the average fold change of 3,1 at 4 wk of age drops to 2.4 at 15 wk of age. Similarly, while at 4 wk of age the average difference in spleen is ~2.2-fold, it is only 1.7-fold at 15 wk of age. This finding may correlate with our previous finding that splenocytes from >15-wk-old 6.VIII mice are as diabetogenic as those from NOD CO mice while significant differences in diabetes protection are found with splenocytes from <8-wk-old 6.VIII mice compared with young NOD CO mice (9).


Figure 3
View larger version (21K):
[in this window]
[in a new window]

  		FIGURE 3. Summary of Tlr1 PCR quantification at 4, 8, and 15 wk of age in spleen (A) and thymus (B) of female 6.VIII (Figure 3) and NOD CO mice (•). p < 0.02 in Mann-Whitney U test for 6.VIII against CO at all ages. AU, Arbitrary units; n, number of animals.

 
Expression analysis of other members of the Tlr family

We tested whether down-regulation of Tlr1 in the congenic strain 6.VIII was specific to this member of the Tlr gene family by performing quantitative PCR on eight other family members using spleen and thymus of six 4-wk-old female mice (Table II). We detected only small expression differences (less than average fold change 1.7) for most Tlr genes. In no case was the deregulation as marked as that for Tlr1 (2.2-fold in spleen and 3.1-fold in thymus).


View this table:
[in this window]
[in a new window]

  		Table II. Quantitative expression analysis of Tlr genes compared to the Hprt reporter gene in splenocyte and thymocyte samples of 4-wk-old micea

 
When three independent pools of RNA of enriched CD4+ T and CD8+ T cell subsets were tested (each pool was obtained from five to ten 8-wk-old female mice and tested in two replicates), we detected an average difference for Tlr1 that was >4-fold for CD4+ T cells. No other Tlr family members were strongly down-regulated in 6.VIII CD4+ T cells, except for Tlr9 (2-fold). Statistical analysis on CD4+ T and CD8+ T cell subsets from individual female mice confirmed significant down-regulation solely for Tlr1 (p = 0.017 for Tlr1 and p > 0.18 for all other genes in both CD4+ T and CD8+ T cell populations; Mann-Whitney U test).

Tlr1 was strongly down-regulated in 6.VIII macrophages (n = 6, 3.2-fold; Table II). The down-regulation of Tlr5, Tlr6, and Tlr9 was also found to be significant albeit at lower levels (≤ 2.2-fold). When pooled RNA from four different mice was examined, the down-regulation of Tlr1 (5.1-fold; Fig. 4) and Tlr9 (1.7-fold) in CO macrophages could be confirmed, whereas that of Tlr5 (1.0-fold) and Tlr6 (1.2-fold) could not.


Figure 4
View larger version (34K):
[in this window]
[in a new window]

  		FIGURE 4. A, FACS analysis of TLR1 protein expression in CD11b+ macrophages isolated from spleen (>3,000 cells), PLNs, and peritoneum (>15,000 cells) of 8-wk-old female mice (n = 5). Anti-hCD8 was used for isotypic control. Values correspond to percentages ± SD; p values were obtained using the Mann-Whitney U test. Graphs show data for one representative individual of the five in each group. B, Quantitative PCR analysis of Tlr1, Il6, and Tnf-{alpha} expression in peritoneal macrophages from four 4-wk-old 6.VIII and CO mice ± SD (Hprt reporter gene). AU, Arbitrary units; FC, fold change. *, Differences for Tlr1 (p < 0.032) and Il6 (p < 0.0001) were significant in a second experiment using five individual animals (Mann-Whitney U test).

 
Our results indicate that Idd6 probably does not influence an overall mechanism that is common to the regulation of the entire Tlr family, but rather acts specifically on Tlr1 regulation with variations according to cell type and tissue.

Tissue-dependent expression of TLR1 protein in macrophages

The TLR1 has been shown to be expressed mainly in myeloid cells (23). In agreement with these data, both strong general Tlr1 expression and expression differences for Tlr1 were observed between NOD CO and 6.VIII macrophages. FACS analysis confirmed the results obtained by quantitative RT-PCR and showed that TLR1 protein expression was much lower in 6.VIII macrophage cell populations than in NOD CO macrophages (Fig. 4). Interestingly, this difference was stronger in peritoneal macrophages and macrophages isolated from pancreatic lymph nodes (PLNs) than in those isolated from spleen (p < 0.01 in the Mann-Whitney U test). We also noticed that there were more macrophages expressing high TLR1 levels in PLNs and the peritoneum than in the spleen. This result may indicate that TLR1 expression levels in macrophages depend on their tissue of origin.

Recently, macrophages from Tlr1-deficient mice stimulated with mycobacteria or with a mycobacterial 19-kDa lipoprotein were shown to have impaired production of TNF-{alpha} and IL-6 (24). We therefore tested whether the constitutive down-regulation of Tlr1 that we observed in the Idd6-congenic strain 6.VIII was associated with down-regulation of Tnf-{alpha} and Il6 expression using RNA pooled from four mice (Fig. 4). In this experiment, both genes were found to be down-regulated in peritoneal macrophages, and the Il6 down-regulation was particularly striking. The data were confirmed using RNA from five individual mice with a p value of 0.095 for Tnf-{alpha} and p < 0.0001 for Il6. Because high levels of IL-6 can block immunosuppression mediated by CD4+CD25+ T cells (25, 26), the Tlr1 and Il6 down-regulation could be of some advantage to the activity of 6.VIII-derived CD4+CD25+ T cells (9).

Idd6 controls T cell proliferation and Tlr1 down-regulation affects T cell proliferation

Previous in vivo results have shown that the Idd6 locus affects the proliferation rates of T cells in the thymus (13). Our own unpublished results point to a more widespread control of T cell proliferation occurring in other tissues such as PLNs. This can be shown by in vivo proliferation assays using Ag-specific CD4+CD25– T cells from PLNs of NOD.BDC 2.5 mice, which show significantly higher proliferation rates in the PLNs of injected NOD CO mice than in PLNs of injected 6.VIII mice. Control of T cell proliferation could be mediated by cell-intrinsic factors as well as by extrinsic factors.

Idd6 also affects the activity of regulatory CD4+CD25+ T cells in the peripheral immune system (9) and extrinsically controlled down-regulation of T cell proliferation could, at least in part, be due to the higher activity of Tregs in 6.VIII mice. The TLR2 pathway has recently been implicated in the regulation of proliferation rates and activity of CD4+CD25+ Tregs (27). Because TLR1 dimerizes with TLR2, we studied whether Tlr1 down-regulation in 6.VIII mice affects T cell proliferation (Fig. 5). Both FACS-sorted CD4+CD25– and CD4+CD25+ T cells were stimulated in vitro by anti-CD3 Abs in the presence or absence of hIL-2 and/or the TLR2 ligand Pam3CSK4. No general deficiency in T cell activation was observed and neither the TCR pathway nor the IL-2 pathway was significantly affected. The TLR1/TLR2 pathway was however strongly affected and proliferation was down-regulated in both 6.VIII CD4+ T cell subsets. This effect could not be overcome by additional stimulation of the IL-2-mediated pathway.


Figure 5
View larger version (15K):
[in this window]
[in a new window]

  		FIGURE 5. CD4+CD25– (A) and CD4+CD25+ (B) T cells from pooled spleens and lymph nodes of CO (dark bars) and 6.VIII mice (light bars) were stimulated with anti-CD3 plus Pam3CSK4 and/or hIL-2. Data from three independent experiments using three different pools of cells from six to eight 8-wk-old female mice are expressed as means ± SEM. Statistical evaluation of the experiments by unpaired t test: *, p < 0.05; **, p < 0.01; ***, p < 0.005. The cpm values represent [3H]thymidine incorporation after 72 h of culture. Cells from CO mice were more responsive to Pam3CSK4 than those of 6.VIII mice.

 
Our data suggest that the down-regulation of Tlr1 is associated with lowered proliferation of stimulated CD4+ T cells. In the case of pathogenic CD4–CD25– T cells, this may contribute to a increased basal immune activation threshold in 6.VIII mice. Because rapid cellular expansion diminishes their immunoregulatory function, the lower proliferation rates of CD4+CD25+ T cells might allow these cells to maintain their suppressor activity for longer (27).


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
T1D results from the autoimmune destruction of insulin-producing pancreatic beta cells. A widely accepted scheme for defective autoimmunity postulates that environmental factors somehow foul up the immune system by triggering the activation and expansion of autoreactive lymphocytes. Although the role of environmental factors in modulating diabetes development has been clearly established for many experimental models of T1D, the role of a unique triggering event, however, is still disputable. T1D is a multifactorial disease in which environmental factors concur with a highly multigenic susceptibility background to allow the escape from immune tolerance of islet beta cells. A possible hypothesis is that numerous genes assemble to contribute to the stochastic activation of the autoimmune reaction to beta cells. Immune activation through TLRs might be expected to contribute to the overall immune activation of this complex genetic set up, irrespective of whether the activation is provoked by internal or external ligands. Our data open up the possibility that the TLR1 is one such contributing factor.

Members of the TLR family are involved in early responses to pathogens that allow the activation of the immune system via a NF-{kappa}B-dependent pathway. Some of these receptors are known to be involved in autoimmune diseases and especially in their initial triggering, either through direct responses to pathogens such as viruses within a target tissue (5) or through activation by endogenous ligands such as necrotic cells, DNA, or RNA in systemic autoimmune diseases (5).

TLR1 is involved in the innate immune responses to the outer surface lipoprotein A of the Lyme disease pathogen Borrelia burgdorferi (28). Activation and regulation of TLR1 has also been confirmed to have a role in human leprosy. TLR1 can form heterodimers with TLR2 that are responsible for the cellular activation mediated by Mycobacterium leprae and triacylated lipoproteins (29). Macrophages from Tlr1-deficient mice stimulated with mycobacteria or with a mycobacterial 19-kDa lipoprotein show impaired production of TNF-{alpha} and IL-6 (24) due to deficiencies in the NF-{kappa}B activation pathway. The importance of the TNF-{alpha} and IL-6 molecules in the regulation of the immune system may be supportive of a role of TLR1 in autoimmune disease.

The T1D-associated Idd6 locus overlaps with two other autoimmune loci, including the experimental autoimmune myocarditis locus Eamcd2 (30) and the lupus susceptibility locus Lbw4 (31, 32). We previously showed that Idd6 is capable of modulating the activity of regulatory CD4+CD25+ T cells (Tregs). The regulatory function of this cell population is known to be mediated by cell-intrinsic factors, such as the transcription factor Foxp3 (33), and to be dependent on interaction with APCs and soluble molecules. In particular, IL-6 has been shown to override the suppressive effects of CD4+CD25+ Tregs (34). The constitutive low Il6 expression observed for 6.VIII strain macrophages correlates with this finding and the observation of enhanced activity of this Treg population in 6.VIII mice. Recently, it has been shown that the expansion and suppressive activity of CD4+CD25+ Tregs is directly controlled by TLR2. TLR2-deficient mice contain significantly fewer Tregs, and administering TLR2 ligands to wild-type mice results in increased Treg numbers. In the presence of TLR2 ligand, the suppressive phenotype of Tregs is temporarily abrogated, thereby enabling the enhancement of the immune response in vitro and in vivo. Following removal of the TLR2 trigger, in vitro-expanded Tregs then fully regain their phenotype and suppressive capabilities (35). These data establish a direct link between TLRs and the control of immune responses through Tregs. Such findings and our present results lead us to suggest that the TLR1/TLR2 pathway may be involved in the Idd6 Treg phenotype. This hypothesis is also supported by the finding that the Idd6.3 subinterval contributes strongly to the Tlr1 expression phenotype. Idd6.3 has recently been shown to control diabetes resistance in splenocyte transfer assays and to contain the T1D candidate gene Arntl2 which is expressed in CD4+CD25+ T cells (14). A possible link between Arntl2 and Tlr1 remains to be demonstrated.

Involvement of the TLR1-NF-{kappa}B pathway is also of interest for several other subphenotypes that are associated with Idd6, since apoptosis and proliferation phenotypes are often related to the NF-{kappa}B pathway. This hypothesis becomes more likely as we observed the regulation of T cell proliferation by the TLR1/TLR2 pathway. Taken together, the ubiquitous down-regulation of Tlr1 could be involved in the development of various cellular phenotypes that have been associated with Idd6. Because the Idd6 interval contains no genes known to contribute directly to the TLR1 pathway or TLR1 activity, functional analysis of the Idd6 gene content will be required to identify the novel components of Tlr1 expression regulation. More complete understanding of the implication of TLR1 in autoimmune disease and T1D will certainly depend on the availability of transgenic animals models on the disease relevant genetic background.


   Acknowledgments
 
We thank Françoise Lepault and Marie-Claude Gagnerault for excellent technical advice and assistance.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by grants from the Juvenile Diabetes Research Foundation International (1-2000-600), Agence National de la Recherche, and Association pour la Recherche sur le Diabète and recurrent funding from the Centre National de la Recherche Scientifique, Institut National de la Santé et de la Recherche Médicale, and Pasteur Institute. Back

2 Current address: Max Planck Institute for Molecular Genetics, Ihnestrasse 63-73, Berlin, Germany. Back

3 Address correspondence and reprint requests to Dr. Ute C. Rogner, Génétique Moléculaire Murine Centre National de la Recherche Scientifique, Unité de Recherche Associée 2578, Institut Pasteur, 25 rue du Docteur Roux, Paris, France. E-mail address: urogner{at}pasteur.fr Back

4 Abbreviations used in this paper: T1D, type 1 diabetes; CO, control; h, human; Pam3CSK4, palmitoyl-3-cysteine-serine-lysine 4; PLN, pancreatic lymph node; Treg, regulatory T cell. Back

Received for publication February 16, 2007. Accepted for publication July 10, 2007.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Krieg, A. M.. 2002. A role for Toll in autoimmunity. Nat. Immunol. 3: 423-424. [Medline]
  2. Boule, M. W., C. Broughton, F. Mackay, S. Akira, A. Marshak-Rothstein, I. R. Rifkin. 2004. Toll-like receptor 9-dependent and -independent dendritic cell activation by chromatin-immunoglobulin G complexes. J. Exp. Med. 199: 1631-1640. [Abstract/Free Full Text]
  3. Berland, R., L. Fernandez, E. Kari, J. H. Han, I. Lomakin, S. Akira, H. H. Wortis, J. F. Kearney, A. A. Ucci, T. Imanishi-Kari. 2006. Toll-like receptor 7-dependent loss of B cell tolerance in pathogenic autoantibody knockin mice. Immunity 25: 429-440. [Medline]
  4. Christensen, S. R., J. Shupe, K. Nickerson, M. Kashgarian, R. A. Flavell, M. J. Shlomchik. 2006. Toll-like receptor 7 and TLR9 dictate autoantibody specificity and have opposing inflammatory and regulatory roles in a murine model of lupus. Immunity 25: 417-428. [Medline]
  5. Lang, K. S., M. Recher, T. Junt, A. A. Navarini, N. L. Harris, S. Freigang, B. Odermatt, C. Conrad, L. M. Ittner, S. Bauer, et al 2005. Toll-like receptor engagement converts T-cell autoreactivity into overt autoimmune disease. Nat. Med. 11: 138-145. [Medline]
  6. Makino, S., K. Kunimoto, Y. Muraoka, Y. Mizushima, K. Katagiri, Y. Tochino. 1980. Breeding of a non-obese, diabetic strain of mice. Jikken Dobutsu. 29: 1-13. [Medline]
  7. Hattori, M., J. B. Buse, R. A. Jackson, L. Glimcher, M. E. Dorf, M. Minami, S. Makino, K. Moriwaki, H. Kuzuya, H. Imura, et al 1986. The NOD mouse: recessive diabetogenic gene in the major histocompatibility complex. Science 231: 733-735. [Abstract/Free Full Text]
  8. Rogner, U. C., C. Boitard, J. Morin, E. Melanitou, P. Avner. 2001. Three loci on mouse chromosome 6 influence onset and final incidence of type I diabetes in NOD.C3H congenic strains. Genomics 74: 163-171. [Medline]
  9. Rogner, U. C., F. Lepault, M. C. Gagnerault, D. Vallois, J. Morin, P. Avner, C. Boitard. 2006. The diabetes type 1 locus Idd6 modulates activity of CD4+CD25+ regulatory T-cells. Diabetes 55: 186-192. [Abstract/Free Full Text]
  10. Leijon, K., B. Hammarstrom, D. Holmberg. 1994. Non-obese diabetic (NOD) mice display enhanced immune responses and prolonged survival of lymphoid cells. Int. Immunol. 6: 339-345. [Abstract/Free Full Text]
  11. Penha-Goncalves, C., K. Leijon, L. Persson, D. Holmberg. 1995. Type 1 diabetes and the control of dexamethasone-induced apoptosis in mice maps to the same region on chromosome 6. Genomics 28: 398-404. [Medline]
  12. Bergman, M. L., N. Duarte, S. Campino, M. Lundholm, V. Motta, K. Lejon, C. Penha-Goncalves, D. Holmberg. 2003. Diabetes protection and restoration of thymocyte apoptosis in NOD Idd6 congenic strains. Diabetes 52: 1677-1682. [Abstract/Free Full Text]
  13. Bergman, M. L., C. Penha-Goncalves, K. Lejon, D. Holmberg. 2001. Low rate of proliferation in immature thymocytes of the non-obese diabetic mouse maps to the Idd6 diabetes susceptibility region. Diabetologia 44: 1054-1061. [Medline]
  14. Hung, M. S., P. Avner, U. C. Rogner. 2006. Identification of the transcription factor Arntl2 as a candidate gene for the type 1 diabetes locus Idd6. Hum. Mol. Genet. 15: 2732-2742. [Abstract/Free Full Text]
  15. Duarte, N., M. Lundholm, D. Holmberg. 2007. The Idd6.2 diabetes susceptibility region controls defective expression of the Lrmp gene in nonobese diabetic (NOD) mice. Immunogenetics 59: 407-416. [Medline]
  16. Vigorito, E., S. Bell, B. J. Hebeis, H. Reynolds, S. McAdam, P. C. Emson, A. McKenzie, M. Turner. 2004. Immunological function in mice lacking the Rac-related GTPase RhoG. Mol. Cell. Biol. 24: 719-729. [Abstract/Free Full Text]
  17. Xie, D., Z. Liu, Z. Li, Y. Ji, J. Chen, B. Sun. 2007. Differential expression of neutrophilic granule proteins between Th1 and Th2 cells. Acta Biochim. Biophys. Sin. 39: 67-72. [Medline]
  18. Wang, T. T., F. P. Nestel, V. Bourdeau, Y. Nagai, Q. Wang, J. Liao, L. Tavera-Mendoza, R. Lin, J. W. Hanrahan, S. Mader, J. H. White. 2004. Cutting edge: 1,25-Dihydroxyvitamin D3 is a direct inducer of antimicrobial peptide gene expression. J. Immunol. 173: 2909-2912. [Abstract/Free Full Text]
  19. Na, Y. J., S. B. Han, J. S. Kang, Y. D. Yoon, S. K. Park, H. M. Kim, K. H. Yang, C. O. Joe. 2004. Lactoferrin works as a new LPS-binding protein in inflammatory activation of macrophages. Int. Immunopharmacol. 4: 1187-1199. [Medline]
  20. Liu, P. T., S. Stenger, H. Li, L. Wenzel, B. H. Tan, S. R. Krutzik, M. T. Ochoa, J. Schauber, K. Wu, C. Meinken, et al 2006. Toll-like receptor triggering of a vitamin D-mediated human antimicrobial response. Science 311: 1770-1773. [Abstract/Free Full Text]
  21. Curran, C. S., K. P. Demick, J. M. Mansfield. 2006. Lactoferrin activates macrophages via TLR4-dependent and -independent signaling pathways. Cell. Immunol. 242: 23-30. [Medline]
  22. Morin, J., C. Boitard, D. Vallois, P. Avner, U. C. Rogner. 2006. Mapping of the murine type 1 diabetes locus Idd20 by genetic interaction. Mamm. Genome 17: 1105-1112. [Medline]
  23. Ochoa, M. T., A. J. Legaspi, Z. Hatziris, P. J. Godowski, R. L. Modlin, P. A. Sieling. 2003. Distribution of Toll-like receptor 1 and Toll-like receptor 2 in human lymphoid tissue. Immunology 108: 10-15. [Medline]
  24. Takeuchi, O., S. Sato, T. Horiuchi, K. Hoshino, K. Takeda, Z. Dong, R. L. Modlin, S. Akira. 2002. Cutting edge: role of Toll-like receptor 1 in mediating immune response to microbial lipoproteins. J. Immunol. 169: 10-14. [Abstract/Free Full Text]
  25. Pasare, C., R. Medzhitov. 2003. Toll pathway-dependent blockade of CD4+CD25+ T cell-mediated suppression by dendritic cells. Science 299: 1033-1036. [Abstract/Free Full Text]
  26. Wan, S., C. Xia, L. Morel. 2007. IL-6 produced by dendritic cells from lupus-prone mice inhibits CD4+CD25+ T cell regulatory functions. J. Immunol. 178: 271-279. [Abstract/Free Full Text]
  27. Liu, H., M. Komai-Koma, D. Xu, F. Y. Liew. 2006. Toll-like receptor 2 signaling modulates the functions of CD4+CD25+ regulatory T cells. Proc. Natl. Acad. Sci. USA 103: 7048-7053. [Abstract/Free Full Text]
  28. Alexopoulou, L., V. Thomas, M. Schnare, Y. Lobet, J. Anguita, R. T. Schoen, R. Medzhitov, E. Fikrig, R. A. Flavell. 2002. Hyporesponsiveness to vaccination with Borrelia burgdorferi OspA in humans and in TLR1- and TLR2-deficient mice. Nat. Med. 8: 878-884. [Medline]
  29. Krutzik, S. R., M. T. Ochoa, P. A. Sieling, S. Uematsu, Y. W. Ng, A. Legaspi, P. T. Liu, S. T. Cole, P. J. Godowski, Y. Maeda, et al 2003. Activation and regulation of Toll-like receptors 2 and 1 in human leprosy. Nat. Med. 9: 525-532. [Medline]
  30. Guler, M. L., D. L. Ligons, Y. Wang, M. Bianco, K. W. Broman, N. R. Rose. 2005. Two autoimmune diabetes loci influencing T cell apoptosis control susceptibility to experimental autoimmune myocarditis. J. Immunol. 174: 2167-2173. [Abstract/Free Full Text]
  31. Kono, D. H., R. W. Burlingame, D. G. Owens, A. Kuramochi, R. S. Balderas, D. Balomenos, A. N. Theofilopoulos. 1994. Lupus susceptibility loci in New Zealand mice. Proc. Natl. Acad. Sci. USA 91: 10168-10172. [Abstract/Free Full Text]
  32. Kono, D. H., A. N. Theofilopoulos. 2000. Genetics of systemic autoimmunity in mouse models of lupus. Int. Rev. Immunol. 19: 367-387. [Medline]
  33. Fontenot, J. D., M. A. Gavin, A. Y. Rudensky, S. Hori, T. Nomura, S. Sakaguchi. 2003. Foxp3 programs the development and function of CD4+CD25+ regulatory T cells. Nat. Immunol. 4: 330-336. [Medline]
  34. Kubo, T., R. D. Hatton, J. Oliver, X. Liu, C. O. Elson, C. T. Weaver. 2004. Regulatory T cell suppression and anergy are differentially regulated by proinflammatory cytokines produced by TLR-activated dendritic cells. J. Immunol. 173: 7249-7258. [Abstract/Free Full Text]
  35. Sutmuller, R. P., M. H. den Brok, M. Kramer, E. J. Bennink, L. W. Toonen, B. J. Kullberg, L. A. Joosten, S. Akira, M. G. Netea, G. J. Adema. 2006. Toll-like receptor 2 controls expansion and function of regulatory T cells. J. Clin. Invest. 116: 485-494. [Medline]



This article has been cited by other articles:


Home page
 Endocr. Rev.Home page
X. Huang, D. J. Moore, R. J. Ketchum, C. S. Nunemaker, B. Kovatchev, A. L. McCall, and K. L. Brayman
Resolving the Conundrum of Islet Transplantation by Linking Metabolic Dysregulation, Inflammation, and Immune Regulation
Endocr. Rev., August 1, 2008; 29(5): 603 - 630.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vallois, D.
Right arrow Articles by Rogner, U. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vallois, D.
Right arrow Articles by Rogner, U. C.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS