|
|
||||||||

* Department of Tumor Cell Biology, St. Jude Childrens Research Hospital, Memphis, TN 38105; and
Department of Molecular Sciences, University of Tennessee, Health Science Center, Memphis, TN 38163
| Abstract |
|---|
|
|
|---|
H chain protein was also diminished, but unexpectedly this occurred at the transcriptional level as opposed to effects on H chain stability. The decrease in H chain transcripts correlated with a reduction in mRNA encoding the H chain transcription factor, OBF-1/BOB-1/OCA-B. Chromatin immunoprecipitation experiments revealed that XBP-1(S) binds to the OBF-1/BOB-1/OCA-B promoter in the plasmacytoma line and in primary B cells not only during plasma cell differentiation, but also in response to classical UPR activation. Gel shift assays suggest that XBP-1(S) binding occurs through a UPR element conserved in both murine and human OBF-1/BOB-1/OCA-B promoters as opposed to endoplasmic reticulum stress response elements. Our studies are the first to identify direct downstream targets of XBP-1(S) during either plasma cell differentiation or the UPR. In addition, our data further define the XBP-1(S)-binding sequence and provide yet another role for this protein as a master regulator of plasma cell differentiation. | Introduction |
|---|
|
|
|---|
The UPR in mammalian cells is activated by the following ER-localized transmembrane proteins: Ire1
/β kinase (4, 5), activating transcription factor (ATF) 6
/β (6), and PKR-like endoplasmic reticulum kinase (PERK) (7). In response to ER stress, an endoribonuclease activity encoded in the C terminus of Ire1 is activated. This results in the excision of 26 bases from XBP-1 mRNA (8, 9). After religation, the resulting frameshift remodels the C terminus of XBP-1 to encode a fully active transcription factor, the spliced form of XBP-1 (XBP-1(S)), which has both an N-terminal DNA binding domain and a new C-terminal trans activation domain. A second arm of the UPR is initiated by ATF6, a membrane-anchored transcription factor that is transported to the Golgi in response to ER stress and cleaved by the S1P and S2P proteases (10). The liberated cytosolic domain of ATF6 enters the nucleus and transcriptionally activates the expression of ER chaperones as well as XBP-1 (6, 8). The third ER-localized UPR transducer PERK phosphorylates eukaryotic initiation factor 2
, thereby dramatically decreasing cap-dependent translation and reducing the amount of proteins entering the ER. The mechanism of activating the UPR is not completely understood, but involves the disruption of BiP binding to these three ER sensors when unfolded proteins accumulate (11, 12).
During plasma cell differentiation, B cells begin to produce massive quantities of Abs, which require a corresponding increase in ER chaperones, folding enzymes, and components of the quality control machinery. XBP-1 has been shown to be an essential component of plasma cell development (13, 14). When the XBP-1 null embryonic stem cells were used to reconstitute RAG-2-deficient mice, the chimeric animals possessed normal numbers of B lymphocytes, but they were unable to differentiate into Ig-secreting plasma cells. These cells could be rescued by expression of XBP-1(S), but not by an unsplicable mutant of XBP-1, arguing that Ire1 activity is required for plasma cell differentiation (14). Microarray data suggested that at least 48 genes are downstream targets of XBP-1 during plasma cell differentiation (15), and many of these (i.e., ERdj4, EDEM, and p58IPK) were also regulated by XBP-1 in response to a pharmacological-induced UPR (16), although from these studies it was not clear which genes were direct targets of XBP-1 and which might be indirect. Recently, XBP-1 was shown to regulate ERdj4 expression using reporter assays and to bind to an ACGT tetranucleotide in the ERdj4 promoter using an EMSA (17). Although for the most part, specific binding sequences in XBP-1-regulated genes have not been elucidated and in no case has XBP-1(S) been demonstrated to bind to a promoter in cells.
Reducing XBP-1(S) expression in Ag8(8) and Ag8.653 plasmacytoma lines with small hairpin RNA (shRNA) led to the down-regulation of ERdj3 mRNA and protein. Using chromatin immunoprecipitation (ChIP) assays, we found that XBP-1(S) binds to the ERdj3 promoter in both plasmacytoma lines and splenic B cells. The binding of XBP-1(S) to the ERdj3 promoter increases during LPS-induced differentiation of splenic B cells, which corresponded to an increase in ERdj3 transcripts. Unexpectedly, we found that XBP-1(S) also contributed to H chain expression in Ag8(8) cells by regulating H chain mRNA levels. Using shRNA, we found that XBP-1 contributes to the expression of OBF-1/BOB-1/OCA-B (hereafter referred as OBF-1). OBF-1 was confirmed as a direct target of XBP-1(S) by ChIP assays, and in vitro gel shift experiments revealed that it bound to an ACGT tetranucleotide sequence, which constitutes the core of the UPR element (UPRE). Our study identifies the first two direct targets of XBP-1 during B cell differentiation and in response to classical UPR activation. In addition, our discovery that H chains are also regulated by XBP-1(S) broadens the scope of XBP-1(S) functions in plasma cell biology.
| Materials and Methods |
|---|
|
|
|---|
Primary mouse splenic B cells were enriched from spleens of 8- to 10-wk-old female C57BL/6 mice by negative sorting. Single-cell suspensions were incubated with Abs specific for non-B cell surface markers (CD3, CD4, CD8, Mac1, GR1, and TER-119), and these cells were depleted using autoMACS (Miltenyi Biotec). The efficiency of B cell enrichment was determined by staining a small aliquot with anti-CD19 and found to be >95%. The studies on mouse splenocytes have been reviewed and approved by an institutional review committee. To induce plasma cell differentiation, primary B cells and the I.29 µ+ lymphoma cell line were immediately incubated with 50 µg/ml LPS for 3 days at 8% CO2 in RPMI 1640 medium supplemented with 20% FCS (JRH Biosciences), 2 mM L-glutamine, 1% fungizone (Cambrex), 100 µM MEM nonessential amino acids, 1 mM sodium pyruvate, and 55 µM 2-ME (Invitrogen Life Technologies). Splenic B and I.29 µ+ cells were also treated with 2.5 µg/ml tunicamycin in the same medium for 6 h to induce the UPR. Ag8(8) and Ag8.653 murine plasmacytoma lines were maintained in RPMI 1640 supplemented with 10% FCS (JRH Biosciences), 2 mM L-glutamine, and 1% fungizone (Cambrex). Polyclonal anti-BiP (18) and anti-ERdj3 (19) antisera were described previously. Rabbit anti-XBP-1 (sc-7160 and sc-7160X), goat anti-heat shock cognate protein 70 (Hsc70), and HRP conjugates of goat anti-rabbit IgG and donkey anti-goat IgG were purchased from Santa Cruz Biotechnology. Goat anti-mouse Ig H chain antiserum was purchased from Southern Biotechnology Associates.
Northern analysis
Total RNA was extracted using the RNeasy mini prep kit (Qiagen), and 20 µg of RNA was loaded on a formaldehyde gel and transferred for Northern blotting, as described (20). The probes used for Northern blotting correspond to the coding sequences of human ERdj3 (19), hamster BiP (20), mouse XBP-1 (21), and human G3PDH (BD Clontech). Additional probes were amplified from Ag8(8) cells using the following primer pairs: Ig
H chain forward, GATTGTGGTTGTAAGCCTTG and reverse, GTTCTCCGCTGGCTGCC; Blimp-1 forward, CCAAAGAGTGTCCCCAAGAG and reverse, GGAAGAGTCTTGTAACCAGTC; OBF-1 forward, CGTGGCCATACCAGCGTTG and reverse, GAGGGTGTGGTTGAGCTCG; OCT-2 forward, GCCACCTGCTCAGTTCCTG and reverse, GGTGAGGGCTGTAGCTGGT; IFN regulatory factor 4 (IRF4) forward, GTCGAGAGGAGCCAGCTG and reverse, GGACCAGTCCCCTCTCCA. The probes were radiolabeled with [
-32P]dCTP (GE Healthcare) using the Prime-it II kit (Stratagene) and purified by ProbeQuant G-50 Micro Columns (GE Healthcare). Radioactive signals for each gene were quantified by PhosphorImager analysis (Amersham Biosciences) and ImageQuant software and normalized to the corresponding signal for G3PDH. The signal for the various genes in the neo control cells was set to one, and that in the cells expressing small hairpin XBP-1 (shXBP-1) was calculated as a fraction of the control value.
Real-time PCR
Total RNA samples were subjected to real-time PCR, and reactions were done in triplicate using a TaqMan One-Step PCR Master Mix kit (Applied Biosystems) and a standard thermal cycler. Amplification of the corresponding genes was achieved with specific primers and measured continuously with an ABI 7900HT Sequence Detection System. The signal was compared with an 18S RNA internal control supplied with the Pre-Developed TagMan Assay Control Kit (Applied Biosystems). The primers and 5'-FAM-3'TAMRA modified probes used are: Ig
H chain forward, AGCACCAAGGTGGACAAGA and reverse, ATGGTGAGCACATCCTTGG primers; Ig
H chain probe, CAACCACAATCCCTGGGCACA; ERdj3 forward, TGGAAGAAGTGTACGCAGGA and reverse, GACAGTTGCATTTCCGTTTG primers; ERdj3 probe, CTGTGGCCAGGCAGGCTCCT; OBF-1 forward, CCTCCTCGGTGTTGACCTAT and reverse, GGGTGTAGCAGTGCTTCTTG primers; OBF-1 probe, TCCACCACTCATCACTAATGTCACGC; BiP forward, AGGAGACTGCTGAGGCGTAT and GCTGGGCATCATTGAAGTAA; and BiP probe, CTGCATGGGTAACCTTCTTTCCCAA. Again, the normalized value for each transcript in the neo control cells was set to one, and the normalized value for the corresponding transcript in the shXBP-1-expressing cells was expressed as a fraction of the control. SD and p values were calculated from three independent experiments. In the case of splenic B and I.29 µ+ cells, the transcript level for each gene in the untreated cells was set to one, and the corresponding levels in tunicamycin- and LPS-treated samples were expressed as a fold increase over untreated cells. SD and p values are calculated from two separate experiments.
Retroviral infection
Viruses that express the neomycin-resistant gene alone or together with the XBP-1 shRNA (22) were provided by L. Glimcher (Harvard University, Boston, MA). Ag8(8) and Ag8.653 cells were infected with these viruses and selected with 1 mg/ml G418 to obtain stable lines.
Pulse-chase labeling and immunoprecipitation
Two million Ag8(8) Neo- and Ag8(8) shXBP-1-expressing cells were metabolically labeled for 40 min with 100 µCi/ml [35S]Translabel (ICN) and chased in complete RPMI 1640 medium for 0, 4, and 8 h. Cells were lysed in 1 ml of lysing buffer (50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 0.5% Nonidet P-40, and 0.5% deoxycholic acid), and protein concentration was determined by Bio-Rad protein assay. Then 400 µg of each sample was incubated with protein A-Sepharose for 1 h to isolate the H chain. Precipitated proteins were analyzed on SDS gels under reducing conditions, and signals were enhanced with Amplify (GE Healthcare) for radiographic visualization.
ChIP
Cells were incubated in RPMI 1640 medium containing 1% formaldehyde at room temperature for 10 min to cross-link protein-chromatin complexes. The cell pellets were lysed with cell lysis buffer I (10 mM HEPES (pH 6.5), 10 mM EDTA, 0.5 mM EGTA, 0.25% Triton X-100) first, then again with cell lysis buffer II (10 mM HEPES (pH 6.5), 1 mM EDTA, 0.5 mM EGTA, and 200 mM NaCl). Nuclear pellets were obtained by centrifugation; lysed in 50 mM Tris-Cl (pH 8.1), 10 mM EDTA, and 1% SDS; and then sonicated with a Branson Sonifier 250 (VWR), as described (23). Either 1% (Ag8(8) cells) or 5% (splenic B cells or I.29 µ+ cells) of each sample was saved and used for the input control. The remaining samples were split in half and immunoprecipitated with either 2 µg of rabbit anti-XBP-1 polyclonal antiserum (Santa Cruz Biotechnology; sc-7160X) or a rabbit anti-BiP polyclonal antiserum, which served as a negative control. The immunoprecipitated protein-DNA complexes and input controls were treated with proteinase K (25 µg/ml) to remove the protein components. The remaining DNA was purified, and 10-fold serial dilutions of DNA were made and subjected to PCR amplification using primer pairs that correspond to the indicated regions of the ERdj3 and OBF-1 promoter sequences. The following primer pairs were used: mOBF-1 ACGT core forward, CACCGTGGCTGTGTGCAAATG and reverse, CTTCAGCAACACCGCCTGTCAA; mOBF-1 1 kb upstream forward, GCCAGGAAGTTCAGGGGTTGA and reverse, GGCCTCACCTGCTGGTACTCT; mERdj3 3XERSE core forward, CTCAGCCGCTTCCGGGCGG and reverse, GCCCCAGAGCCGGCGAGCA; mERdj3 3 kb upstream forward, CCCTTACCCTAGCTGCCTGCA and reverse, GCTCTAAACAGTCACCATGACC.
In vitro translation and EMSA
The spliced form of XBP-1 was cloned by RT-PCR from Ag8(8) cells using the following primer pairs: forward primer, CCCAAGCTTGCGGCGCTGGCGTAGACGTT and reverse, TCAAGAGCTCGTGGCTCTTTAGACACTAATCAG. The amplified DNA was inserted into pBluescript-SK downstream of the T7 promoter, and the identity of the clone was confirmed by DNA sequencing and Western blotting. XBP-1(S) protein was produced using the T7 TNT Coupled Reticulocyte Lysate (Promega). Two microliters of lysates containing either in vitro translated XBP-1(S) or no exogenous protein (as the negative control) was incubated with the indicated oligonucleotide-radiolabeled probes (
0.01 pmol; 10,000 cpm) in a 20-µl reaction containing 1 µg of salmon sperm DNA, 50 mM NaCl, 10 mM Tris-HCl (pH 7.5), 1 mM MgCl2, 4% glycerol, 0.5 mM EDTA, and 0.5 mM DTT at 4°C for 1 h, as described previously (17). When indicated, 1000- to 2000-fold excess of unlabeled oligonucleotide probe was used to compete against the [
-32P]ATP-labeled wild-type (WT) probe, or 2 µg of anti-XBP-1 (sc-7160X) was used for the recognition of the protein complex. At the end of the incubation, 3 µl of a stop solution (80% glycerol, 10 mM EDTA (pH 8.0)) was added. Samples were loaded onto 5% (w/v) nondenaturing TGE polyacrylamide gels and electrophoresed in 1x TGE buffer (25 mM Tris-HCl (pH 8.0), 192 mM glycine, and 1 mM EDTA) at 150 V for 120 min at 4°C. The double-stranded synthetic oligonucleotide probes were radiolabeled using the T4 DNA kinase (Promega) and [
-32P]ATP (GE Healthcare) and purified by centrifugation through MicroSpin G-50 columns (GE Healthcare). The following probes were used for the EMSA: probe 1 forward, 5'-CACCGTGGCTGTGTGCAAATGGCCGTGGCC-3'; probe 1 reverse, 5'-GGCCACGGCCATTTGCACACAGCCACGGTG-3'; probe 2 forward, 5'-GGGTGCACACAGTGGGTTGACAGGCGGTGTTGCTGAAG-3'; probe 2 reverse, 5'-CTTCAGCAACACCGCCTGTCAACCCACTGTGTGCACCC-3'; probe 3 forward, 5'-GGAGGATGTGATGACGTGGCCCCTCTCAG-3'; probe 3 reverse, 5'-CTGAGAGGGGCCACGTCATCACATCCTCC-3'; probe 4 forward, 5'-TGTATGGTGGTTAGTCCCAATTGGCTGGC-3'; probe 4 reverse, 5'-GCCAGCCAATTGGGACTAACCACCATACA-5'; probe 3 ACGC forward, 5'-GGAGGATGTGATGACGCGGCCCCTCTCAG-3'; probe 3 ACGC reverse, 5'-CTGAGAGGGGCCGCGTCATCACATCCTCC-3'; probe 3 TGTA forward, 5'-GGAGGATGTGATGTGTAGGCCCCTCTCAG-3'; probe 3 TGTA reverse, 5'-CTGAGAGGGGCCTACACATCACATCCTCC-3'.
| Results |
|---|
|
|
|---|
Previously, we reported that the BiP cofactor, ERdj3, appears to bind directly to unassembled Ig H chains in vivo (19, 24). Consistent with its substrate-binding/cochaperone function, ERdj3 is highly expressed in secretory tissues and is up-regulated by agents that affect protein folding in the ER (19, 25). Although XBP-1(S) regulates ERdj3 during the classical UPR (16), it is not known whether it also controls ERdj3 levels during plasma cell differentiation or in stable plasmacytoma cells. To address the latter point, XBP-1(S) expression was investigated in Ag8(8) and Ag8.653 cells. Ag8(8) cells accumulate unassembled, nontransported
H chains due to the lack of L chains, and Ag8.653, which is a derivative of the Ag8(8) cell line, no longer synthesizes either L chains or H chains (26). We found that XBP-1(S) protein expression was remarkably greater in Ag8(8) cells (Fig. 1) that express free H chains than in the Ig– Ag8.653 cells (Fig. 1). As previously reported (19), protein levels of both ERdj3 and BiP were also higher in Ag8(8) cells than in Ag8.653 cells (Fig. 1), although the difference in ERdj3 expression is much less impressive than that of XBP-1(S).
|
Although the XBP-1(S) consensus binding site has not been well defined, XBP-1 was identified, along with ATF6, in a one-hybrid screen using an ER stress response element (ERSE) that regulates BiP expression during the UPR (27). When the promoter regions of human and mouse ERdj3 were examined, we found three potential ERSEs between –200 and –400 bp that could provide an XBP-1 binding site (Fig. 2A, boxed and italicized), as well as one conserved ACGT tetranucleotide element that was identified as an XBP-1 binding site in the ERdj4 promoter (Fig. 2A, boxed and in bold face) (17). To determine whether XBP-1 directly trans activates ERdj3 in these cells, we performed a ChIP assay. When the protein-chromatin complexes from Ag8(8) cells were immunoprecipitated with an Ab specific for XBP-1(S), a band could be amplified with primers that flank this region, but not with a nonspecific Ab (Fig. 2B), demonstrating that XBP-1(S) binds to the ERdj3 promoter in vivo. Thus, although many genes are regulated by XBP-1, ERdj3 is the first direct target of XBP-1(S) to be identified in vivo. The specific binding site is presumably located within 1 kb of the conserved region, because the vast majority of sheared chromatin was <1 kb in length (data not shown). However, it is not clear from this analysis whether XBP-1(S) binds to the ERSE or to the ACGT core because both are found in this region. When a primer pair that corresponded to a sequence
3 kb upstream of the conserved region was similarly used, it did not amplify a band (Fig. 2B). The evenness of the input controls indicates that the quality and the amount of the chromatin used are equal between samples.
|
1.5- and 9-fold in splenic B cells in response to tunicamycin and LPS treatment, respectively (p < 0.05) (Fig. 2E). In keeping with patterns of XBP-1(S) protein expression in I.29 µ+ cells, ERdj3 transcripts were increased by
5- and 1.5-fold, respectively, by these treatments. The expression of ERdj3 and H chain is compromised when XBP-1 is down-regulated
Due to the essential role of XBP-1 during plasma cell differentiation, it is impossible to obtain XBP-1 null plasma cells to examine the effect on ERdj3 expression. Thus, to further investigate the role of XBP-1(S) in regulating ERdj3 expression in plasmacytoma cells, we introduced XBP-1-specific shRNA (22) into Ag8(8) and Ag8.653 cells and obtained stable bulk cultures. Total RNA (Fig. 3A) and cell lysates (Fig. 3C) were examined for XBP-1 expression. Due to the minor difference (26 bases) in length, the full-length unspliced and the spliced XBP-1 mRNA cannot be separated by mobility. Thus, the single band shown includes both forms and represents the total amount of XBP-1 mRNA. To our surprise, we observed that the level of the total XBP-1 mRNA (Fig. 3A) is actually higher (
2- to 3-fold by Northern and semiquantitative PCR) in Ag8.653 cells than in Ag8(8) cell (Fig. 3A and data not shown), although Ag8(8) cells express significantly more XBP-1(S) protein (Figs. 1 and 3C). When primer pairs were designed to specifically recognize and amplify only either the sliced or unspliced form of XBP-1, we found that Ag8(8) and Ag8.653 cells contained similar amounts of the spliced form of XBP-1, whereas the Ag8.653 cells expressed appreciably more of the unspliced form of XBP-1 than Ag8(8) cells did (data not shown). Thus, the ratio of spliced to unspliced XBP-1 differs between the two lines. Recent data demonstrate that the unspliced XBP-1 protein can bind to XBP-1(S) and destabilize it (28), which may account for the very different amounts of XBP-1(S) protein in these two lines. We found that expression of XBP-1 transcripts was reduced by up to
70–80% in both cell lines after introducing the XBP-1 shRNA vector (Fig. 3, A and B). More importantly, we confirmed that XBP-1(S) protein expression was also reduced to below 20% in both lines (Fig. 3C).
|
60% of that present in the neo control Ag8(8) line and to
70% in Ag8.653 cells (Fig. 3C). Because H chain is a substrate of ERdj3 (19, 24), we examined the resulting effects on H chain expression in these cells. Similar to ERdj3 protein, we found that the accumulation of H chain protein was reduced to
50% in the shXBP-1-expressing Ag8(8) cells (Fig. 3C). Coupled with the results in Fig. 2, our data strongly suggest that XBP-1(S) directly regulates the ERdj3 promoter and contributes to the expression of ERdj3 transcripts during both a classical UPR, as well as in response to the modified UPR that occurs during plasma cell differentiation. The t1/2 of H chain is not decreased in Ag8(8) cells that express shXBP-1; however, the synthesis of H chain is reduced
In addition to their ability to stimulate the ATPase activity of their heat shock protein 70 partners, some DnaJ homologues possess chaperone activity themselves by binding directly to unfolded substrates through their C-terminal domains (29, 30). Because our previous data suggested that ERdj3 may also bind directly to unassembled H chains (19) (our unpublished data), it was plausible to speculate that the down-regulation of the ERdj3 expression could affect the stability of the H chain. Thus, we examined the t1/2 of H chains in Ag8(8) cells with normal and reduced levels of ERdj3. The cells were metabolically labeled and chased for the indicated times, and H chains were isolated for electrophoretic analyses. The radiographic signals of the 35S-labeled H chain did not disappear faster in the Ag8(8) shXBP-1-expressing line (Fig. 4), demonstrating that the turnover rate of the H chain was not increased with lower levels of ERdj3. However, we noticed that the radioactive signal of H chains at time = 0 in Ag8(8) shXBP-1 cells was consistently weaker than that observed in control cells, indicating a decreased expression of H chains. This did not appear to be due to increased aggregation of H chain as determined by examining the Nonidet P-40 insoluble fraction by Western blotting (data not shown). Because the lower levels of ERdj3 are mitigated in this line due to a similar decrease in H chain expression, it was not possible for us to establish whether inadequate amounts of ERdj3 would affect H chain stability.
|
To determine whether the lower level of H chain expression in the shXBP-1 line was due to decreased transcription of H chains, the same Northern blot membrane shown in Fig. 3A was hybridized with a probe specific for
H chain (Fig. 5A). We observed that expression of shXBP-1 resulted in an obvious decrease in transcripts encoding the secretory form of the H chain (
s) (Fig. 5, A, C, and D), which explains the decreased expression of H chain proteins in these cells. The membrane form of the H chain (
m) did not appear to be affected (Fig. 5A). To determine how XBP-1(S) might be regulating H chain transcription, we examined the expression of several transcription factors that are either induced during plasma cell differentiation or known to regulate H chain transcription. Blimp-1, the master regulator of plasma cell differentiation and a known regulator of XBP-1, has been shown to regulate µs without significantly affecting µm (31). Because this is similar to the phenomenon we observed in the shXBP-1-transduced Ag8(8) cells, we included Blimp-1 in our analysis. We included IRF4, which has been shown to regulate Blimp-1 (32) and XBP-1 (33). We also examined OCT-2 (34) and its cofactor OBF-1, which together contribute to H chain gene transcription through the octamer site of Ig promoters during late B cell differentiation (35, 36). Consistent with PhosphorImager data from our Northern blot (Fig. 5C), our real-time PCR analyses revealed that OBF-1 was down-regulated in Ag8(8) and Ag8.653 cells expressing shXBP-1 to 51 and 24%, respectively (p < 0.05) (Fig. 5D). Expression of OCT-2 was not affected (Fig. 5B), whereas Blimp-1 and IRF4 were actually modestly up-regulated in Ag8(8) cells.
|
Using synthetic probes, one-hybrid screens, and reporter assays, XBP-1 was shown previously to bind to both UPRE (3, 8, 37) and ERSE-II (37) sequences in response to ER stress, but only poorly to ERSE sites (8, 37). In addition, XBP-1 can bind to CRE-like sequences that contain an ACGT core (38, 39), which is also a central element of the 8-bp UPRE. As reported recently, although the ERdj4 promoter does not have either a UPRE or ERSE-II element, it does contain an ACGT tetranucleotide sequence, and EMSA studies demonstrated that rXBP-1 could bind to this sequence (17). Alignment of the human and mouse OBF-1 promoters revealed one potential UPRE site TGACGTGG/A, which is conserved in both (Fig. 6A, bold). However, the human OBF-1 promoter has a T
C substitution in the ACGT core of the UPRE site (Fig. 6A). We also found one potential ERSE site, GGTGG-N9-ATTGG, in the mouse OBF-1 promoter (Fig. 6A, italicized), but it is not present in the corresponding region of the human OBF-1 promoter. In addition, we found a TGCA core that was conserved in both the human and mouse OBF-1 promoters, which represents a reversion of the ACGT sequence (Fig. 6A, bold). This sequence was speculated to serve as a putative XBP-1 binding site in the EDEM promoter, another UPR target that is downstream of XBP-1 (17), although no data were provided to support this possibility. It is important to note that other than our data on ERdj3 (Fig. 2), the binding of XBP-1 to the promoter of any gene in cells has not been demonstrated, and therefore, a bona fide consensus-binding sequence has not been easy to determine.
|
XBP-1 regulates OBF-1 expression through a UPRE
To identify the specific binding sites for XBP-1(S) in the OBF-1 promoter, four double-strand probes (as underlined in Fig. 6A) were synthesized and tested by EMSA. Probe 1 (–340 to –311 bp) contains the TGCA element (speculated to serve as an XBP-1 binding site) (17) probe 2 (–234 to –197 bp) corresponds to a region with very high sequence homology between the two species (but which has not been suggested to serve as an XBP-1-binding sequence in any published study), probe 3 (–168 to –140 bp) includes the potential UPRE site, and probe 4 (–302 to –274 bp) represents a potential ERSE site in the mouse promoter. Either control rabbit reticulocyte lysates or lysates containing in vitro translated XBP-1(S) were incubated with [
-32P]ATP-labeled probes (Fig. 7A). We observed an XBP-1-specific band shift (indicated with an arrow) only with the sample that included probe 3 and XBP-1(S) (Fig. 7A). The other protein-probe complexes (indicated by asterisks), although possibly specific to the probe, are not due to XBP-1 binding, because they are present in both control and XBP-1-containing lysates. Probe 3 possesses a potential UPRE site in the mouse OBF-1 promoter; however, a single-nucleotide alteration from TGACGTGG to TGACGCGG exists in the human OBF-1 promoter.
|
| Discussion |
|---|
|
|
|---|
A combination of one-hybrid screens, reporter assays, and EMSA has suggested that XBP-1(S) binds several different UPR-inducible elements with the following preferences: UPRE>ERSE-II>>ERSE (3, 8, 37). ERSE sequences appear to have a higher affinity for ATF6 than XBP-1 (8, 37). The presence of multiple ERSE sites in the ERdj3 promoter may suggest that ATF6 is largely responsible for the remaining expression of ERdj3 in our Ag8(8) cells after shRNA transfection (Fig. 3) and in XBP-1 null mouse embryonic fibroblasts (data not shown). In support of this, overexpression of ATF6 in NIH3T3 cells up-regulates ERdj3 without inducing XBP-1 splicing (40). Although we did not investigate the exact XBP-1 binding site in the ERdj3 promoter, we focused on finding the target sequence of XBP-1 in the promoter of our second direct, and unexpected target of XBP-1, OBF-1. The OBF-1 promoter contained one ERSE and one UPRE, as well as a TGCA sequence that was previously suggested to serve as a putative XBP-1(S) binding site (17). The UPRE sequence TGACGTGG/A has a tetranucleotide core (ACGT), which was first identified as an optimal binding sequence for XBP-1 in an oligonucleotide screen (39) and recently was demonstrated to serve as an XBP-1(S) site in the ERdj4 promoter using EMSA (17). Our data demonstrated that the ACGT core of the UPRE was required for XBP-1(S) association and eliminated the ERSE and the TGCA sequences as likely binding sites (shown in Fig. 7). In addition, we found that the single change in this sequence found in the human OBF-1 promoter did not prevent its association with XBP-1(S), thus refining the UPRE sequence as TGACGT/CGG/A. Our demonstration that XBP-1(S) binds to the OBF-1 promoter, coupled with our EMSA studies provide reasonable support for the UPRE as a primary XBP-1-binding sequence and warrant further mutagenesis studies to fully define critical residues in this element.
Somewhat unexpectedly, we found that XBP-1(S) regulated the expression of H chain at the transcriptional level. A previous microarray study suggested that both Blimp-1 and XBP-1 contribute to H chain expression; however, because Blimp-1 regulates XBP-1 and both the Blimp-1 and the XBP-1 null cells fail to fully differentiate into plasma cells, it has been somewhat difficult to assess the relative contribution of these two transcription factors to H chain expression (15). Our studies reveal that OBF-1 is a direct target of XBP-1 and that reducing XBP-1(S) levels resulted in decreased expression of OBF-1 in cells. This is in contrast to the previous microarray study, which suggested that OBF-1 was downstream of Blimp-1, but not XBP-1, during differentiation (15). It is possible that the contribution of XBP-1(S) to OBF-1 expression is fairly modest compared with that of Blimp-1, and was therefore not detected in the microarray study. It is important to note that although decreased levels of OBF-1 corresponded to reduced expression of H chain, our experiments do not allow us to unequivocally conclude that OBF-1 levels per se are entirely responsible. It was surprising that the effect of lowering XBP-1 was greater for
s than for
m. However, this is consistent with a previous report showing that Blimp-1 is responsible for the developmentally regulated switch from µm to µs (31). Because XBP-1 is downstream of Blimp-1, it is possible that this occurs at least partially through XBP-1. A second possibility is that XBP-1 directly trans activates the H chain promoter. Inspection of the H chain promoter did not reveal any obvious UPRE sites, but a further delineation of the complete UPRE sequence may be required to draw this conclusion.
Although a modified UPR has been shown to be activated during the differentiation of B cells to plasma cells, and at least some elements of this signaling cascade are essential to the process, it was not known whether this pathway remained active in cells that stably produce large quantities of Ab molecules such as plasmacytoma, long-lived plasma cells, and hybridomas. In this study, we examined plasmacytoma cells as a model and found that they appear to continuously activate at least some arms of the UPR. The fact that XBP-1(S) is very abundant in Ag8(8) cells implies that Ire1 is likely to remain activated in these cells, because Ire1 is the only known protein that is capable of splicing XBP-1. The high levels of total XBP-1 mRNA and BiP expression in this line imply that the ATF6 pathway is also activated. A previous study reported that ATF6 is cleaved during LPS-induced differentiation of CH12 cells (41) and enforced expression of a dominant-negative ATF6 mutant in splenic B cells decreased Ab secretion (42). Similar to what has been shown in differentiating CH12 cells (41), we did not find evidence of C/EBP homologous protein (CHOP) expression in the plasmacytomas (data not shown), suggesting that whatever suppresses the PERK pathway during differentiation continues to do so in stable Ig-expressing lines, which could have implications for long-lived plasma cells. The signal for activating the ATF6 and Ire1 branches remains unclear. Previous studies show that XBP-1 splicing and up-regulation of ATF6 targets during plasma cell differentiation precede or coincide with increased IgM synthesis (41, 43); thus, Ig H chain is therefore unlikely to be the signal for their activation. However, our data showing higher levels of XBP-1(S) in the Ag8(8) cells that produce H chain are consistent with a previous report showing that µ H chain-deficient splenic B cells from the B1–8f/+ mouse have a lower level of XBP-1(S) in response to LPS (14) and suggest a possible amplification of this loop later in the differentiation process by the increased synthesis of Ig proteins.
In summary, we found that stable plasmacytoma lines continue to activate a modified or partial UPR, as evidenced by high levels of XBP-1(S), ERdj3, and BiP in the absence of detectable CHOP expression. We identified ERdj3 and OBF-1 as the first direct targets of XBP-1 during plasma cell differentiation and in response to a classical UPR. Furthermore, we found that XBP-1(S) also contributes to H chain transcription, which is likely to occur indirectly through its regulation of a H chain transcription factor. Our studies strongly suggest that XBP-1 regulates genes via UPRE sequences and extend the already vast role of XBP-1 in plasma cells.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by National Institutes of Health Grant GM54068 (to L.M.H.), the Cancer Center CORE Grant CA21765, and the American Lebanese Syrian Associated Charities of St. Jude Childrens Research Hospital. ![]()
2 Address correspondence and reprint requests to Linda M. Hendershot, St. Jude Childrens Research Hospital, 332 North Lauderdale Street, Danny Thomas Research Tower 5063, Memphis, TN 38105. E-mail address: linda.hendershot{at}stjude.org ![]()
3 Abbreviations used in this paper: ER, endoplasmic reticulum; ATF, activating transcription factor; ChIP, chromatin immunoprecipitation; ERSE, ER stress response element;
m, membrane form of the H chain;
s, secretory form of the H chain; IRF4, IFN regulatory factor 4; PERK, PKR-like endoplasmic reticulum kinase; shRNA, small hairpin RNA; shXBP-1, small hairpin XBP-1; UPR, unfolded protein response; UPRE, UPR element; WT, wild type; XBP-1(S), spliced form of XBP-1; Hsc70, heat shock cognate protein 70. ![]()
Received for publication January 30, 2007. Accepted for publication June 15, 2007.
| References |
|---|
|
|
|---|
promoter. Science 247: 1581-1584. This article has been cited by other articles:
![]() |
M. Dong, J. P. Bridges, K. Apsley, Y. Xu, and T. E. Weaver ERdj4 and ERdj5 Are Required for Endoplasmic Reticulum-associated Protein Degradation of Misfolded Surfactant Protein C Mol. Biol. Cell, June 1, 2008; 19(6): 2620 - 2630. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |