The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

The Journal of Immunology, 2007, 179, 3504-3514
Copyright © 2007 by The American Association of Immunologists, Inc.
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Saurer, L.
Right arrow Articles by Summerfield, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Saurer, L.
Right arrow Articles by Summerfield, A.

In Vitro Induction of Mucosa-Type Dendritic Cells by All-Trans Retinoic Acid1

Leslie Saurer2, Kenneth C. McCullough and Artur Summerfield

Institute of Virology and Immunoprophylaxis, Mittelhäusern, Switzerland


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Efficient induction of mucosal immunity usually employs nasal or oral vaccination while parenteral immunization generally is ineffective at generating mucosal immune responses. This relates to the unique ability of resident mucosal dendritic cells (DC) to induce IgA switching and to imprint mucosa-specific homing receptors on lymphocytes. Based on the well-established plasticity of the DC system, this study sought to investigate whether peripheral DC could be modulated toward "mucosa-type" DC by treatment with immunomodulatory, and therefore potentially adjuvant-like, factors. In this study, we show that monocyte-derived DCs pretreated with the vitamin A derivative all-trans retinoic acid (RA) indeed acquired several attributes characteristic of mucosal DC: secretion of TGF-beta and IL-6 and the capacity to augment mucosal homing receptor expression and IgA responses in cocultured lymphocytes. Addition of a TGF-beta-neutralizing Ab to cocultures significantly inhibited {alpha}4beta7 integrin, but not CCR9 mRNA expression by the lymphocytes. Both {alpha}4beta7 integrin and CCR9 mRNA expression, but not IgA production, were suppressed in the presence of a RA receptor antagonist. None of the observed effects on the lymphocytes were influenced by citral, a retinal dehydrogenase inhibitor, arguing against a role for de novo-synthesized RA. Collectively, our findings identified a novel role for RA as a mucosal immune modulator targeting DC. Our results further demonstrate that DC can act as efficient carriers of RA at least in vitro. Consequently, RA targeting of DC shows potential for promoting vaccine-induced mucosal immune responses via a parenteral route of immunization.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
With most infectious agents invading the host via mucosal surfaces, there is a strong demand for vaccines with the potential to induce mucosal immunity. The development of such vaccines has been impeded by the fact that the well-characterized route of parenteral immunization is generally ineffective at eliciting mucosal immune responses. Moreover, oral or nasal application of vaccines requires higher Ag payloads and novel adjuvants, which need to be both effective and safe to use (1, 2).

Accumulating evidence suggests that the long-observed compartmentalization of mucosal and systemic immune responses is mainly based on the selective expression of homing receptors by lymphocytes. These receptors target effector and memory cells to specific ligands expressed in the corresponding extralymphoid site of original Ag encounter (3). Accordingly, lymphocytes primed in Peyer’s patches or mesenteric lymph nodes (MLN)3 will acquire expression of the integrin {alpha}4beta7 and the chemokine receptor CCR9. They will localize to the small intestinal mucosa where their appropriate ligands—mucosal addressin cell adhesion molecule-1 and CCL25 (TECK)—are expressed by postcapillary venules and intestinal epithelial cells, respectively. In contrast, effector T cells trafficking to inflamed skin are devoid of {alpha}4beta7 and CCR9. Instead, they express ligands for vascular P- and E- selectins and the chemokine receptors CCR4 and/or CCR10. A number of studies have demonstrated an important role for resident dendritic cells (DC) in instructing naive lymphocytes to express the appropriate homing receptor profile (4, 5, 6). DC isolated from Peyer’s patches or MLN were necessary and sufficient to induce {alpha}4beta7 and CCR9 expression in cocultured T or B cells in vitro. In contrast, DC from peripheral lymph nodes only promoted expression of P- and E-selectin ligands. The ability of intestinal DC to promote gut-tropic lymphocytes was assigned to their unique expression of retinoid hydrogenase enzymes converting dietary vitamin A to retinoic acid (RA), which was shown to directly up-regulate {alpha}4beta7 and CCR9 expression on T cells (7). Importantly, in addition to this modulation of the homing properties of lymphocytes to mucosal sites, gut DC-derived RA—in combination with IL-6 or IL-5 and other yet unknown factors—was also identified as an important mediator of IgA secretion in B cells (8). Furthermore, a recent report associated the presence of the integrin {alpha}E chain (CD103) on lamina propria (LP) DC and a subset of MLN DC with their capacity to up-regulate CCR9 in T cells (9).

Nonetheless, several studies suggest that the ability of intestinal DC to confer gut tropism to T cells must not necessarily be the attribute of a specialized, distinct, and tissue-restricted DC subset (5, 6, 10, 11, 12). Indeed, injection of in vitro bone marrow-derived "neutral" DC into mice induced skin-homing and gut-homing receptors, which was dependent on the route of administration: intracutaneous or i.p., respectively (10). Moreover, i.p. injection of Ag-pulsed DC preferentially up-regulated {alpha}4beta7 expression on adoptively transferred T cells, irrespective of the DC origin: MLN or peripheral lymph nodes (11). These experiments indicate a dominant role for the local tissue environment in shaping the mucosal imprinting capacity of DC. Such a flexibility is certainly known for DC, being reminiscent of the Th1, Th2, or T regulatory cell polarizing ability they can adopt following exposure to particular cytokine and microbial signals (13). Based on this well-recognized plasticity of the DC system, the present study sought to investigate whether peripheral DC could be modulated toward "mucosa-type" DC by targeting with immunomodulatory and therefore potentially adjuvant-like factors.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Animals

Specific pathogen-free Swiss White Landrace pigs were kept at the institute and used as blood donors. For Ag-specific (re)stimulation assays, some of the pigs had received repeated vaccinations with inactivated foot-and-mouth disease virus (FMDV) type O1 Lausanne Ag (provided by Dr. P. Barnett, Institute for Animal Health, Pirbright, U.K.) formulated in Montanide 20 (donated by Seppic, Paris, France). Vaccinations and regular bleeding were performed in compliance with the regulations approved by the local committee for animal experimentation.

Generation and differential treatment of monocyte-derived DCs (MoDC)

PBMC were isolated from citrated blood of pigs by Ficoll-Paque (1.077 g/L; Amersham Pharmacia Biotech) density centrifugation. CD172a+ monocytes were isolated using the mAb 74-22-15 (American Type Culture Collection) plus MACS separation system (Miltenyi Biotec), and cultured in DMEM (Invitrogen Life Technologies) supplemented with 10% v/v porcine serum (Sigma-Aldrich), 100 U/ml recombinant porcine GM-CSF (provided by Dr. S. Inumaru, Institute for Animal Health, Ibaraki, Japan) and 100 U/ml recombinant porcine IL-4 (prepared in our laboratory) as described previously (14). MoDC were fed on day 3 of culture by addition of fresh medium containing GM-CSF and IL-4. On day 4 of culture, when nonadherent cells with the morphology of immature DC dominated, the MoDC were treated for an additional 48 h with the immunomodulatory factors including: porcine TNF-{alpha} (prepared from TNF-{alpha}-expressing L929 cells provided by Dr. G. Bertoni, University of Bern, Switzerland (15)), heat-labile enterotoxin (LT; provided by Berna Biotech, Bern, Switzerland), P3CSK4 (Pam3Cys; provided by Dr. K. H. Wiesmüller, EMC Microcollections, Tübingen, Germany), Escherichia coli-derived LPS, polyinosine-polycytodolic acid (pIC), 1{alpha},25-dihydroxyvitamin D3 (VitD3), all-trans RA, retinol (Ret) (all reagents obtained from Sigma-Aldrich, unless specified differently). On day 6 of culture, treated MoDC were used for phenotyping or coculture experiments, as described below.

Isolation and CFSE labeling of lymphocytes

Lymphocytes were isolated from freshly prepared PBMC by depletion of CD172a+ cells using the MACS system and LD columns (for additional depletion of CD172alow APC). For some experiments, lymphocytes were labeled with CFSE (Molecular Probes). Briefly, CD172– cells were resuspended at 1 x 107 cells/ml in PBS and incubated with 5 µM CFSE for 10 min at 39°C. Lymphocytes were washed three times in DMEM 10% v/v FBS (Invitrogen Life Technologies) and used in cocultures with autologous MoDC which had received the different treatments mentioned above.

MoDC-lymphocyte cocultures

For superantigen-dependent T cell activation, MoDC were loaded with 1 µg/ml staphylococcal enterotoxin B (SEB; Toxin Technology) for 1 h at 39°C, washed four times and cultured at 2 x 104 cells/well with CFSE-labeled lymphocytes (2 x 105/well) in DMEM 10% v/v FBS in 96-well U-bottom plates (Costar) in replicates of three to five wells. On day 4 of culture, cells were harvested and stained for the beta7 integrin with the anti-mouse (anti-porcine cross-reactive) mAb FIB27 (BD Biosciences) and an anti-rat IgG PE-conjugated goat F(ab')2 Ig (Southern Biotechnology Associates). In some experiments, cells were additionally stained for {alpha}4 integrin chain expression with the mAb L25 (BD Biosciences). Proliferation (as based on CFSE profile) and integrin expression was assessed by flow cytometry (FCM) using a FACSCalibur with the CellQuest pro software (both BD Biosciences). In some of the experiments, MoDC were fixed with 1% w/v paraformaldehyde (PFA) for 15 min after SEB loading.

For FMDV-specific T cell activation, differentially treated 6-day-old MoDC were washed four times and cocultured with lymphocytes (5 x 106/well) at a 1:10 ratio of MoDC to CD172– lymphocytes in 24-well plates (Costar) with inactivated FMDV as Ag. To this end, FMDV O1 Lausanne was propagated in BHK-21 cells and inactivated by exposure to UV light, as described previously (16, 17). beta7 integrin expression was assessed on day 5 of culture using the mAb FIB27 and mAbs against porcine CD4 (74-12-4) and CD8 (11-295-33) (hybridomas provided by Dr. A. Saalmüller, Veterinary University, Vienna, Austria) to allow for gating on the FMDV-responsive CD4+CD8+ porcine memory Th population (18, 19). In some experiments, MoDC were separated from lymphocytes by a 0.4 µM pore-size cell culture insert (BD Biosciences).

Addition/neutralization of cytokines and inhibition of RA pathways in cocultures

For neutralization of TGF-beta in cocultures, a pan-TGF-beta (1, 2, 3) mAb (mAb 1835; R&D Systems) was used and purified mouse IgG1 (Sigma-Aldrich) was used as an isotype-matched control. Neutralization of IL-6 used an anti-porcine polyclonal Ab (AF686; R&D Systems). Recombinant porcine IL-6 was also obtained from R&D Systems. The RA receptor {alpha} (RAR{alpha}) antagonist Ro-41-5253 and the retinal dehydrogenase inhibitor citral were obtained from Biomol and Sigma-Aldrich, respectively.

Phenotyping of MoDC

MoDC cell surface expression of MHC class II and CD80/86 was assessed by FCM using the mAb MSA3 (donated by A. Saalmüller) and a human CTLA4-mouse-Ig fusion protein (Alexis), respectively, followed by anti-mouse isotype-specific PE-conjugated goat F(ab')2 Igs (Southern Biotechnology Associates). Endocytic activity (primarily macropinocytosis) of MoDC was evaluated by incubation of the cells with 10 µg/ml OVA-dQ (Molecular Probes) in serum-free medium for 1 h at 39°C. OVA-dQ acquires fluorescence after dequenching through proteolytic enzyme cleavage, permitting the analyses of both Ag uptake and processing by FCM. As control, the uptake at 4°C was analyzed and mean fluorescence intensity (MFI) values were subtracted from the 39°C values.

RNA extraction and quantitative TaqMan RT-PCR for porcine CCR9

SEB-stimulated MoDC/lymphocyte cocultures (pool of five replicate wells for each coculture) or FMDV-stimulated cocultures were harvested on days 4 and 5 of culture, respectively. RNA was extracted using the Nucleospin RNA II Extraction kit (Macherey Nagel) according to manufacturers’ instructions. Four microliters of RNA was reversed transcribed in a final reaction volume of 40 µl with RNasin (32 U), dNTPs (2.5 µM final each; both Promega), buffer A, MgCl2 (25 mM final), Multiscribe RT (50 U) (all Applied Biosystems), and random hexamers (25 µM final; Pharmacia). The reaction was allowed to proceed for 30 min at 48°C and stopped by incubation for 10 min at 95°C. Four microliters of cDNA in a final reaction volume of 25 µl with buffer A, MgCl2 (25 mM final), dNTP (2.5 mM final each), AmpliTaq-Gold (0.5 U), and specific primers (0.5 µM final each) and probe (0.1 µM final) were subsequently used for TaqMan RT-PCR with the ABI PRISM 7700 Sequence Detector System (Applied Biosystems). Specific primers and probes for porcine GAPDH and CCR9 were designed based on sequences obtained from GenBank and synthesized by Microsynth. Sequences were as follows: pGAPDH-forward (F): catcactgccacccagaaga, pGAPDG-reverse (R): atgatgttctgggcagccc, pGAPDH-P: tgtggatggcccgtctgggaa, pCCR9-F: gcctcagacactgctctccac, pCCR9-R: tcagacttgcggcttctgtg, pCCR9-P: caagcttgcagctggccaaccat. Primers for CCR9 were designed as intron-spanning primers and did not amplify genomic DNA. CCR9 mRNA expression was analyzed with Sequence Detector System software version 1.9.1 (Applied Biosystems) and normalized based on expression of GAPDH mRNA.

Stimulation of PBMC in the presence of exogenous RA, RAR{alpha} antagonist, or coculture supernatants

PBMC were stimulated with 100 ng/ml SEB in DMEM 10% v/v FBS in wells of 96-well U-bottom plates in the absence or presence of various concentrations of exogenous RA, the RAR{alpha} antagonist Ro-41-5253, or cell-free supernatants derived from 4-day-old cocultures. beta7 integrin and CCR9 mRNA expression were analyzed at day 4 of culture by FACS and TaqMan RT-PCR as described above.

ELISA for TGF-beta1, IL-6, and FMDV-specific IgG and IgA

IL-6 in MoDC culture supernatants was assessed by the porcine IL-6 DuoSet ELISA Development System from R&D Systems. For analysis of TGF-beta, day 4 MoDC were transferred to serum-free medium before treatment with immunomodulatory factors for 24 and 48 h to avoid interference from serum-derived TGF-beta1 in the ELISA. Cell-free supernatants were acidified with 10 µl/100 µl supernatant 1 M HCl for 30 min at 4°C, neutralized with equal amounts of 1 M NaOH, and used at a 1/2 dilution in the ELISA. This was performed using anti-TGF-beta mAb 1835 (R&D Systems) for capture and biotinylated anti-TGF-beta1 mAb 240 (R&D Systems) for detection, following the manufacturers’ guidelines. Recombinant human TGF-beta1 (PeproTech) was used as standard. The ELISA for FMDV-specific IgG was based on the method described by Rigden et al. (20), with modifications. Briefly, MaxiSorp plates (Nunc) were coated overnight at 4°C with a rabbit anti-FMDV O serum (prepared in-house) diluted in 0.05 M carbonate-bicarbonate buffer, pH 9.6 (1/10,000). Plates were washed with PBS containing 0.05% (v/v) Tween 20. Heat-inactivated (30 min at 60°C) FMDV O1 Lausanne prediluted in PBS 0.05% (v/v) Tween 20, 1% (w/v) dried skimmed milk was added for 1 h at 37°C. Plates were washed, followed by the addition of samples diluted 1/4 in PBS containing 0.05% (v/v) Tween 20, 1% (w/v) dried skimmed milk and 1% (v/v) rabbit serum (Sigma-Aldrich), and then incubated for 1 h at 37°C. After washing, peroxidase-labeled anti-swine IgG F(ab')2 (Jackson ImmunoResearch Laboratories) diluted in the same buffer was added, followed by a 1-h incubation at 37°C. O-phenylenediamine (Sigma-Aldrich) H2O2 was used as substrate. Ab titers are expressed as adsorbance (OD450). FMDV-specific IgA was assessed analogously but using an anti-swine IgA mAb (CVI.SwIgA.27.9.1; Cedi Diagnostics) and a rabbit anti-mouse Ig-HRP conjugate (DakoCytomation) for detection.

Statistical analysis

All statistical analyses were performed using the Wilcoxon pairwise rank sum test.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
RA pretreatment of MoDC leads to up-regulated beta7 integrin and CCR9 mRNA expression by cocultured T cells

The initial analyses focused on screening a number of immunoregulatory factors for their potential to modulate peripheral DC toward mucosa-type DC. An in vitro coculture model of MoDC and lymphocytes was used, with analysis of lymphocyte expression of the beta7 integrin and CCR9 mRNA as functional readout. The factors used for pretreatment of MoDC were chosen based on their already well-established association with the induction and functioning of mucosal immune responses (LT, Di-VitD3, Ret, RA) or on account of their known overall stimulating capacity for DC (TNF-{alpha}, LPS, Pam3Cys, pIC).

When MoDC were pretreated with 1000 nM RA before coculture with autologous lymphocytes, significantly higher beta7 integrin expression was noted on proliferating (CFSElow) lymphocytes, compared with untreated MoDC (Fig. 1A). This was not observed when the MoDC were treated with the other factors or the lower concentration of RA (10 nM). CCR9 mRNA expression by the lymphocytes was also modulated in the cocultures containing the RA-pretreated MoDC, in a similar fashion to the beta7 integrin expression—CCR9 mRNA levels were increased up to 43-fold in cocultures with MoDC pretreated with 1000 nM RA (Fig. 1B). Interestingly, a mean 4-fold increase of CCR9 mRNA was also observed in cocultures with LT-pretreated MoDC, but only with 1 µg/ml LT (Fig. 1B). Although statistical analyses did not indicate a significant promotion of beta7 integrin expression by LT-treated MoDC (Fig. 1A), certain experiments did show a clear increase of beta7 integrin expression on lymphocytes cocultured with LT-treated MoDC (Fig. 1D). Together, these results would support a general correlation between the induction of beta7 integrin and CCR9 mRNA. Considering that the treated MoDC themselves expressed very low amounts of CCR9 mRNA (data not shown), the observed increase in CCR9 mRNA in the cocultures was due to up-regulated expression in the lymphocytes.


Figure 1
View larger version (40K):
[in this window]
[in a new window]

  		FIGURE 1. beta7 integrin and CCR9 mRNA expression by lymphocytes after coculture with MoDC. The MoDC were either untreated or pretreated with immunomodulatory factors TNF-{alpha} (20 ng/ml), LPS (1 µg/ml), LT (0.1, 1, or 10 µg/ml), VitD3 (10 or 1000 nM), RA (10 or 1000 nM), Ret (10 or 1000 nM), pIC (10 µg/ml), Pam3Cys (10 µg/ml). After 48 h, the MoDC were loaded with SEB, washed four times, and cocultured with CFSE-labeled lymphocytes for another 4 days. A, Increase of beta7 integrin expression by lymphocytes cocultured with treated MoDC relative to beta7 integrin expression induced by untreated MoDC. B, Increase in CCR9 mRNA levels in lymphocytes cocultured with treated MoDC relative to the levels induced by untreated MoDC. C, Increase of CFSElow cells in cocultures with treated MoDC relative to increase in cocultures with untreated MoDC. The box plots in A–C represent median values of independent experiments (n = 1–5) and the bars represent mean values with error bars indicating the range. D, Gating strategy and representative dot plots for three of the cocultures: the numbers indicate MFI for beta7 integrin (top left corner) and percentage of CFSElow lymphocytes (bottom left corner) defined within the gated region. The dotted lines indicate the position of the isotype controls. **, p < 0.01.

 
The {alpha}4beta7-integrin expression was seen to be cell cycle dependent (Fig. 1D) (4). Thus, it was possible that the results shown in Fig. 1, A and B, were due to an increased stimulatory capacity of the RA pretreated MoDC. Consequently, the relative increase in lymphocyte proliferation, determined as the frequency of CFSElow cells, was quantified in cocultures of lymphocytes with the pretreated MoDC, compared with cultures using untreated MoDC. The RA-pretreated MoDC were indeed more efficient than untreated MoDC at inducing T cell proliferation (Fig. 1, C and D). However, their stimulatory capacity was exceeded by LT-treated MoDC, which induced significantly more lymphocyte proliferation compared with untreated MoDC (Fig. 1, C and D). In fact, there was no precise relationship between the induction of lymphocyte proliferation and up-regulation of mucosal homing receptors.

Influence of RA treatment of MoDC on beta7 integrin and CCR9 mRNA expression during an Ag-specific response

The above results were obtained in an SEB-dependent stimulation assay. Although DC do present SEB in a costimulation-dependent manner (21), Ag processing is not required. To ascertain whether the above observations would also be operative during Ag presentation, as would occur during vaccination, a second model system was used. Therein, an identical set of experiments was performed using FMDV as Ag together with lymphocytes isolated from FMDV-immune pigs. Selective gating on FMDV-specific blasting CD4+CD8+ memory/activated cells, but not on any other lymphocyte subset (data not shown), revealed a significantly up-regulated expression of the beta7 integrin by these cells after coculture with 1000 nM RA-treated or 1 µg/ml LT-treated MoDC (Fig. 2, A and D), although the latter were less effective than the RA-treated MoDC. Despite the low frequency of FMDV-responsive lymphocytes, an increase in CCR9 mRNA expression similar to the SEB-dependent system was also detected in these cocultures (Fig. 2B). Again, analysis of the percentage of proliferating lymphocytes (frequency of CD4+CD8+ blasting cells) failed to demonstrate a clear-cut correlation between the stimulatory potential and homing receptor imprinting capacity of the treated MoDC (Fig. 1C). Thus, despite variations between individual experiments in both the SEB and FMDV systems, the presence of RA-treated (and to a lesser extent of LT-treated) MoDC consistently led to an increased mucosal homing receptor expression by cocultured lymphocytes. Interestingly, this imprinting of mucosal homing receptors through the presence of RA-treated MoDC was seen with both naive and Ag-experienced lymphocytes (Figs. 1 and 2).


Figure 2
View larger version (40K):
[in this window]
[in a new window]

  		FIGURE 2. beta7 integrin and CCR9 mRNA expression by lymphocytes cocultured with MoDC in an Ag-specific stimulation assay. The MoDC were treated as described for Fig. 1, but cocultured with lymphocytes from FMDV-immune pigs and FMDV Ag for 5 days. A, Increase of beta7 integrin expression by CD4+CD8+ blasting Th cells cocultured with treated MoDC relative to expression in cocultures with untreated MoDC. B, Increase in CCR9 mRNA levels in lymphocytes cocultured with treated MoDC relative to the levels induced by untreated MoDC. C, Increase of CD4+CD8+ blasting Th cells in cocultures with treated MoDC relative to increase in cocultures with untreated MoDC. The box plots in A–C represent median values of independent experiments (n = 2–4) and the bars represent mean values with error bars indicating the range. D, Gating strategy and representative example for three of the cocultures: the numbers in the dot blots indicate the frequency of CD4+CD8+ blasting Th cells, while the numbers in the histograms are the MFI for beta7 (bold line: the filled histograms represent isotype controls) in the gated region shown in the dot plots. *, p < 0.05.

 
Analysis of cell surface molecule expression and cognate interaction relative to the activity associated with the RA-treated MoDC

Microscopic examination revealed that RA-treated MoDC were morphologically distinct to untreated cells, being more similar to the morphology of TNF-{alpha}-matured MoDC (data not shown). Accordingly, MoDC phenotyping was used to assess whether the influence of the RA-treated MoDC on the lymphocytes could be related to modified MHC class II or costimulatory molecule expression. RA-treated MoDC did not display modulated MHC class II or CD80/86 expression compared with untreated cells (Fig. 3A). In contrast, RA-treated MoDC had a strongly reduced endocytic and processing capacity, as assessed by the signal intensity obtained with OVA-dQ (Fig. 3A). Thus, RA was influencing the functionality of the MoDC. The relevance of cognate interactions between RA-treated MoDC and T cells, in terms of beta7 integrin and CCR9 mRNA expression, was ascertained by separating the treated MoDC from the lymphocytes by a 0.4 µM pore-size cell culture insert. Whole PBMC were stimulated with FMDV to allow for Ag presentation. In the absence of the cell culture insert, the RA-treated MoDC promoted an almost 4-fold increase in beta7 integrin expression on the gated CD4+CD8+ Th lymphocytes (Fig. 3B, MoDC + PBMC). The degree of this induction was greater than that obtained with cocultured APC-depleted (CD172a– ly) lymphocytes (Fig. 3B, "MoDC + CD172a- ly"). When the RA-treated MoDC were separated from the PBMC by the 0.4-µM membrane, their capacity to induce beta7 integrin expression was unaffected (Fig. 3B, "MoDC ] PBMC"). In contrast, when separated from the APC-depleted lymphocytes, the RA-treated MoDC only induced a minor increase in beta7 integrin expression (Fig. 3B; "MoDC ] CD172a- ly"). This related to the lack of Ag presentation in these cultures (data not shown) and confirmed that separation of the MoDC by the 0.4 µM pore-size membrane was complete (Fig. 3B). These findings suggested that RA-treated MoDC mediated their effect through soluble factors rather than cognate interaction with the lymphocytes.


Figure 3
View larger version (40K):
[in this window]
[in a new window]

  		FIGURE 3. The imprinting capacity of RA-treated MoDC is mediated by soluble factors. A, The surface expression of MHC class II and CD80/86 and the degree of OVA-DQ uptake and proteolysis were analyzed in 6-day-old MoDC, either left untreated (filled histograms), or pretreated for 48 h with TNF-{alpha}, LT, or RA (bold lines). Numbers to the left and right indicate MFI values for untreated and treated MoDC, respectively. B, Untreated and 48-h RA-treated MoDC were cocultured with PBMC or with APC-depleted CD172a– lymphocytes plus FMDV Ag for 5 days. beta7 integrin expression was subsequently analyzed in gated CD4+CD8+ blasting Th cells. Where indicated, the MoDC were separated by a 0.4 µM pore-size cell culture insert. Experiments were repeated three times with similar results.

 
MoDC as carriers of RA

Iwata et al. (7) demonstrated that concentrations of RA as low as the picomolar range can directly induce beta7 integrin and CCR9 expression by T cells in the absence of DC. In our system, RA-treated MoDC were washed at least four times (with a ~100-fold dilution at each step) before coculture with the lymphocytes. Thus, the original concentration of 1000 nM RA used for MoDC pretreatment was likely reduced to <0.01 pM. Titrations of RA on SEB-stimulated PBMC isolated from several individual pigs indicated that concentrations of >1 nM RA were required for detectable induction of beta7 integrin and CCR9 mRNA expression by porcine lymphocytes (Fig. 4, A and B). Considering this together with the known instability of RA, a carryover of residual RA into the cocultures seemed unlikely. Nevertheless, additional analyses to rule out a "carry-over" of RA were pursued using the RAR{alpha} antagonist Ro-41-5253. When added into the MoDC-lymphocyte cocultures, 100 nM Ro-41-5253 impaired the up-regulation of beta7 integrin expression induced by the RA-treated MoDC; 1000 nM of the RAR{alpha} antagonist was needed to abolish beta7 up-regulation (Fig. 4C). Intriguingly, the basal beta7 integrin expression levels—induced by untreated MoDC—were also impaired in the presence of the RAR{alpha} antagonist (Fig. 4C). CCR9 mRNA expression was also affected by the RAR{alpha} antagonist. Concentrations as low as 1 nM impaired the expression, with 100 nM of Ro-41-5253 effectively abolishing CCR9 mRNA induction (Fig. 4D). A cross-titration of RA and Ro-41-5252 on SEB-stimulated PBMC revealed that a 1000x molar excess of the RAR{alpha} antagonist was required to counteract the effects of RA with respect to induction of beta7 integrin expression (Fig. 4E). Thus, according to the findings presented in Fig. 4C, substantial amounts of RA were still present in the cocultures. Because RA may regulate its own synthesis by positive feedback activation of retinal dehydrogenase enzymes (RALDH) and RARs (22, 23, 24), the possibility of de novo synthesis of RA by RA-treated MoDC was considered. However, addition of the RALDH inhibitor citral into cocultures did not significantly affect the ability of RA-treated MoDC to induce up-regulated beta7 integrin expression (Fig. 4F). These findings suggested that RA-treated MoDC appear to be able to function as efficient reservoirs and carriers of bioactive RA.


Figure 4
View larger version (36K):
[in this window]
[in a new window]

  		FIGURE 4. Role for carryover of RA. A and B, PBMC isolated from several individual pigs were incubated with SEB and the indicated RA concentrations for 4 days. A, RA-induced increase in beta7 integrin expression by proliferating cells relative to beta7 integrin expression in cells cultured in the absence of RA. B, Relative RA-induced increase in CCR9 mRNA expression. Lines represent responses from individual pigs. C and D, Untreated and 1000 nM RA-treated, SEB-loaded MoDC were cocultured with CFSE-labeled lymphocytes for 4 days in the absence or presence of the RAR{alpha} antagonist Ro-41-5253. C, beta7 integrin expression by CFSElow cells. D, CCR9 mRNA expression in cocultures. E, PBMC were stimulated with SEB in the absence or presence of different concentrations of RA and the RAR{alpha} antagonist Ro-41-5253. After 4 days of culture, beta7 integrin expression was analyzed in proliferating cells. F, beta7 integrin expression by CFSElow lymphocytes cocultured with untreated or RA-treated MoDC for 4 days in the absence or presence of the RALDH inhibitor citral. All experiments in A–F were performed in replicates of three wells. Mean values are shown with error bars indicating the range. Experiments were repeated twice with similar results.

 
Potential role of additional MoDC-derived factors in the regulation of beta7 integrin expression

The experiments described above indicated a role for a cell-mediated carry-over of RA into the cocultures. Accordingly, RA-treated MoDC might efficiently "deliver" RA to lymphocytes during immunological synapse formation. However, the induction of beta7 integrin expression on lymphocytes separated from RA-treated MoDC by a transwell insert would rather argue for a release of RA or other soluble factors from the RA-treated MoDC into the culture medium (Fig. 3B). Indeed, serially diluted supernatants from 4-day-old cocultures of lymphocytes and RA-treated MoDC still induced increased beta7 integrin expression in SEB-stimulated PBMC (Fig. 5A). Such an activity seemed to be in conflict with the well-acknowledged instability of RA in aqueous solutions. Moreover, the levels of beta7 integrin expressed by lymphocytes cocultured with RA-treated MoDC were substantially higher than the levels induced on PBMC by saturating (100 nM) concentrations of exogenous RA (Fig. 5B). This could not be explained by an increased stimulatory potential of the RA-treated MoDC (Fig. 5C). To assess a potential function for a soluble factor produced by RA-treated MoDC in up-regulating beta7 integrin expression by cocultured lymphocytes, MoDC were fixed with PFA before addition of the lymphocytes. Although the fixation of SEB-loaded MoDC did not abrogate their ability to stimulate proliferative responses (Fig. 5D), beta7 integrin expression by the cocultured lymphocytes was strongly impaired (Fig. 5E). This was noted with both the RA-treated and untreated fixed MoDC. In contrast, CCR9 mRNA induction by the RA-treated MoDC was less affected by the fixation of the MoDC (Fig. 5F). Because fixation of the MoDC likely prevented the synthesis and release of cytokines, but not the release of RA, these findings would indicate an additional potential role for MoDC-derived factors other than RA in the regulation of beta7 integrin, but not of CCR9 mRNA, expression.


Figure 5
View larger version (34K):
[in this window]
[in a new window]

  		FIGURE 5. Additional MoDC-derived factors may be involved in the regulation of beta7 integrin expression. A, PBMC were stimulated with SEB in the presence of serially diluted supernatants derived from 4-day-old cocultures of CD172a– lymphocytes with untreated and RA-treated MoDC, respectively. beta7 integrin expression was analyzed in proliferating PBMC at day 4 of culture. B and C, Comparison of beta7 integrin expression and proliferative responses in FMDV-stimulated PBMC cultures supplied with 100 nM RA and in cocultures of CD172a– cells with untreated and RA-treated MoDC, respectively. Mean values of three replicate wells are shown with error bars indicating the range. D–F, Untreated or 48-h RA-treated, SEB-loaded MoDC were fixed with 1% PFA, washed four times, and cocultured with CFSE-labeled CD172a– lymphocytes for 4 days. D, Frequency of proliferating, CFSElow cells. E, beta7 integrin expression in CFSElow cells. Bars represent values of five replicate wells ± SEM. F, CCR9 mRNA expression in pools of five replicate coculture wells. Each set of experiments A, B and C, and D–F were repeated three times with similar results.

 
Role for TGF-beta secreted by RA-treated MoDC

Although no IL-10 was detectable in supernatants from either untreated or RA-treated MoDC (data not shown) 1000 nM RA clearly induced TGF-beta at 24 and 48 h posttreatment (Fig. 6A). Pan-TGF-beta neutralizing mAb significantly reduced the capacity of the RA-treated MoDC to induce beta7 integrin up-regulation on cocultured lymphocytes while not affecting the basal level of beta7 integrin expression (Fig. 6B). In contrast to beta7 integrin expression, the up-regulation of CCR9 mRNA induced by RA-treated MoDC was not affected by the presence of the TGF-beta-neutralizing mAb (Fig. 6C).


Figure 6
View larger version (28K):
[in this window]
[in a new window]

  		FIGURE 6. Potential role for TGF-beta secreted by RA-treated MoDC. A, Four-day-old MoDC were transferred to serum-free medium and left untreated or treated with 1000 nM RA. Supernatants harvested after 24 and 48 h were assessed for TGF-beta1 by ELISA. B–F, SEB-loaded untreated or RA-treated MoDC were cocultured with CFSE-labeled lymphocytes for 4 days in the presence of a neutralizing anti-TGF-beta mAb (at 5 or 20 µg/ml), or an isotype-matched control Ab (5 µg/ml). B and D, beta7 integrin expression in CFSElow cells. C, mRNA expression in pooled replicates of five wells for each of the conditions. E, {alpha}4 integrin chain expression in CFSElow cells. F, Frequency of {alpha}4highbeta7high cells within CFSElow cells. Bars represent mean values of five replicate wells ± SEM. Experiments were repeated three times with similar results.

 
TGF-beta has been implicated in up-regulating {alpha}Ebeta7, but not {alpha}4beta7 integrin, expression, on T cells entering the mucosal compartment (25, 26). As Abs against the {alpha}4beta7 heterodimer were not available for the porcine system, our studies routinely used a cross-reactive anti-mouse beta7 mAb. To certify that the anti-TGF-beta-neutralizing mAb indeed impaired {alpha}4beta7 rather than {alpha}Ebeta7 expression, experiments were repeated with additional analysis of the {alpha}4 integrin chain with a mAb specific for {alpha}4 (Fig. 6, D–F). RA-treated MoDC in fact induced increased levels of {alpha}4 integrin chain expression on cocultured lymphocytes compared with untreated MoDC (Fig. 6E). However, this was only a 2-fold increase compared with the several-fold augmented expression of the beta7 integrin chain. Moreover, {alpha}4 integrin chain expression was not affected by the anti-TGF-beta mAb (Fig. 6E). This may relate to pairing of the {alpha}4 integrin chain with the beta1 chain and the ubiquitous expression of the {alpha}4beta1 integrin by activated lymphocytes. Nonetheless, when selective gating on CFSElow {alpha}4beta7 double-positive, high-expressing cells was used, the impairing effect of the anti-TGF-beta mAb was again apparent (Fig. 6F), similar to the observations for beta7 integrin chain expression (Fig. 6D).

RA synergizes with TLR ligands to promote IL-6 production in MoDC

The above results demonstrating a partial role for RA-induced TGF-beta in the induction of {alpha}4beta7 integrin expression led us to investigate the role of additional cytokines potentially produced by the RA-treated MoDC. Along with TGF-beta, IL-6 is considered an important cytokine in the functioning of mucosal immune homeostasis. Indeed, RA treatment of MoDC for 48 h induced levels of IL-6 similar to those obtained after TLR ligand stimulation (Fig. 7). Intriguingly, when MoDC were simultaneously treated with RA and TLR ligands, up to 10-fold increased levels of IL-6 were detected (Fig. 7). MoDC cotreated with RA and TLR ligands were thus compared with the RA-treated MoDC for their capacity to induce increased beta7 integrin expression. The cotreated MoDC were in fact more potent inducers of beta7 integrin expression in certain experiments, but addition of an anti-IL-6-neutralizing Ab had no influence (data not shown). Hence, while IL-6 production by RA-treated, and particularly RA- and TLR-ligand cotreated MoDC represents a striking feature, IL-6 does not contribute to the capacity of MoDC to promote mucosal homing receptor expression.


Figure 7
View larger version (10K):
[in this window]
[in a new window]

  		FIGURE 7. RA is an inducer and potent amplifier of IL-6 production in MoDC. Four-day-old MoDC were stimulated for 48 h with 1000 nM RA, TLR ligands (Pam3Cys, 10 µg/ml; pIC, 10 µg/ml, LPS 1 µg/ml), or 1000 nM RA combined with TLR ligands. Supernatants were assessed for IL-6 by ELISA. One representative experiment of five independent experiments is shown.

 
RA-treated MoDC are potent inducers of FMDV-specific IgG and IgA secretion

Mucosal DC are characterized by their ability to promote gut-tropic T cells, and by their preferential secretion of the cytokines IL-10, TGF-beta, and IL-6 (27). Another unique attribute of mucosal DC is their capacity to induce IgA responses, which was recently shown to depend on RA, IL-6, or IL-5, as well as other unidentified DC-derived factors (8). Considering that RA-treated MoDC produced significant levels of IL-6, especially after concomitant TLR ligand stimulation (Fig. 7), we analyzed the capacity of RA-treated and RA plus LPS cotreated MoDC to induce FMDV-specific Ig secretion in cocultured, FMDV-stimulated lymphocytes. FMDV-specific Ig secretion depended on the presence of APC, as Ig levels were strongly abolished in CD172a– lymphocytes depleted from monocytes and DC compared with total PBMC (Fig. 8A). Addition of untreated MoDC to these CD172a– lymphocytes was unable to restore specific IgG production, whereas the presence of LPS-treated MoDC induced a small increase in FMDV-specific IgG (Fig. 8A). In contrast, coculture of CD172a– lymphocytes with RA-treated or RA plus LPS cotreated MoDC induced high levels of FMDV-specific IgG, which even exceeded the levels obtained using total PBMC (Fig. 8A).


Figure 8
View larger version (28K):
[in this window]
[in a new window]

  		FIGURE 8. RA-treated MoDC are potent inducers of FMDV-specific IgG and IgA responses. A, PBMC and APC-depleted CD172a– lymphocytes were isolated from FMDV-immune pigs and cultured with UV-inactivated FMDV in the absence or presence of RA (100 nM) or RA plus IL-6 (10 ng/ml). Where indicated in A and B, lymphocytes were cocultured with 48 h differentially pretreated MoDC and UV-inactivated FMDV in the absence (A) or presence (B) of exogenous RA (100 ng/ml), RA plus IL-6 (10 ng/ml), IL-6, anti-IL-6 Ab (5 µg/ml), or the RAR antagonist Ro-41-5253 (1 µM). FMDV-specific IgG and IgA was assessed in supernatants from 5-day-old cultures by sandwich ELISA. Mean values of three in vitro culture replicate wells are presented with error bars showing the range. Experiments were repeated three times with similar results.

 
For FMDV-specific IgA, a similar pattern of induction was observed. However, RA plus LPS cotreated MoDC were now more potent than RA-treated MoDC in inducing FMDV-specific IgA responses (Fig. 8A). This was in keeping with the acknowledged synergy of RA and LPS in inducing IL-6 production and the well-acknowledged role of IL-6 in the induction of IgA responses (Fig. 7 and Refs. 8 and 28). However, addition of RA or RA plus IL-6 to total PBMC cultures did not further boost their FMDV-specific IgA or IgG production (Fig. 8A).

An additional experiment was performed to address the impact of exogenous RA and IL-6 added to cocultures with untreated MoDC and LPS-treated MoDC. When RA and IL-6 were added to cocultures of lymphocytes with otherwise untreated MoDC, substantially augmented FMDV-specific IgG and IgA responses were observed (Fig. 8B). This effect was even more pronounced when LPS-treated MoDC were used. Intriguingly, when the MoDC were pretreated with RA or RA plus LPS, neither an anti-IL-6-neutralizing Ab nor the RAR{alpha} antagonist Ro-41-5253 impaired their ability to augment the FMDV-specific Ig responses. These findings indicate that, in contrast to what was observed for mucosal homing receptor induction, direct interaction of RA with lymphocytes was probably not involved. Rather, exposure of MoDC to RA resulted in their modulation leading to an enhanced capacity for promoting the induction of potent FMDV-specific IgG and IgA responses.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
Accumulating evidence suggests that DC play pivotal roles in shaping the migration pattern of lymphocytes (4, 5, 6, 10, 11, 12). Importantly, only DC from mucosa-draining lymph nodes will endow lymphocytes with the correct set of homing receptors for subsequent entry into mucosal effector tissues. This particular capacity of DC may account for the long-observed general failure of parenteral immunization to induce mucosal immunity. Although DC targeting for enhanced Ag delivery and presentation has become a prominent focus of vaccine research, few studies have systematically examined the potential of manipulating peripheral DC for vaccine-induced mucosal immunity. Based on the well-recognized plasticity of the DC-system, this study sought to investigate whether DC could be modulated toward "mucosa-type" DC. In this context, MoDC were analyzed for their capacity to imprint mucosal homing receptor expression on lymphocytes following targeting with selected immunomodulatory and adjuvant factors. Using an in vitro coculture model, the present work shows that MoDC pretreated with the vitamin A-derivative RA promoted up-regulated {alpha}4beta7 integrin and CCR9 mRNA expression by activated lymphocytes.

This apparently DC-mediated effect is intriguing considering that picomolar concentrations of RA can directly induce mucosal homing receptor expression by T cells in the absence of DC (7). In our porcine model, concentrations of RA of at least 1 nM were required for direct induction of beta7 integrin and CCR9 mRNA expression in T cells. Hence, with the well-recognized instability of RA in aqueous solutions and the extensive washing of the MoDC a carry-over of RA at first seemed unlikely. Indeed, culture of SEB-stimulated PBMC in the presence of the final wash fractions of the RA-treated MoDC did not indicate any residual activity of RA in respect to the induction of beta7 integrin expression (data not shown). However, the use of a RAR{alpha} antagonist in cocultures demonstrated that RA was evidently responsible for the effects observed and that substantial amounts of RA, likely associated with the MoDC, still had to be present. This may explain why only MoDC pretreated with the supraphysiological dose of 1000 nM but not with the lower dose of 10 nM RA were capable of inducing mucosal homing receptor expression.

Although it has been demonstrated that DC can produce RA, little information is available regarding the cellular metabolism of RA in DC after exposure to RA (7, 29). At least in certain cell types, RA induces the expression of a specific RA-metabolizing P450 cytochrome enzyme (CYP26) and triggers its own metabolization toward less active and more polar forms, which can be released into the culture medium (30, 31, 32). In contrast, evidence also exists for a possible positive feedback loop of RA on its own synthesis by activation of specific RA response elements in promoters of RAR and RALDH genes (22, 23, 24). It was beyond the scope of this study and the possibilities of our laboratory to analyze the actual residual amounts of RA in the RA-treated MoDC or to assess the formation and release of metabolites. Another difficulty is that the biological activity of these metabolites with respect to the induction of mucosal homing receptors is unknown. Because addition of the RALDH inhibitor citral into cocultures did not abrogate the capacity of the RA-treated MoDC to induce increased mucosal homing receptor expression, a de novo synthesis of RA from serum-derived retinol appeared unlikely. In the absence of further evidence, we thus have to state that MoDC can act as surprisingly efficient reservoirs and carriers of bioactive RA.

Two observations nonetheless led us to investigate a role for additional potential factors involved in the functioning of the RA-treated MoDC. First, we and others noted a distinct suppressive effect of the RAR antagonist on basal or pre-existing beta7 integrin expression, indicating that RAR antagonists may interfere with integrin expression in a RA-independent manner (8). Interference of certain RAR antagonists with AP-1 signaling has in fact been reported (33). Second, the increase in beta7 integrin expression levels in cocultures with RA-treated MoDC was consistently greater than that observed with PBMC cultures supplied with saturating concentrations of RA, suggesting that other DC-derived factors may contribute to the induction of beta7 integrin expression. Cytokine analyses revealed that RA treatment of MoDC induced substantial quantities of TGF-beta and IL-6. Although addition of an anti-TGF-beta-neutralizing mAb to the cocultures significantly impaired beta7 integrin expression, an Ab against IL-6 had no influence. In addition, CCR9 mRNA expression was not affected. Thus, similar to what has been proposed in the mouse, beta7 integrin and CCR9 expression appear to be regulated differentially (5, 6, 8, 9, 12). CCR9 expression may stringently depend on RA, whereas {alpha}4beta7 integrin expression could be regulated by the cooperative action of RA and additional factors. In this respect, it is interesting to note that peripheral DC can induce low levels of {alpha}4beta7 on T cells after long-term in vitro culture (11).

Although the results were unable to provide a clear pathway for cytokine-mediated control of {alpha}4beta7 integrin regulation, secretion of TGF-beta and IL-6 by RA-treated MoDC remains an important and novel feature. It is strongly reminiscent of the unique cytokine profile described for mucosal DC, promoting Th2 responses and supporting IgA switching (27).

Interestingly, a recent study characterized the IgA-inducing ability of mucosal DC as occurring independently of T cell help but involving DC-derived RA and IL-6 or IL-5 (8). Notably, despite polyclonal activation of B cells in these in vitro cultures, the presence of DC could not be substituted with RA and IL-6 and/or IL-5, indicating that additional (unidentified) DC-derived factors or signals were crucially involved. Related to these observations, our studies demonstrated that MoDC pretreated with RA or with RA and TLR ligands were potent inducers of FMDV-specific IgG and IgA secretion by cocultured B cells compared with untreated MoDC or MoDC pretreated with LPS alone. Intriguingly, this effect did not appear to be dependent on the increased IL-6 production by the RA-treated MoDC, as an anti-IL-6-neutralizing Ab had no influence. Moreover, in contrast to what was observed for the induction of mucosal homing receptor expression by the RA-treated MoDC, the RAR antagonist had no impact on the capacity of the RA-treated MoDC to induce Ig production. Because addition of RA to cocultures of CD172a– cells with untreated MoDC greatly boosted FMDV-specific Ig production, we can only speculate that DC themselves and not necessarily the B cells are the deciding targets of RA. Accordingly, exposure of DC to IL-6 and RA could lead to a generally increased stimulatory function of the DC and to the production of factors which are essential for the induction of B cell responses.

Based on our in vitro studies, we propose a novel role for RA as mucosal immune modulator directly targeting DC—a concept supported by the following notions: apart from mucosal DC, intestinal epithelial cells also possess the necessary enzymatic machinery to synthesize RA, and their direct metabolization of retinol to RA has been demonstrated (34). Due to the strategic location and multitude of enterocytes, these cells could represent a principal source of RA in the intestinal mucosa. Because epithelial cells cross-talk with DC by the production of chemokines and cytokines, LP DC may well be shaped by the presence of epithelial-derived RA. This could relate to the observation that the mucosal imprinting capacity of MLN DC is restricted to LP-derived CD103+ DC (9). Hence, exposure of LP DC to RA could result in the necessary induction of RALDH enzyme expression by positive feedback activation of the RALDH promotor (22). CD103 expression could either be directly induced by epithelial-derived TGF-beta, as proposed by Johansson-Lindbom et al. (9), or be mediated by RA-induced autocrine production of TGF-beta by the DC (our own results). Unfortunately, no reagents were available to analyze porcine CD103 expression.

Taken together, we have identified RA as a factor endowing peripheral or "neutral" DC with attributes of mucosal DC. Although secretion of TGF-beta and IL-6 and the ability to induce IgA responses by the RA-treated MoDC involved a true modulation of the DC by RA, their imprinting capacity of mucosal homing receptor expression is evidently associated with the release of RA and/or its metabolites acting on the lymphocytes. It will now be interesting to translate these in vitro findings into the in vivo situation. Although the overall importance of vitamin A in the functioning of immune responses is well-acknowledged from epidemiological data, most investigations on its potential adjuvant effect have focused on dietary supplementation. Nevertheless, a recent publication by Skountzou et al. (35) demonstrated that transcutaneous application of RA with cholera toxin and whole inactivated influenza virus augmented intestinal anti-influenza virus responses compared with a cholera toxin-virus combination. Although migration of peripheral DC to mucosal inductive sites may account for this effect (36, 37), our findings suggest that in situ modulation of DC and imprinting of mucosal homing receptor expression in local draining lymph nodes may also be involved. Such a mechanism has yet to be proven in vivo, but is at least supported by the notion that mucosal DC can potently override signals mediated by peripheral DC (12). Based on the modulation of DC by RA and the surprising capacity of these cells to store and carry RA, selective targeting of DC with RA shows promise for vaccine-induced mucosal immune responses via a parenteral route of immunization.


   Acknowledgments
 
We thank H. Gerber for mAb preparations, V. Neuhaus and M. Alves for preparing recombinant cytokines, and M. Hofmann for assistance with CCR9 primer design. We further thank P. Barnett for the generous supply of the FMDV vaccine. Particular thanks go to D. Brechbühl and H. Lüthi for care and regular bleeding of the pigs.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by the State Secretariat for Education and Research (Grant 03.0519 linked to European Union Project FMD_Improcon Project FP6 503603). Back

2 Address correspondence and reprint requests to Dr. Leslie Saurer, Institute of Virology and Immunoprophylaxis, Sensemattstrasse 293, CH-3147 Mittelhäusern, Switzerland. E-mail address: leslie.saurer{at}ivi.admin.ch Back

3 Abbreviations used in this paper: MLN, mesenteric lymph node; DC, dendritic cell; RA, retinoic acid; LP, lamina propria; FMDV, foot-and-mouth disease virus; MoDC, monocyte-derived DC; LT, heat-labile enterotoxin; SEB, staphylococcal enterotoxin B; FCM, flow cytometry; MFI, mean fluorescence intensity; RALDH, retinal dehydrogenase; pIC, polyinosine-polycytodolic acid; VitD3, 1{alpha},25-dihydroxyvitamin D3; Ret, retinol. Back

Received for publication November 2, 2006. Accepted for publication July 5, 2007.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Holmgren, J., C. Czerkinsky. 2005. Mucosal immunity and vaccines. Nat. Med. 11: S45-S53. [Medline]
  2. Neutra, M. R., P. A. Kozlowski. 2006. Mucosal vaccines: the promise and the challenge. Nat. Rev. Immunol. 6: 148-158. [Medline]
  3. Mora, J. R., U. H. von Andrian. 2006. T-cell homing specificity and plasticity: new concepts and future challenges. Trends Immunol. 27: 235-243. [Medline]
  4. Stagg, A. J., M. A. Kamm, S. C. Knight. 2002. Intestinal dendritic cells increase T cell expression of {alpha}4beta7 integrin. Eur. J. Immunol. 32: 1445-1454. [Medline]
  5. Mora, J. R., M. R. Bono, N. Manjunath, W. Weninger, L. L. Cavanagh, M. Rosemblatt, U. H. von Andrian. 2003. Selective imprinting of gut-homing T cells by Peyer’s patch dendritic cells. Nature 424: 88-93. [Medline]
  6. Johansson-Lindbom, B., M. Svensson, M. A. Wurbel, B. Malissen, G. Marquez, W. Agace. 2003. Selective generation of gut tropic T cells in gut-associated lymphoid tissue (GALT): requirement for GALT dendritic cells and adjuvant. J. Exp. Med. 198: 963-969. [Abstract/Free Full Text]
  7. Iwata, M., A. Hirakiyama, Y. Eshima, H. Kagechika, C. Kato, S. Y. Song. 2004. Retinoic acid imprints gut-homing specificity on T cells. Immunity 21: 527-538. [Medline]
  8. Mora, J. R., M. Iwata, B. Eksteen, S. Y. Song, T. Junt, B. Senman, K. L. Otipoby, A. Yokota, H. Takeuchi, P. Ricciardi-Castagnoli, et al 2006. Generation of gut-homing IgA-secreting B cells by intestinal dendritic cells. Science 314: 1157-1160. [Abstract/Free Full Text]
  9. Johansson-Lindbom, B., M. Svensson, O. Pabst, C. Palmqvist, G. Marquez, R. Forster, W. W. Agace. 2005. Functional specialization of gut CD103+ dendritic cells in the regulation of tissue-selective T cell homing. J. Exp. Med. 202: 1063-1073. [Abstract/Free Full Text]
  10. Dudda, J. C., J. C. Simon, S. Martin. 2004. Dendritic cell immunization route determines CD8+ T cell trafficking to inflamed skin: role for tissue microenvironment and dendritic cells in establishment of T cell-homing subsets. J. Immunol. 172: 857-863. [Abstract/Free Full Text]
  11. Dudda, J. C., A. Lembo, E. Bachtanian, J. Huehn, C. Siewert, A. Hamann, E. Kremmer, R. Forster, S. F. Martin. 2005. Dendritic cells govern induction and reprogramming of polarized tissue-selective homing receptor patterns of T cells: important roles for soluble factors and tissue microenvironments. Eur. J. Immunol. 35: 1056-1065. [Medline]
  12. Mora, J. R., G. Cheng, D. Picarella, M. Briskin, N. Buchanan, U. H. von Andrian. 2005. Reciprocal and dynamic control of CD8 T cell homing by dendritic cells from skin- and gut-associated lymphoid tissues. J. Exp. Med. 201: 303-316. [Abstract/Free Full Text]
  13. Kapsenberg, M. L.. 2003. Dendritic-cell control of pathogen-driven T-cell polarization. Nat. Rev. Immunol. 3: 984-993. [Medline]
  14. Carrasco, C. P., R. C. Rigden, R. Schaffner, H. Gerber, V. Neuhaus, S. Inumaru, H. Takamatsu, G. Bertoni, K. C. McCullough, A. Summerfield. 2001. Porcine dendritic cells generated in vitro: morphological, phenotypic and functional properties. Immunology 104: 175-184. [Medline]
  15. Von, N. B., G. Bertoni, C. Hertig, H. Pfister, E. Peterhans, U. Pauli. 1993. Cloning and expression in mammalian cells of porcine tumor necrosis factor {alpha}: examination of biological properties. Vet. Immunol. Immunopathol. 38: 57-74. [Medline]
  16. McCullough, K. C., R. Butcher. 1982. Monoclonal antibodies against foot-and-mouth disease virus 146S and 12S particles. Arch. Virol. 74: 1-9. [Medline]
  17. Rigden, R. C., C. P. Carrasco, A. Summerfield, K. C. McCullough. 2002. Macrophage phagocytosis of foot-and-mouth disease virus may create infectious carriers. Immunology 106: 537-548. [Medline]
  18. Summerfield, A., H. J. Rziha, A. Saalmuller. 1996. Functional characterization of porcine CD4+CD8+ extrathymic T lymphocytes. Cell. Immunol. 168: 291-296. [Medline]
  19. Blanco, E., K. McCullough, A. Summerfield, J. Fiorini, D. Andreu, C. Chiva, E. Borras, P. Barnett, F. Sobrino. 2000. Interspecies major histocompatibility complex-restricted Th cell epitope on foot-and-mouth disease virus capsid protein VP4. J. Virol. 74: 4902-4907. [Abstract/Free Full Text]
  20. Rigden, R. C., C. P. Carrasco, P. V. Barnett, A. Summerfield, K. C. McCullough. 2003. Innate immune responses following emergency vaccination against foot-and-mouth disease virus in pigs. Vaccine 21: 1466-1477. [Medline]
  21. Nestle, F. O., C. Thompson, Y. Shimizu, L. A. Turka, B. J. Nickoloff. 1994. Costimulation of superantigen-activated T lymphocytes by autologous dendritic cells is dependent on B7. Cell. Immunol. 156: 220-229. [Medline]
  22. Duester, G., M. L. Shean, M. S. McBride, M. J. Stewart. 1991. Retinoic acid response element in the human alcohol dehydrogenase gene ADH3: implications for regulation of retinoic acid synthesis. Mol. Cell. Biol. 11: 1638-1646. [Abstract/Free Full Text]
  23. de, T. H., M. M. Vivanco-Ruiz, P. Tiollais, H. Stunnenberg, A. Dejean. 1990. Identification of a retinoic acid responsive element in the retinoic acid receptor beta gene. Nature 343: 177-180. [Medline]
  24. Leroy, P., H. Nakshatri, P. Chambon. 1991. Mouse retinoic acid receptor {alpha}2 isoform is transcribed from a promoter that contains a retinoic acid response element. Proc. Natl. Acad. Sci. USA 88: 10138-10142. [Abstract/Free Full Text]
  25. Kilshaw, P. J., S. J. Murant. 1991. Expression and regulation of beta7(betap) integrins on mouse lymphocytes: relevance to the mucosal immune system. Eur. J. Immunol. 21: 2591-2597. [Medline]
  26. El-Asady, R., R. Yuan, K. Liu, D. Wang, R. E. Gress, P. J. Lucas, C. B. Drachenberg, G. A. Hadley. 2005. TGF-beta-dependent CD103 expression by CD8+ T cells promotes selective destruction of the host intestinal epithelium during graft-versus-host disease. J. Exp. Med. 201: 1647-1657. [Abstract/Free Full Text]
  27. Iwasaki, A.. 2007. Mucosal dendritic cells. Annu. Rev. Immunol. 25: 381-418. [Medline]
  28. Sato, A., M. Hashiguchi, E. Toda, A. Iwasaki, S. Hachimura, S. Kaminogawa. 2003. CD11b+ Peyer’s patch dendritic cells secrete IL-6 and induce IgA secretion from naive B cells. J. Immunol. 171: 3684-3690. [Abstract/Free Full Text]
  29. Szatmari, I., A. Pap, R. Ruhl, J. X. Ma, P. A. Illarionov, G. S. Besra, E. Rajnavolgyi, B. Dezso, L. Nagy. 2006. PPAR{gamma} controls CD1d expression by turning on retinoic acid synthesis in developing human dendritic cells. J. Exp. Med. 203: 2351-2362. [Abstract/Free Full Text]
  30. Doyle, J. W., R. K. Dowgiert, S. M. Buzney. 1995. Retinoic acid metabolism in cultured retinal pigment epithelial cells. Invest. Ophthalmol. Vis. Sci. 36: 708-717. [Abstract/Free Full Text]
  31. Sonneveld, E., C. E. van den Brink, B. M. van der Leede, R. K. Schulkes, M. Petkovich, B. van der Burg, P. T. van der Saag. 1998. Human retinoic acid (RA) 4-hydroxylase (CYP26) is highly specific for all-trans-RA and can be induced through RA receptors in human breast and colon carcinoma cells. Cell Growth Differ. 9: 629-637. [Abstract]
  32. Lampen, A., S. Meyer, H. Nau. 2001. Effects of receptor-selective retinoids on CYP26 gene expression and metabolism of all-trans-retinoic acid in intestinal cells. Drug Metab. Dispos. 29: 742-747. [Abstract/Free Full Text]
  33. Li, Y., Y. Hashimoto, A. Agadir, H. Kagechika, X. Zhang. 1999. Identification of a novel class of retinoic acid receptor beta-selective retinoid antagonists and their inhibitory effects on AP-1 activity and retinoic acid-induced apoptosis in human breast cancer cells. J. Biol. Chem. 274: 15360-15366. [Abstract/Free Full Text]
  34. Lampen, A., S. Meyer, T. Arnhold, H. Nau. 2000. Metabolism of vitamin A and its active metabolite all-trans-retinoic acid in small intestinal enterocytes. J. Pharmacol. Exp. Ther. 295: 979-985. [Abstract/Free Full Text]
  35. Skountzou, I., F. S. Quan, J. Jacob, R. W. Compans, S. M. Kang. 2006. Transcutaneous immunization with inactivated influenza virus induces protective immune responses. Vaccine 24: 6110-6119. [Medline]
  36. Belyakov, I. M., S. A. Hammond, J. D. Ahlers, G. M. Glenn, J. A. Berzofsky. 2004. Transcutaneous immunization induces mucosal CTLs and protective immunity by migration of primed skin dendritic cells. J. Clin. Invest. 113: 998-1007. [Medline]
  37. Enioutina, E. Y., D. Visic, R. A. Daynes. 2000. The induction of systemic and mucosal immune responses to antigen-adjuvant compositions administered into the skin: alterations in the migratory properties of dendritic cells appears to be important for stimulating mucosal immunity. Vaccine 18: 2753-2767. [Medline]



This article has been cited by other articles:


Home page
 Int ImmunolHome page
A. Yokota, H. Takeuchi, N. Maeda, Y. Ohoka, C. Kato, S.-Y. Song, and M. Iwata
GM-CSF and IL-4 synergistically trigger dendritic cells to acquire retinoic acid-producing capacity
Int. Immunol., April 1, 2009; 21(4): 361 - 377.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
F. Edele, R. Molenaar, D. Gutle, J. C. Dudda, T. Jakob, B. Homey, R. Mebius, M. Hornef, and S. F. Martin
Cutting Edge: Instructive Role of Peripheral Tissue Cells in the Imprinting of T Cell Homing Receptor Patterns
J. Immunol., September 15, 2008; 181(6): 3745 - 3749.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
E. Jaensson, H. Uronen-Hansson, O. Pabst, B. Eksteen, J. Tian, J. L. Coombes, P.-L. Berg, T. Davidsson, F. Powrie, B. Johansson-Lindbom, et al.
Small intestinal CD103+ dendritic cells display unique functional properties that are conserved between mice and humans
J. Exp. Med., September 1, 2008; 205(9): 2139 - 2149.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Saurer, L.
Right arrow Articles by Summerfield, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Saurer, L.
Right arrow Articles by Summerfield, A.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS