The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


The Journal of Immunology, 2007, 179, 2616 -2626
Copyright © 2007 by The American Association of Immunologists, Inc.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Koehn, B. H.
Right arrow Articles by Larsen, C. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Koehn, B. H.
Right arrow Articles by Larsen, C. P.

Fully MHC-Disparate Mixed Hemopoietic Chimeras Show Specific Defects in the Control of Chronic Viral Infections1

Brent H. Koehn*, Matthew A. Williams2,*, Keshawna Borom*, Shivaprakash Gangappa*, Thomas C. Pearson*, Rafi Ahmed{dagger} and Christian P. Larsen3,*

* Emory Transplant Center and Department of Surgery, and {dagger} Emory Vaccine Center, Emory University School of Medicine, Atlanta, GA 30322


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The establishment of mixed allogeneic chimerism can induce donor-specific transplantation tolerance across full MHC barriers. However, a theoretical disadvantage of this approach is the possibility that the state of mixed chimerism might negatively affect the recipient’s immune competence to control pathogens. Previous studies using murine models have not supported this hypothesis, because they indicate that acute viral infections are cleared by chimeric animals with similar kinetics to that of unmanipulated controls. However, chronic or persistent viral infections often require a more complex and sustained response with cooperation between CD4 Th cells, CTL, and B cells for effective control. The current study indicates that profound defects become manifest in the control of chronic pathogenic infections in MHC-disparate mixed allogeneic chimeric mice. Furthermore, we show that ineffective priming of the donor-restricted CTL response leads to virus persistence, as well as severe T cell exhaustion. Our results further suggest that either T cell adoptive immunotherapy or selected MHC haplotype matching partially restore immune competence. These approaches may facilitate the translation of mixed chimerism therapeutic regimens.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The establishment of hemopoietic chimerism shows considerable promise as a strategy for the treatment of several hematologic diseases and as a method to induce specific immunologic tolerance to allogeneic organ transplants (1, 2, 3, 4). Ideally, the tolerant state induced by therapeutic hemopoietic chimerism should not only confer durable and imperturbable bidirectional unresponsiveness to donor and recipient Ags in the absence of ongoing immunosuppression, but also allow the maintenance of robust protective immunity against the panoply of pathogens and opportunistic infections that may be confronted by the recipient. Furthermore, in order for therapeutic mixed chimerism approaches to enjoy wide application for tolerance induction to organ transplants, it is important that these approaches be applicable across varying degrees of MHC disparity.

Early studies of chimerism induction used myelo- and lymphoablative approaches, which resulted in complete replacement of the recipient’s hemopoietic system. Although these strategies successfully achieved robust tolerance, they resulted in significant deficiencies in immune competence when performed across major MHC disparities (5, 6, 7, 8). As a result, emphasis shifted toward approaches to establish a state of mixed chimerism in which there is coexistence of donor and recipient hemopoietic elements in the hopes of maintaining pathogen-specific immunity (5).

Initial approaches to mixed chimerism induction involved near complete, nonselective depletion of the existing T cell repertoire (9, 10), but more recently several protocols have been devised using transient blockade of T cell costimulatory pathways in conjunction with donor bone marrow and minimal or no myelosuppression to establish a state of stable mixed hemopoietic chimerism in mice (4, 11, 12, 13). In concept, by selectively deleting donor-reactive cells in the periphery and maintaining tolerance by ongoing deletion of donor-reactive T cells developing in the thymus (14, 15), it was hoped that this approach would better preserve a broad T cell repertoire and thus maintain protective immunity.

Mixed chimerism is thought to offer an additional advantage over complete chimerism for preserving protective immunity in that the mixed chimera harbors the full complement of donor- and recipient-derived APC, B cells, and T cells, conceptually allowing for effective generation of either recipient- or donor-restricted immune responses (5, 16). Early experiments to assess the specificity of tolerance, and by implication immune competence, through the application of skin grafts from third-party donors provided evidence for at least some degree of immune competence (16, 17). In other studies, MHC-disparate mixed chimeras rapidly controlled infections when challenged with vaccinia virus or the Armstrong strain of lymphocytic choriomeningitis virus (LCMV),4 which normally causes an acute infection that is rapidly cleared in CD8+ T cell-dependent manner (18, 19, 20). However, a different picture emerged when mixed chimeras were challenged with a LCMV variant (clone 13) (18) that produces a chronic infection in normal mice, requiring participation of both CD4 and CD8 T cells to clear viremia over a 2- to 3-mo period (21, 22, 23, 24, 25). Importantly, Armstrong and clone 13 strains are know to share 99.8% sequence homology, including all defined CD4 and CD8 T cell epitopes (24, 26). These results suggested that mixed chimeras may have subtle, but important immune defects that become manifest during chronic/persistent infections, requiring a more complex and sustained immune response to achieve viral control. To date, the underlying immune mechanisms for these observations have not been defined. Given the clinical importance in transplantation of persistent pathogens such as hepatitis C virus, polyoma BK virus, CMV, EBV, and more recently LCMV (27, 28, 29, 30, 31, 32, 33), coupled with the desire to apply mixed chimerism approaches in both living and deceased donor organ transplantation with varying degrees of MHC disparity (5, 34), it is imperative that studies be undertaken to interrogate the immune competence of allogeneic mixed chimeras, to understand mechanisms of immunodeficiency, and to develop strategies to maintain or restore protective immunity. In the current study, we demonstrate that there are profound defects in the control of chronic pathogenic infections in fully MHC-disparate mixed chimeric mice. Additionally, we show that the deficiency arises from inadequate development of donor-restricted T cells within the chimeras’ peripheral repertoire. As a result, despite the initial generation of a functional host-restricted response, donor-derived cells within the chimera are a relative immunologic blind spot allowing active viral replication and promoting severe immune pathology. Furthermore, the sustained viremia promotes a profound degree of T cell exhaustion of the recipient-restricted response, further compounding the immune incompetence. Finally, we provide evidence that immune competence can be largely restored by T cell adoptive immunotherapy or selective MHC matching. These considerations should be the focus of future translational and clinical investigations to enhance the safety and effectiveness of strategies to promote tolerance through chimerism induction protocols.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Mice and viral infections

C57BL/6J (CD45.2+), B6.SJL-PtprcaPep3b/BoyJ (CD45.1+), BALB/cJ, CB6.F1/J (BALB/c x B6), MHC II{Delta}/{Delta} (deletion of entire class II region, C57BL/6 background) (35), and B6-nu/nu mice were purchased from The Jackson Laboratory. KbDb-deficient-B6 mice were maintained at the Emory Division of Animal Research (36). Crosses were generated and maintained at Emory University’s Division of Animal Resources. All animals were male and between 4 and 8 wk of age when experiments were begun. Mice were infected with 1 x 106 PFU LCMV clone 13 injected i.v. to initiate chronic infection, or 2 x 105 PFU LCMV Armstrong i.p. to initiate acute infection (37). All experiments were conducted in accordance with institutional guidelines for animal care and use.

Induction of hemopoietic chimerism

Four-week-old recipient (B6-CD45.1+ congenic) mice were pretreated on day –1 with 20 mg/kg busulfan, i.p. (Busulfex; Orphan Medical). Bone marrow from donor mice was flushed from tibiae and femurs, resuspended at 2 x 107 cells/500 µl sterile saline, and injected i.v. into busulfan-treated recipients. On days 0 and 2 postinfusion, recipients were also given 0.5 mg each of hamster anti-mouse CD40L mAb (MR1; Bioexpress) and CTLA-4.Ig (Bristol-Myers Squibb) administered i.p. (4). Recipients of BALB/c marrow were also given 0.2 mg of anti-NK1.1 (PK136) on day –1, to overcome the NK cell barrier (38). Biweekly monitoring for levels of donor chimerism was done by flow cytometric measurement of donor CD45.2 expression on PBL.

Viral quantification

Total RNA extraction was conducted on 100 µl of whole blood using a QIAmp blood RNA extraction kit (Qiagen), and first-strand cDNA was synthesized using an ABI high capacity cDNA archive kit (Applied Biosystems), according to the manufacturer’s instructions. The LCMV primer sets and probe for TaqMan RT-PCR were designed using MGB Eclipse Design 2.3 Software and synthesized by EPOCH Biosciences with sequences, as follows: forward primer, GCAATCGTATTACCTCTTATCGCAG; reverse primer, CAACCATCGTCATCGTCAGGAAAC; and probe, 5'FAM-GGCAAAGTCCCATCGTT-3'MGB. Real-time PCR was performed in duplicate for each sample, on an ABI 7900H in a total volume of 15 µl (5 µl of cDNA template). The genome copy number was calculated by fitting the threshold cycle to a standard curve of known copy number.

Flow cytometry and tetramer staining

MHC class I H-2Db, Kb, or Ld tetramers complexed with LCMV nuclear protein (NP)396–404, gp33–41, gp276–286, or NP118–126 were produced, as previously described (39). Biotinylated complexes were tetramerized using allophycocyanin-conjugated streptavidin (Molecular Probes), and staining was conducted directly ex vivo. All Abs were purchased from BD Pharmingen, except the mAb clone H113 (anti-LCMV-NP), which was purified and conjugated with the AlexaFluor 647 protein-labeling kit, per the manufacturer’s instructions (Molecular Probes). Splenocytes were RBC lysed, stained with the indicated probes at 4°C, and acquired using a FACSCalibur flow cytometer (BD Biosciences). FlowJo was used for analysis (Tree Star). For intracellular cytokine analysis, 106 splenocytes were cultured in the presence of a given peptide (0.1 µg/ml) and brefeldin A for 5–6 h, at 37°C. Following the surface Ag staining, cells were stained for intracellular cytokines using the Cytofix/Cytoperm kit (BD Pharmingen), according to the manufacturer’s instructions. The anti-IFN-{gamma} clone XMG1.2 was used for intracellular cytokine detection.

ELISA

At given time points, serum was collected from individual mice, and LCMV-specific serum Ab titers were determined by a solid-phase ELISA, as described previously (40). Analysis for allotype-specific responses was performed in duplicate using biotinylated anti-mouse IgG2aa- or IgG2ab-specific detection Abs (BD Pharmingen). The LCMV-specific Ab titer was determined by normalizing to background binding (OD492), and is expressed as the reciprocal of the highest dilution showing a reading >2 SDs from background.

Serum cytokine quantification

Serum levels of TNF-{alpha}, IL-12p70, and MCP-1 were measured in a multiplex assay at the indicated time points by Cytometric Bead Array (BD Biosciences), according to the manufacturer’s instructions (41, 42).

In vivo cytotoxicity assay

In vivo epitope-specific killing was measured using a protocol developed by Barber et al. (43), with modifications. Target splenocytes from naive CB6.F1 mice were differentially costained with CellTrace Far Red DDAO-SE (2 µM; Molecular Probes) and CFSE (0.0025, 0.25, or 5 µM; Sigma-Aldrich) so as to identify five unique populations. Each population was then pulsed with the indicated peptide, washed, then recombined and adoptively transferred i.v. in equal quantities to chronically infected recipients. Five hours later, the spleens were harvested and single cell suspensions were acquired directly using a FACSCalibur. The relative survival of each target population was normalized to the unpulsed population, and the percentage of specific killing was calculated against the survival of that population in naive (n = 3) control animals, as described previously (43): 100 – ((percentage of peptide pulsed in infected/percentage of unpulsed in infected)/(percentage of peptide pulsed in uninfected/percentage of unpulsed in uninfected)) x 100.

Thymic reconstitution

Recipient B6-nu/nu (athymic) mice were treated as above for the induction of hemopoietic chimerism, using T-depleted bone marrow. Additionally, thymic fragments from the indicated donors were transplanted under the kidney capsule, under general anesthesia (44). Animals were allowed to reconstitute for 90 days, at which time mixed chimerism and T cell reconstitution were confirmed.

T cell enrichment and adoptive transfer

T cells were enriched using the mouse CD8+ or CD4+ T cell isolation kit and an AutoMACS separator (Miltenyi Biotec). Purity was confirmed to be >92% CD8+ or CD4+ by FACs analysis, with <0.5% contamination due to CD4+ or CD8+ T cells, respectively. Forty-eight hours before infection, 12 x 106 of the indicated enriched population was adoptively transferred i.v. For mice receiving both CD8+ and CD4+ T cells, sorted cells were pooled to deliver 12 x 106 of each population per recipient.

Statistics

Statistical analyses were performed using Student’s t test or one-way ANOVA (in vivo killing) with GraphPad Prism software.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Fully MHC-disparate mixed hemopoietic chimeras show impaired control of chronic infections relative to semiallogeneic or congenic mixed chimeras

To rigorously evaluate the immune competence of mixed hemopoietic chimeras with varying degrees of MHC disparity, stable mixed chimerism was established in C57BL/6 (B6-CD45.1+) recipients using one of three defined bone marrow donors, as follows: fully MHC-disparate BALB/c (H-2d) donors; semi-MHC-disparate BALB/c x B6-F1 donors (CB6F1/J, H-2bxd), which express the same allogeneic MHC H-2d molecules as the BALB/c donors, but also express the recipient MHC class I and II H-2b alleles; and finally, congenic B6-CD45.2+ (H-2b) control donors. Chimerism was established via a protocol consisting of a minimally myelosuppressive dose of busulfan and short-term CD28/CD40 costimulation blockade, as previously described (4). Multilineage mixed chimerism developed in a predictable fashion (4), and to similar degrees in each group (45 ± 5% donor chimerism). Eight weeks after chimerism induction, recipient mice were challenged with LCMV clone 13 to initiate a chronic pathogenic challenge. Viral load and immune responses were assessed at 14 and 30 days and at monthly intervals thereafter.

As expected, all groups showed high-level viremia 2 wk after infection (Fig. 1A). The recipients of congenic bone marrow (B6-CD45.2gB6-CD45.1) gradually controlled the virus with kinetics similar to unmanipulated B6 mice (37) (data not shown). In contrast, chimeras given fully MHC-disparate BALB/c bone marrow showed a considerable deficiency in viral control, maintaining high viral titers throughout the 4-mo period of observation (Fig. 1, A and B) (18). Interestingly, the recipients of the semi-MHC-disparate CB6F1 donor bone marrow effectively controlled the viral challenge with kinetics indistinguishable from the congenic chimeras (Fig. 1A).


Figure 1
View larger version (30K):
[in this window]
[in a new window]

 
FIGURE 1. Viral control is associated with shared MHC. Hemopoietic chimeras with varied degrees of MHC sharing were generated using the indicated donor bone marrow: BALB/c donor, CB6.F1 donor, or B6 congenic donor. Eight weeks postchimerism induction, animals were infected with 1 x 106 PFU LCMV clone 13 to initiate chronic infection. A, Viral titers from PBL at indicated time points represent the mean for ≥9 animals. B, Viral titers from day 127 postinfection. Line indicates median value. C, Weight loss is represented as the mean percentage of preinfection weight; dashed line indicates a severe weight loss threshold requiring euthanasia. D, Serum cytokines for day 98 postinfection. TNF-{alpha}, MCP-1, and IL-12p70 levels are shown; n = 3. Data from each figure are representative of three independent experiments. All error bars indicate SEM.

 
The differences in viral control were associated with significant clinical manifestations. All of the experimental groups experienced a similar degree of early weight loss (~15%) within the first 2 wk after infection. However, whereas body weight stabilized as the congenic and semi-MHC-disparate mixed chimeras began to control viremia, the fully MHC-disparate mixed chimeras exhibited progressive weight loss associated with their high-level viremic state (Fig. 1C). Analysis of serum from the infected MHC-disparate mixed chimeras 98 days postinfection revealed the presence of a systemic inflammatory state, characterized by high levels of the inflammatory cytokine TNF-{alpha} and the chemokine MCP-1. There was a trend toward increased IL-12p70, but this did not reach statistical significance. This cytokine storm was not present in the infected congenic or semi-MHC-disparate mixed chimeras (Fig. 1D).

Fully MHC-disparate mixed hemopoietic chimeras exhibit accelerated and more pronounced functional exhaustion of viral-specific T cells

To gain insight into the mechanisms that underlie the immune-deficient state in fully MHC-disparate mixed chimeras, we analyzed the number and functional properties of viral-specific T cells generated in the three experimental groups using MHC tetramers and detection of intracellular cytokines after ex vivo restimulation. In normal B6 mice, the prolonged exposure to high viral load after LCMV clone 13 infection results in a distinct pattern of epitope immunodominance and a spectrum of T cell responses. This ranges from deletion (Db/NP396, Ld/NP118) to varying degrees of functional impairment of viral-specific T cells (Db/gp33, Kb/NP205), before viremia is ultimately controlled by T cells that recognize subdominant epitopes (Db/gp276, Kd/gp283) (20, 37, 45).

The mice in each of the three experimental groups were infected as in the previous experiment, and splenocytes were harvested for analysis at monthly intervals. All groups showed transient expansion, followed by rapid deletion of the Db/NP396- and Ld/NP118-specific T cells (data not shown). Similarly, there was expansion of Db/gp33- and Db/gp276-specific T cells, as assessed by MHC tetramer-peptide staining in each of the different groups (Fig. 2, A and B). However, there were striking differences in the degree and rapidity of functional impairment of the Db/gp33 (>90% exhaustion at day 14)- and Db/gp276 (>90% by day 30)-specific T cells that was uniquely seen in fully MHC-disparate mixed chimeras (Fig. 2, B and C). This was manifest as a dramatic decrease in the percentage of these viral-specific T cells that were capable of IFN-{gamma} production in response to peptide stimulation relative to the other groups (Fig. 2C).


Figure 2
View larger version (38K):
[in this window]
[in a new window]

 
FIGURE 2. Lack of any MHC-shared alleles leads to a rapid and severe state of T cell exhaustion. Splenocytes from LCMV-infected chimeric mice were harvested and stained with MHC tetramers, or intracellular IFN-{gamma} after ex vivo restimulation with indicated viral peptides. A, Representative flow plots from day 98 gated on CD8+ splenocytes showing the percentage staining positive for MHC tetramer Db/gp276 (top), or intracellular gp276-induced IFN-{gamma} production after ex vivo restimulation (bottom), as well as the activation marker CD44 (y-axis). B, The absolute number of splenocytes staining positive for MHC tetramer Db/gp276 or Db/gp33 (open histogram) and the fraction capable of producing IFN-{gamma} upon ex vivo restimulation (shaded portion) for days 14 and 98. Each bar represents the mean of at least three mice; error bars represent SEM. C, Time course showing the mean fraction of Db/gp276 tetramer-staining cells capable of IFN-{gamma} production after a 5-h restimulation for the indicated time points postinfection (n = 3). Data are representative of two independent experiments.

 
Fully MHC-disparate mixed chimeras are unable to kill in a donor-restricted fashion

The ability of CTLs to recognize and kill infected cells is critically important for the control of intracellular bacteria and viruses (46, 47). To measure CTL function in the various mixed chimeras, we compared their ability to eliminate CB6.F1 (H-2bxd) target cells that had been pulsed with either donor (H-2d) or recipient (H-2b) MHC-restricted viral peptides in an in vivo killing assay. To generate targets for this assay, H-2dxb splenocytes were differentially labeled with both CFSE and CellTrace Far Red; each population was then pulsed with one of four virally derived peptides. These included the H-2b recipient-restricted peptides gp33 and gp276, and the H-2d donor-restricted peptides gp99 and gp283. The assay was internally controlled by inclusion of a reference target population that was not pulsed with peptide. Five hours after transfer of these targets to the infected chimeras, their elimination was compared with the unpulsed reference population and normalized to relative survival of the populations in a group of naive recipient mice, as described (43).

The congenic chimeras showed highly efficient killing of gp276 peptide-pulsed cells with much more limited killing of targets bearing the gp33 LCMV peptide (H-2b restricted) (Fig. 3). The lower levels of gp33-restricted killing may reflect the significantly fewer absolute numbers of gp33 tetramer+ T cells relative to gp276 tetramer+ cells or the degree of impaired IFN-{gamma} production, which was more pronounced for the gp33 epitope (see Fig. 2). H2b-restricted killing in semidisparate and fully MHC-disparate mixed chimeras was similar to that seen in congenic chimeras. However, there appeared to be a trend toward a diminished capacity to kill in fully disparate chimeras, although the data did not reach statistical significance. Furthermore, it is noteworthy that whereas the recipient-restricted response (Db/gp276) showed reduced capacity for IFN-{gamma} production (Fig. 2), there is a retained capacity for host cell-directed cytolysis, suggesting that the functional exhaustion is not complete. This is consistent with work from Wherry et al. (37) (our unpublished observations) showing distinct stages of exhaustion in the course of LCMV clone 13 infection.


Figure 3
View larger version (44K):
[in this window]
[in a new window]

 
FIGURE 3. Mismatched chimeras are unable to kill in a donor-restricted fashion. Chronically infected chimeras were given differentially fluorescence-labeled and peptide-pulsed splenocytes. Five distinct target populations are indicated (gated populations) and correspond with the peptide loading indicated in the naive plot (far left), which was used as a reference to calculate the relative percentage of specific killing (see Materials and Methods). A, Representative flow cytometry plots indicating the percentage of specific killing of peptide-pulsed targets (indicated directly above) in 5 h, 104 days postinfection for individual animals from each experimental group. The upper right population in each plot represents an internal (no peptide) control. B, Summary data of recipient (Db)- and donor (Kd)-restricted killing for each experimental group are shown, for the four indicated peptide epitopes (n = 3); error bars represent SEM; asterisk indicates p value of <0.05 for indicated epitope. Data are representative of two independent experiments.

 
H2d-restricted killing in congenic chimeras was undetectable. This is not surprising because these chimeras were never primed to virus in the presence of H2d restriction elements. Interestingly, the semi-MHC-disparate mixed chimeras showed a small, but reproducible ability to kill targets pulsed with either of the Kd-restricted peptides (gp283, 13.5 ± 1.8%; gp99, 6.8 ± 3.9% killing). Killing for gp283 was significantly greater in semi-MHC-disparate chimeras vs the other groups (p < 0.05); however, control of virus in these chimeras would not be absolutely dependent on this mode of killing. This is because both infected donor and recipient cells in these animals would also present H-2b restriction elements and would be susceptible to recipient-restricted killing as well. In contrast, the fully MHC-disparate mixed chimeras, although capable of killing in a recipient-restricted fashion, showed no detectable ability to lyse targets in an H-2d-restricted manner (Fig. 3; Ld/NP118-mediated killing was also undetectable; data not shown). Although there was no evidence for IFN-{gamma} production after restimulation with gp283 or gp99 peptides (data not shown), without tetramer staining we were unable to determine whether T cells directed against these epitopes have become exhausted or deleted. Nevertheless, the absence of killing toward these epitopes would be expected to limit the ability of CTL to control virus in infected donor cells that only express H-2d restriction elements.

Donor-restricted T cell help in chronically infected fully MHC-disparate mixed chimeras is impaired

Next, we explored the status of the humoral immune response after chronic virus infection in our chimeras as an indicator of a Th-dependent immune response. The delivery of donor-restricted CD4 T cell help in fully MHC-disparate chimeras was determined by assaying for class-switched IgG2aa allotype Ab that is produced by B cells bearing the allele derived from the BALB/c genotype and was distinguished from B6-derived IgG2ab allotype (22, 48). The overall level of LCMV-specific Abs was not significantly different among the chimeras 3 mo after infection (Fig. 4). As expected, the B6 congenic chimeras produced only B6-derived Ab (IgG2ab). Interestingly, despite having roughly equal numbers of donor- and recipient-derived B cells, the fully MHC-disparate mixed chimeras almost exclusively produced recipient-derived (IgG2ab) Ab (Fig. 4). This indicates that donor-derived B cells are not receiving cognate donor-restricted help from CD4 T cells, demonstrating a deficit in the presence or function of T cells that recognize LCMV in an I-Ad- or I-Ed-restricted manner. The Ab response in the semi-MHC-disparate mixed chimeras was comprised of both donor- and recipient-derived Ab. In this setting, the donor B cells have a mixed genotype, expressing both recipient and donor MHC class II and Ig allotypes. As such, they do not absolutely require donor-restricted CD4-derived help to class-switch.


Figure 4
View larger version (11K):
[in this window]
[in a new window]

 
FIGURE 4. Serum anti-LCMV Ab titers. Serum from LCMV-infected mice was analyzed at day 100 for class-switched LCMV-specific IgG2a Ab. The scatter plot indicates the log10 dilution at which detectable LCMV-specific IgG2a of allotype a (BALB/c derived, open symbols) or b (B6 derived, closed symbols) is detected. Horizontal line indicates mean value. Data are representative of two independent experiments.

 
Donor-derived cells are a reservoir for viral replication in fully MHC-disparate mixed chimeras

In light of the significant deficiency in the ability of the fully MHC-disparate mixed chimeras to produce effector cytokines or kill in a donor-restricted fashion, we hypothesized that the high viral load in these animals might be the result of unimpeded replication of virus in donor-derived cells. To test this, we compared the level of virus in donor- and recipient-derived cells in the different chimeras at various times using a mAb that is specific to the LCMV nucleoprotein (clone H113) in an intracellular staining flow cytometric assay (49). At 34 days postinfection, when virus is systemically present in all experimental groups (Fig. 1A), LCMV nucleoprotein was detected in both donor (CD45.2+)- and recipient (CD45.2)-derived cells, with no apparent preference (Fig. 5). However, the congenic and semi-MHC-disparate mixed chimeras have fewer infected cells in comparison with the fully MHC-disparate mixed chimeras at this time point, similar to results found in Fig. 1. Subsequently, analysis at 104 days postinfection reveals clear differences in the levels and cellular localization of virus in the different groups. First, the congenic and semi-MHC-disparate mixed chimeras that, at this time point, had low or undetectable levels of virus in the serum (Fig. 1) were negative for intracellular LCMV-NP. In contrast, the fully MHC-disparate mixed chimeras that continued to have high viral loads (Fig. 1) showed that virus was preferentially harbored in the donor-derived CD45.2+ population (Fig. 5). These findings support the notion that donor-derived cells in the fully MHC-disparate mixed chimeras are not targeted effectively and act as a reservoir for viral replication and persistence.


Figure 5
View larger version (51K):
[in this window]
[in a new window]

 
FIGURE 5. Viral persistence is associated with infection of donor-derived cells in MHC-disparate mixed chimeras. A, Representative flow plots indicating surface staining for the congenic marker CD45.2 (x-axis), which is present exclusively on donor-derived cells. A mAb specific for LCMV nucleoprotein (clone H113, y-axis) was used in an intracellular stain to indicate virally infected cells at day 34 (top) and day 104 (bottom). B, Summary data for virally infected cells that are either donor (CD45.2+) or recipient (CD45.2) derived (n = 3). Data are representative of two independent experiments.

 
Immune competence of MHC-disparate chimeras is partially restored by MHC class I matching

Next we sought to define the requirement for CD4 and CD8 donor-restricted responses for immune competence of mixed chimeras. Viral control and immune responses were evaluated using selected MHC-deficient bone marrow donors that expressed the full complement of H-2d MHC class I and II molecules, but expressed exclusively either the H-2b MHC class I or class II molecules, but not both. Using this approach, we could control whether the chimeras did or did not have the ability to directly survey donor cells bearing viral peptides using class I or class II recipient-restricted T cells. To accomplish this, we generated mixed chimeras in B6 mice using bone marrow from F1 donors that were a cross of BALB/c (H-2d) x B6 class I deficient (KbDb–/–) mice, which would restore recipient class II expression on the donor bone marrow, class II matched. Conversely, bone marrow from F1 donors that were a cross of BALB/c (H-2d) x B6 class II-deficient mice (MHC II{Delta}/{Delta}) would restore recipient class I expression on the donor bone marrow, class I matched.

The class II matched mixed chimeras showed a very similar degree of immunodeficiency to the fully MHC-disparate mixed chimeras, maintaining high viral titers for >4 mo postinfection (Fig. 6A). Additionally, these animals exhibited a corresponding profile of epitope exhaustion, in which gp276-specific CD8 T cells are present, but never recover a significant amount of function (Fig. 6B). Just as with the fully MHC-disparate mixed chimeras, the inability to kill targets in a donor-restricted fashion is defective in class II matched allogeneic mixed chimeras (data not shown), and as a result they harbor virally infected cells preferentially in their donor-derived cellular compartment (Fig. 6C). In contrast, MHC class I matched mixed chimeras show a partial restoration of immune competence (viral clearance) when compared with the fully MHC-disparate mixed chimeras (p < 0.05) (Fig. 6A). This was associated with maintenance of body weight and lower serum levels of inflammatory cytokines (data not shown). In addition, consistent with the improved viral clearance, the degree of T cell exhaustion was reduced, with larger numbers of IFN-{gamma} producing gp276-specific T cells when compared with the fully MHC-disparate mixed chimeras (see Fig. 2) or the class II matched allogeneic mixed chimeras 98 days postinfection (Fig. 6B). Finally, whereas a significant number of chimeras matched for MHC class I cleared virus, those that maintained high titers harbored virus equally in donor- and recipient-derived cells (Fig. 6C). Thus, it appears that MHC class II matching alone offers little or no degree of protection, whereas shared MHC class I appears to improve immune function, facilitating the control of chronic infections.


Figure 6
View larger version (34K):
[in this window]
[in a new window]

 
FIGURE 6. MHC class I matching partially restores immune competence. Mixed chimeras were set up with B6.CD45.1 recipients and CB6.F1 donors specifically deficient in either H2b class I or class II. Chimeras were then infected with LCMV clone 13. A, Day 127 viral titers for experimental chiimeras; line indicates the median value. B, Db/gp276 tetramer staining at day 98 (top) and corresponding IFN-{gamma} cytokine response upon ex vivo gp276 peptide restimulation (bottom); plots are gated on CD8+ splenocytes. Summary data represent the percentage of IFN-{gamma} function after ex vivo restimulation for Db/gp276 tetramer+ cells. C, Representative and summary (n = 3) data for intracellular LCMV-NP staining in donor- vs recipient-derived splenocytes at day 104 postinfection.

 
The inability to generate donor-restricted CD8 T cell responses is the result of impaired positive selection on recipient thymic epithelium

Although the hemopoietic compartment of the mixed chimeras is composed of approximately equal numbers of recipient and donor cells, the T cells arising in these chimeras develop within the recipient’s thymus (50). Thus, regardless of their genetic origin, the developing T cell precursors are selected exclusively on thymic epithelium of recipient origin (51). Therefore, we sought to determine whether the defective ability of fully MHC-disparate mixed chimeras to generate donor-restricted CD8+ antiviral responses was the result of inefficient positive selection of an effective T cell repertoire.

To explore this, we generated fully MHC-disparate mixed chimeras in athymic B6 nude mice using T-depleted BALB/c bone marrow. In conjunction with the donor bone marrow infusion, these recipient mice were reconstituted with a thymus transplant from a syngeneic (B6), an allogeneic (BALB/c), or semiallogeneic (CB6.F1) donor. These fully MHC-mismatched chimeric mice were challenged with 2 x 105 PFU of LCMV Armstrong, which shares all defined epitopes with clone 13, but offers the opportunity to clearly examine the restriction of the antiviral T cell response to multiple H-2b and H-2d dominant epitopes in an acute response.

Fully MHC-disparate mixed chimeras that received a B6 thymus mounted potent host-restricted responses to the Db/NP396 and Db/gp33 epitopes 8 days postinfection (Fig. 7), similar to the quality of responses in control nonchimeric B6 nude mice receiving a B6 thymus (data not shown). Furthermore, these same chimeras generated poor, but detectable donor-restricted responses to the Ld/NP118 epitope, indicating some degree of positive selection of a donor-restricted response (Fig. 7). In contrast, the anti-LCMV responses in fully MHC-disparate mixed chimeras receiving a BALB/c thymus transplant were dominated by the donor-restricted Ld/NP118 epitope, and responses to the host-restricted Db/NP396 and Db/gp33 epitopes were greatly compromised. Finally, mixed chimeras that had received a CB6.F1 thymus showed a broad-based response, including both donor- and recipient-directed T cells (Fig. 7B). These data support the notion that thymic epithelial cells primarily support positive selection, with perhaps a minor role for hemopoietically derived cells (19, 44, 51). Thus, in the setting of fully MHC-disparate mixed chimerism, the development of approaches that promote the selection of an adequate T cell repertoire may be an important consideration in providing robust immune protection against chronic viral infections residing in donor-derived cells.


Figure 7
View larger version (44K):
[in this window]
[in a new window]

 
FIGURE 7. Thymic parenchyma is the dominant determinant of T cell repertoire restriction in mixed chimeras. BALB/c->B6 nude chimeras were generated as above and given a B6, BALB/c, or CB6.F1 thymus under the kidney capsule at the time of induction. Ninety days after reconstitution, the resultant chimeras were infected with 2 x 105 PFU LCMV Armstrong. A, Representative flow plots display CD8+ (x-axis), IFN-{gamma}+ (y-axis) splenocytes after restimulation with the indicated peptide (Db/NP396, B6 or Ld/NP118, BALB/c) at the peak of the response, 8 days postinfection. B, The percentage of CD8+, IFN-{gamma} + cells in the spleen is shown for each indicated epitope. Error bars represent SEM, n = 4 for each group.

 
Adoptive T cell immunotherapy restores the immune competence of fully MHC-disparate mixed chimeras

To test whether gaps in the T cell repertoire play a major role in the immune incompetence of fully MHC-disparate mixed chimeras, we evaluated the ability of adoptively transferred T cells to restore control of chronic viral infections. Naive T cells from CB6.F1 donors were used for adoptive transfer because they are tolerant to both host (H-2b) and donor (H-2d) Ags, and more importantly, have been positively selected over an H2bxd environment. Fully MHC-disparate mixed chimeras were generated as above, and 48 h before challenge with LCMV clone 13, the mice were infused with either 1.2 x 107 CD4 T cells, 1.2 x 107 CD8 T cells, or a combination of both populations from CB6.F1 donors. Viral load was assessed over time, and as in our previous studies, fully MHC-disparate chimeras that did not receive T cells failed to control viral replication and maintained high-level viremia. Adoptive transfer of either CD4+ or CD8+ T cells alone led to trends toward improved viral clearance, but these did not achieve statistical significance (Fig. 8). However, fully MHC-disparate mixed chimeras reconstituted with both CD4+ and CD8+ T cells showed significantly improved viral control (Fig. 8, p < 0.05). This further supports our hypothesis that a primary mechanism underlying the immune deficiency of fully MHC-disparate mixed hemopoietic chimeras is the failure to generate a T cell repertoire that provides an adequate number of donor-restricted T cells.


Figure 8
View larger version (13K):
[in this window]
[in a new window]

 
FIGURE 8. T cell adoptive immunotherapy improves viral control. BALB/c->B6 mixed chimeras were generated as above. Forty-eight hours before LCMV clone 13 challenge, chimeras were given 12 x 106 naive CB6.F1-sorted CD4+ splenocytes, sorted CD8+ splenocytes, or 12 x 106 of each subset. Viral titers were followed, and are shown for day 127 postinfection. Line indicates median.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
In light of the increasing number of clinical trials using nonmyeloablative approaches to establish therapeutic chimerism across a range of MHC disparities in bone marrow and solid organ transplantation (1, 34, 52), we undertook studies to evaluate the immune competence of allogeneic mixed chimeras and to define the mechanisms underlying any observed immunodeficiencies. The results presented in this study demonstrate that, whereas the establishment of a state of stable multilineage mixed chimerism consistently promotes robust donor-specific transplantation tolerance, depending on the degree of MHC disparity this state does not necessarily confer immune competence. Rather, we observe that when the donor is fully MHC disparate, mixed chimeras have significant defects in protective immunity that become manifest after challenge with a persistent pathogen requiring a coordinated and sustained immune response to achieve viral control. The observation that fully MHC-disparate mixed chimeras exhibit sustained viremia coupled with a systemic inflammatory cytokine storm and progressive weight loss suggests that these recipients were indeed mounting an immune response, albeit an ineffective and possibly immunopathologic one.

At first glance, the immune deficiencies of the fully MHC-disparate mixed chimeras seem surprising given that the peripheral immune system of these chimeras contains approximately equivalent numbers of donor- and recipient-derived APC and T cells (data not shown). However, the donor or recipient genetic origin of T cells in the peripheral pool provides only the germline TCR segments available for rearrangement, but this does not supersede the epigenetic influences of the thymic selecting environment that ultimately determines the restriction and composition of the peripheral T cell repertoire (8, 50). The observation that T cell chimerism in these recipients develops over a period of several weeks suggests that the bulk of these donor-derived T cells emerged from the recipient’s thymus, where they will have undergone positive and negative selection on recipient thymic epithelium and on both recipient- and donor-derived dendritic cells. This observation is consistent with earlier observations in cross-species rat-to-mouse mixed chimeras, which have been shown to support host-restricted T cells derived from xenogeneic donors (50).

Conceptually, the immune deficiencies in fully MHC-disparate mixed chimeras could involve inadequacies of the T cell repertoire induced by either of two nonmutually exclusive mechanisms, as follows: 1) the introduction of donor hemopoietic cells to the recipient’s thymus could result in more extensive negative selection, thereby narrowing the T cell repertoire and potentially eliminating important pathogen-specific T cells (53), or alternatively, 2) positive selection in the recipient’s thymus may not support the development of an adequate pool of T cells capable of recognizing viral peptides presented on donor MHC molecules, thus compromising the elimination of infected cells of donor origin.

The wide range of tools and assays that are available to assess immune responses to LCMV allowed us to directly assess quantitative and qualitative aspects of the recipient- and donor-restricted anti-LCMV response in mixed chimeras. Our studies suggest that the principal defect in fully MHC-disparate mixed chimeras is the lack of a sufficient population of T cells that are capable of recognizing viral peptides presented by donor-MHC rather than a hole in the repertoire of T cells that recognize viral peptides presented on recipient-type MHC molecules. Although we have shown previously that low-level (~10-fold lower) donor-restricted responses are generated in fully MHC-disparate mixed chimeras and are adequate to clear an acute LCMV Armstrong infection (18), the data presented in this study indicate that these low-level responses are neither sustained nor sufficient to control the persistent LCMV clone 13 variant. The defective generation of a donor-restricted response was most clearly demonstrated by profound defects in the ability of fully MHC-disparate mixed chimeras to kill donor cells bearing viral peptides in an in vivo killing assay. This is consistent with earlier work showing a lack of donor-restricted killing using ex vivo killing assays (8). Similarly, the defective production of Ab from donor-derived B cells in the MHC-disparate mixed chimeras implies that defects in donor-restricted T cell help may play a role in viral persistence. Although not crucial for the humoral response, which can be supplied by recipient-derived B cells, the defects in donor-restricted help also may contribute to the profound defects in the generation and maintenance of donor-restricted CTL responses.

Evidence to support the conclusion that an insufficient pool of donor-restricted T cells is the primary defect in fully MHC-disparate mixed chimeras comes primarily from the observation that the adoptive transfer of donor-derived T cells that had been selected on donor MHC molecules during their thymic development can restore immune competence of fully MHC-disparate mixed chimeras. Furthermore, the observation that fully and semi-MHC-disparate mixed chimeras differ significantly in their immune competence despite presenting the same allo-Ags (H-2d) on donor-derived hemopoietic cells to developing thymocytes in the recipient thymus suggests that the immune defects in the fully disparate mixed allogeneic chimeras are not likely to be solely explained by excessive negative selection in this system. However, further studies could be undertaken to determine whether excessive negative selection also might contribute to defects in immune competence when a supraphysiologic number of MHC molecules are present during thymic selection, for example, if mixed chimerism were established using a donor bearing two different MHC haplotypes (e.g., H-2dxk) into a recipient bearing yet another two MHC haplotypes (e.g., H-2bxs) as would occur in fully MHC-disparate human transplants.

The observation that fully MHC-disparate chimeras have defects in generating donor-restricted responses is consistent with early studies suggesting that the nonhemopoietically derived thymic epithelial cells play a dominant role in positively selecting the T cell repertoire (51, 54, 55). Similarly, our thymic reconstitution experiments demonstrated that the thymic environment can dramatically alter the resulting T cell response to LCMV Armstrong in fully MHC-disparate mixed chimeras. In these experiments, the use of LCMV Armstrong allowed us to reproducibly study the restriction of the antiviral T cell response to multiple H-2b and H-2d dominant epitopes. Studies by several investigators in large animal models have shown that transplantation of the donor thymus can enhance tolerance induction (56, 57). It will also be interesting to determine whether thymic transplantation also has salutary effects on immune competence in the setting of persistent pathogenic challenges such as LCMV clone 13.

The functional consequence of the defective repertoire is that the fully MHC-disparate mixed chimeras are unable to detect and eliminate infected donor-derived cells upon challenge with a persisting pathogen such as LCMV clone 13. This immunological blind spot allows the donor-derived cells to act as a reservoir for ongoing viral replication that appears to perpetuate host-restricted T cell exhaustion as well. This was evident for subdominant Db/gp276 responses, which in congenic and semi-MHC-disparate mixed chimeras retain function and correlate with clearance, whereas in fully disparate chimeras this response loses IFN-{gamma} function, coincident with higher viral titers and immune pathology (37, 58). This is somewhat unexpected given that persistent virus was predominantly detected in donor-derived cells. However, it is possible that virus replication in donor cells leads to low-level recipient cell infection or chronic cross-presentation of viral peptides by recipient APC, contributing to enhanced exhaustion of the recipient-restricted T cells.

Our studies provide potential insights for the development of strategies to minimize immunodeficiency or restore immune competence in the setting of mixed hemopoietic chimerism. First, our studies emphasize the importance of MHC matching not only to minimize the barrier to tolerance induction, but also for the preservation of protective immunity. Our findings indicate that for the preservation of protective immunity, the degree of MHC incompatibility is not as critical as the degree of MHC sharing between donor and recipient. Fully incompatible chimeras, which do not share MHC, exhibit severe immunoincompetence, whereas an F1 donor (shared MHC) appears to reconstitute viral control. Notably, sharing of MHC class I by donor and recipient appears to be the more important factor for restoring competency. Chimeras without a shared class I Ag exhibit deficient donor-restricted killing, maintaining a viral reservoir exclusively in donor-derived cells. Studies of mixed chimerism induction in human transplantation have most commonly been done across either one or two MHC haplotype matches (1) (www.immunetolerance.org). However, in other protocols in which chimerism induction has been attempted across wider degrees of MHC disparity (34), chimerism has been transient. Although caution should be used in extrapolating from murine studies to the clinical setting, our studies nonetheless suggest that attention to the evaluation of protective immunity during clinical chimerism induction trials, particularly across greater degrees of MHC disparity, should be emphasized.

A second approach to restoring protective immunity, when chimerism is established in the absence of MHC matching, is adoptive T cell therapy to provide an adequate repertoire of T cells restricted by donor MHC alleles. As shown in our studies, this was most effective when both CD4 and CD8 donor T cells were transferred. Adoptive therapy of donor T cells enriched for viral specificities has been used clinically to enhance clearance of CMV, EBV, or EBV-related lymphomas in transplant recipients (59, 60). However, this has primarily been performed in the setting of MHC-matched transplantation. The major concern using this approach in the setting of mixed chimerism across MHC disparities will be the risk of inducing graft-vs-host disease. The development of approaches to selectively eliminate or inactivate T cells with graft-vs-host disease-inducing potential before or after transfer will be important for safe application of pre-emptive adoptive T cell therapy for the restoration of protective immunity in the setting of mixed chimerism-based therapies.


    Acknowledgments
 
We gratefully acknowledge Mandy Ford, Leslie Kean, John Wherry, Rachael Aubert, and Daniel Barber for helpful comments and insights, and Lisa M. Carlson for editorial assistance.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported in part by Research Grants AI44644 and AI040519 from the National Institutes of Health and by the Carlos and Marguerite Mason Trust. Back

2 Current address: Department of Immunology and Howard Hughes Medical Institute, University of Washington, Seattle, WA 98195. Back

3 Address correspondence and reprint requests to Dr. Christian P. Larsen, Emory Transplant Center, 5105 WMB, 101 Woodruff Circle, Atlanta, GA 30322. E-mail address: clarsen{at}emory.edu Back

4 Abbreviations used in this paper: LCMV, lymphocytic choriomeningitis virus; NP, nuclear protein. Back

Received for publication October 11, 2006. Accepted for publication June 6, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Fudaba, Y., T. R. Spitzer, J. Shaffer, T. Kawai, T. Fehr, F. Delmonico, F. Preffer, N. Tolkoff-Rubin, B. R. Dey, S. L. Saidman, et al 2006. Myeloma responses and tolerance following combined kidney and nonmyeloablative marrow transplantation: in vivo and in vitro analyses. Am. J. Transplant. 6: 2121-2133. [Medline]
  2. Sykes, M.. 2001. Mixed chimerism and transplant tolerance. Immunity 14: 417-424. [Medline]
  3. Kean, L. S., M. M. Durham, A. B. Adams, L. L. Hsu, J. R. Perry, D. Dillehay, T. C. Pearson, E. K. Waller, C. P. Larsen, D. R. Archer. 2002. A cure for murine sickle cell disease through stable mixed chimerism and tolerance induction after nonmyeloablative conditioning and major histocompatibility complex-mismatched bone marrow transplantation. Blood 99: 1840-1849. [Abstract/Free Full Text]
  4. Adams, A. B., M. M. Durham, L. Kean, N. Shirasugi, J. Ha, M. A. Williams, P. A. Rees, M. C. Cheung, S. Mittelstaedt, A. W. Bingaman, et al 2001. Costimulation blockade, busulfan, and bone marrow promote titratable macrochimerism, induce transplantation tolerance, and correct genetic hemoglobinopathies with minimal myelosuppression. J. Immunol. 167: 1103-1111. [Abstract/Free Full Text]
  5. Sykes, M., D. H. Sachs. 2001. Mixed chimerism. Philos. Trans. R. Soc. London B Biol. Sci. 356: 707-726. [Abstract/Free Full Text]
  6. Singer, A., K. S. Hathcock, R. J. Hodes. 1981. Self recognition in allogeneic radiation bone marrow chimeras: a radiation-resistant host element dictates the self specificity and immune response gene phenotype of T-helper cells. J. Exp. Med. 153: 1286-1301. [Abstract/Free Full Text]
  7. Zinkernagel, R. M., A. Althage, G. Callahan, R. M. Welsh, Jr. 1980. On the immunocompetence of H-2 incompatible irradiation bone marrow chimeras. J. Immunol. 124: 2356-2365. [Medline]
  8. Ruedi, E., M. Sykes, S. T. Ildstad, C. H. Chester, A. Althage, H. Hengartner, D. H. Sachs, R. M. Zinkernagel. 1989. Antiviral T cell competence and restriction specificity of mixed allogeneic (P1 + P2—P1) irradiation chimeras. Cell. Immunol. 121: 185-195. [Medline]
  9. Sharabi, Y., D. H. Sachs. 1989. Mixed chimerism and permanent specific transplantation tolerance induced by a nonlethal preparative regimen. J. Exp. Med. 169: 493-502. [Abstract/Free Full Text]
  10. Cobbold, S. P., G. Martin, S. Qin, H. Waldmann. 1986. Monoclonal antibodies to promote marrow engraftment and tissue graft tolerance. Nature 323: 164-166. [Medline]
  11. Wekerle, T., J. Kurtz, H. Ito, J. V. Ronquillo, V. Dong, G. Zhao, J. Shaffer, M. H. Sayegh, M. Sykes. 2000. Allogeneic bone marrow transplantation with co-stimulatory blockade induces macrochimerism and tolerance without cytoreductive host treatment. Nat. Med. 6: 464-469. [Medline]
  12. Larsen, C. P., E. T. Elwood, D. Z. Alexander, S. C. Ritchie, R. Hendrix, C. Tucker-Burden, H. R. Cho, A. Aruffo, D. Hollenbaugh, P. S. Linsley, et al 1996. Long-term acceptance of skin and cardiac allografts after blocking CD40 and CD28 pathways. Nature 381: 434-438. [Medline]
  13. Durham, M. M., A. W. Bingaman, A. B. Adams, J. Ha, S.-Y. Waitze, T. C. Pearson, C. P. Larsen. 2000. Administration of anti-CD40 ligand and donor bone marrow leads to hemopoietic chimerism and donor-specific tolerance without cytoreductive conditioning. J. Immunol. 165: 1-4. [Abstract/Free Full Text]
  14. Tomita, Y., A. Khan, M. Sykes. 1994. Role of intrathymic clonal deletion and peripheral anergy in transplantation tolerance induced by bone marrow transplantation in mice conditioned with a nonmyeloablative regimen. J. Immunol. 153: 1087-1098. [Abstract]
  15. Wekerle, T., M. H. Sayegh, J. Hill, Y. Zhao, A. Chandraker, K. G. Swenson, G. Zhao, M. Sykes. 1998. Extrathymic T cell deletion and allogeneic stem cell engraftment induced with costimulatory blockade is followed by central T cell tolerance. J. Exp. Med. 187: 2037-2044. [Abstract/Free Full Text]
  16. Ildstad, S. T., S. M. Wren, J. A. Bluestone, S. A. Barbieri, D. H. Sachs. 1985. Characterization of mixed allogeneic chimeras: immunocompetence, in vitro reactivity, and genetic specificity of tolerance. J. Exp. Med. 162: 231-244. [Abstract/Free Full Text]
  17. Morecki, S., B. Leshem, M. Weigensberg, S. Bar, S. Slavin. 1985. Functional clonal deletion versus active suppression in transplantation tolerance induced by total-lymphoid irradiation. Transplantation 40: 201-210. [Medline]
  18. Williams, M. A., A. B. Adams, M. B. Walsh, N. Shirasugi, T. M. Onami, T. C. Pearson, R. Ahmed, C. P. Larsen. 2003. Primary and secondary immunocompetence in mixed allogeneic chimeras. J. Immunol. 170: 2382-2389. [Abstract/Free Full Text]
  19. Martinic, M. M., T. Rulicke, A. Althage, B. Odermatt, M. Hochli, A. Lamarre, T. Dumrese, D. E. Speiser, D. Kyburz, H. Hengartner, R. M. Zinkernagel. 2003. Efficient T cell repertoire selection in tetraparental chimeric mice independent of thymic epithelial MHC. Proc. Natl. Acad. Sci. USA 100: 1861-1866. [Abstract/Free Full Text]
  20. Van der Most, R. G., A. Sette, C. Oseroff, J. Alexander, K. Murali-Krishna, L. L. Lau, S. Southwood, J. Sidney, R. W. Chesnut, M. Matloubian, R. Ahmed. 1996. Analysis of cytotoxic T cell responses to dominant and subdominant epitopes during acute and chronic lymphocytic choriomeningitis virus infection. J. Immunol. 157: 5543-5554. [Abstract]
  21. Zajac, A. J., J. N. Blattman, K. Murali-Krishna, D. J. Sourdive, M. Suresh, J. D. Altman, R. Ahmed. 1998. Viral immune evasion due to persistence of activated T cells without effector function. J. Exp. Med. 188: 2205-2213. [Abstract/Free Full Text]
  22. Planz, O., S. Ehl, E. Furrer, E. Horvath, M. A. Brundler, H. Hengartner, R. M. Zinkernagel. 1997. A critical role for neutralizing-antibody-producing B cells, CD4+ T cells, and interferons in persistent and acute infections of mice with lymphocytic choriomeningitis virus: implications for adoptive immunotherapy of virus carriers. Proc. Natl. Acad. Sci. USA 94: 6874-6879. [Abstract/Free Full Text]
  23. Brooks, D. G., L. Teyton, M. B. Oldstone, D. B. McGavern. 2005. Intrinsic functional dysregulation of CD4 T cells occurs rapidly following persistent viral infection. J. Virol. 79: 10514-10527. [Abstract/Free Full Text]
  24. Matloubian, M., R. J. Concepcion, R. Ahmed. 1994. CD4+ T cells are required to sustain CD8+ cytotoxic T-cell responses during chronic viral infection. J. Virol. 68: 8056-8063. [Abstract/Free Full Text]
  25. Kalams, S. A., B. D. Walker. 1998. The critical need for CD4 help in maintaining effective cytotoxic T lymphocyte responses. J. Exp. Med. 188: 2199-2204. [Free Full Text]
  26. Matloubian, M., S. R. Kolhekar, T. Somasundaram, R. Ahmed. 1993. Molecular determinants of macrophage tropism and viral persistence: importance of single amino acid changes in the polymerase and glycoprotein of lymphocytic choriomeningitis virus. J. Virol. 67: 7340-7349. [Abstract/Free Full Text]
  27. Awadalla, Y., P. Randhawa, K. Ruppert, A. Zeevi, R. J. Duquesnoy. 2004. HLA mismatching increases the risk of BK virus nephropathy in renal transplant recipients. Am. J. Transplant. 4: 1691-1696. [Medline]
  28. Bruce, D. S., K. A. Newell, M. A. Josephson, E. S. Woodle, J. B. Piper, J. M. Millis, D. S. Seaman, C. L. Carnrike, Jr, E. Huss, J. R. Thistlethwaite, Jr. 1996. Long-term outcome of kidney-pancreas transplant recipients with good graft function at one year. Transplantation 62: 451-456. [Medline]
  29. Davis, C. L.. 1990. The prevention of cytomegalovirus disease in renal transplantation. Am. J. Kidney Dis. 16: 175-188. [Medline]
  30. Hafiz, M. M., R. Poggioli, A. Caulfield, S. Messinger, M. C. Geiger, D. A. Baidal, T. Froud, J. V. Ferreira, A. G. Tzakis, C. Ricordi, R. Alejandro. 2004. Cytomegalovirus prevalence and transmission after islet allograft transplant in patients with type 1 diabetes mellitus. Am. J. Transplant. 4: 1697-1702. [Medline]
  31. Hirsch, H. H., W. Knowles, M. Dickenmann, J. Passweg, T. Klimkait, M. J. Mihatsch, J. Steiger. 2002. Prospective study of polyomavirus type BK replication and nephropathy in renal-transplant recipients. N. Engl. J. Med. 347: 488-496. [Abstract/Free Full Text]
  32. Fischer, S. A., M. B. Graham, M. J. Kuehnert, C. N. Kotton, A. Srinivasan, F. M. Marty, J. A. Comer, J. Guarner, C. D. Paddock, D. L. DeMeo, et al 2006. Transmission of lymphocytic choriomeningitis virus by organ transplantation. N. Engl. J. Med. 354: 2235-2249. [Abstract/Free Full Text]
  33. Koehn, B., S. Gangappa, J. D. Miller, R. Ahmed, C. P. Larsen. 2006. Patients, pathogens, and protective immunity: the relevance of virus-induced alloreactivity in transplantation. J. Immunol. 176: 2691-2696. [Abstract/Free Full Text]
  34. Strober, S., R. J. Lowsky, J. A. Shizuru, J. D. Scandling, M. T. Millan. 2004. Approaches to transplantation tolerance in humans. Transplantation 77: 932-936. [Medline]
  35. Madsen, L., N. Labrecque, J. Engberg, A. Dierich, A. Svejgaard, C. Benoist, D. Mathis, L. Fugger. 1999. Mice lacking all conventional MHC class II genes. Proc. Natl. Acad. Sci. USA 96: 10338-10343. [Abstract/Free Full Text]
  36. Perarnau, B., M. F. Saron, B. R. San Martin, N. Bervas, H. Ong, M. J. Soloski, A. G. Smith, J. M. Ure, J. E. Gairin, F. A. Lemonnier. 1999. Single H2Kb, H2Db and double H2KbDb knockout mice: peripheral CD8+ T cell repertoire and anti-lymphocytic choriomeningitis virus cytolytic responses. Eur. J. Immunol. 29: 1243-1252. [Medline]
  37. Wherry, E. J., J. N. Blattman, K. Murali-Krishna, R. van der Most, R. Ahmed. 2003. Viral persistence alters CD8 T-cell immunodominance and tissue distribution and results in distinct stages of functional impairment. J. Virol. 77: 4911-4927. [Abstract/Free Full Text]
  38. Kean, L. S., K. Hamby, B. Koehn, E. Lee, S. Coley, L. Stempora, A. B. Adams, E. Heiss, T. C. Pearson, C. P. Larsen. 2006. NK cells mediate costimulation blockade-resistant rejection of allogeneic stem cells during nonmyeloablative transplantation. Am. J. Transplant. 6: 292-304. [Medline]
  39. Murali-Krishna, K., J. D. Altman, M. Suresh, D. Sourdive, A. Zajac, R. Ahmed. 1998. In vivo dynamics of anti-viral CD8 T cell responses to different epitopes: an evaluation of bystander activation in primary and secondary responses to viral infection. Adv. Exp. Med. Biol. 452: 123-142. [Medline]
  40. Ahmed, R., A. Salmi, L. D. Butler, J. M. Chiller, M. B. Oldstone. 1984. Selection of genetic variants of lymphocytic choriomeningitis virus in spleens of persistently infected mice: role in suppression of cytotoxic T lymphocyte response and viral persistence. J. Exp. Med. 160: 521-540. [Abstract/Free Full Text]
  41. Cook, E. B., J. L. Stahl, L. Lowe, R. Chen, E. Morgan, J. Wilson, R. Varro, A. Chan, F. M. Graziano, N. P. Barney. 2001. Simultaneous measurement of six cytokines in a single sample of human tears using microparticle-based flow cytometry: allergics vs. non-allergics. J. Immunol. Methods 254: 109-118. [Medline]
  42. Morgan, E., R. Varro, H. Sepulveda, J. A. Ember, J. Apgar, J. Wilson, L. Lowe, R. Chen, L. Shivraj, A. Agadir, et al 2004. Cytometric bead array: a multiplexed assay platform with applications in various areas of biology. Clin. Immunol. 110: 252-266. [Medline]
  43. Barber, D. L., E. J. Wherry, R. Ahmed. 2003. Cutting edge: rapid in vivo killing by memory CD8 T cells. J. Immunol. 171: 27-31. [Abstract/Free Full Text]
  44. Zinkernagel, R. M., A. Althage, E. Waterfield, B. Kindred, R. M. Welsh, G. Callahan, P. Pincetl. 1980. Restriction specificities, alloreactivity, and allotolerance expressed by T cells from nude mice reconstituted with H-2-compatible or -incompatible thymus grafts. J. Exp. Med. 151: 376-399. [Abstract/Free Full Text]
  45. Van der Most, R. G., K. Murali-Krishna, J. G. Lanier, E. J. Wherry, M. T. Puglielli, J. N. Blattman, A. Sette, R. Ahmed. 2003. Changing immunodominance patterns in antiviral CD8 T-cell responses after loss of epitope presentation or chronic antigenic stimulation. Virology 315: 93-102. [Medline]
  46. Kagi, D., P. Seiler, J. Pavlovic, B. Ledermann, K. Burki, R. M. Zinkernagel, H. Hengartner. 1995. The roles of perforin- and Fas-dependent cytotoxicity in protection against cytopathic and noncytopathic viruses. Eur. J. Immunol. 25: 3256-3262. [Medline]
  47. Doherty, P. C., J. M. Riberdy, G. T. Belz. 2000. Quantitative analysis of the CD8+ T-cell response to readily eliminated and persistent viruses. Philos. Trans. R. Soc. London B Biol. Sci. 355: 1093-1101. [Abstract/Free Full Text]
  48. Stevens, T. L., A. Bossie, V. M. Sanders, R. Fernandez-Botran, R. L. Coffman, T. R. Mosmann, E. S. Vitetta. 1988. Regulation of antibody isotype secretion by subsets of antigen-specific helper T cells. Nature 334: 255-258. [Medline]
  49. Barber, D. L., E. J. Wherry, D. Masopust, B. Zhu, J. P. Allison, A. H. Sharpe, G. J. Freeman, R. Ahmed. 2006. Restoring function in exhausted CD8 T cells during chronic viral infection. Nature 439: 682-687. [Medline]
  50. Colson, Y. L., R. A. Tripp, P. C. Doherty, S. M. Wren, M. Neipp, A. Y. Abou El-Ezz, S. T. Ildstad. 1998. Antiviral cytotoxic activity across a species barrier in mixed xenogeneic chimeras: functional restriction to host MHC. J. Immunol. 160: 3790-3796. [Abstract/Free Full Text]
  51. Bevan, M. J., P. J. Fink. 1978. The influence of thymus H-2 antigens on the specificity of maturing killer and helper cells. Immunol. Rev. 42: 3-19. [Medline]
  52. Starzl, T. E.. 2004. Chimerism and tolerance in transplantation. Proc. Natl. Acad. Sci. USA 101: (Suppl. 2):14607-14614. [Abstract/Free Full Text]
  53. Turner, S. J., P. C. Doherty, J. McCluskey, J. Rossjohn. 2006. Structural determinants of T-cell receptor bias in immunity. Nat. Rev. Immunol. 6: 883-894. [Medline]
  54. Singer, A.. 1988. Experimentation and thymic selection. J. Immunol. 140: 2481-2483. [Medline]
  55. Matzinger, P.. 1993. Why positive selection?. Immunol. Rev. 135: 81-117. [Medline]
  56. Nobori, S., E. Samelson-Jones, A. Shimizu, Y. Hisashi, S. Yamamoto, C. Kamano, K. Teranishi, P. A. Vagefi, M. Nuhn, M. Okumi, et al 2006. Long-term acceptance of fully allogeneic cardiac grafts by cotransplantation of vascularized thymus in miniature swine. Transplantation 81: 26-35. [Medline]
  57. Johnston, D. R., A. Muniappan, R. Hoerbelt, D. A. Guenther, T. Shoji, S. L. Houser, D. H. Sachs, J. C. Madsen. 2005. Heart and en-bloc thymus transplantation in miniature swine. J. Thorac. Cardiovasc. Surg. 130: 554-559. [Abstract/Free Full Text]
  58. Klenerman, P., A. Hill. 2005. T cells and viral persistence: lessons from diverse infections. Nat. Immunol. 6: 873-879. [Medline]
  59. Babel, N., M. H. Hammer, P. Reinke. 2003. [Adoptive transfer of Epstein-Barr virus-specific T-lymphocytes in chronic active Epstein-Barr infection]. Dtsch. Med. Wochenschr. 128: 548-550. [Medline]
  60. Savoldo, B., M. H. Huls, Z. Liu, T. Okamura, H. D. Volk, P. Reinke, R. Sabat, N. Babel, J. F. Jones, J. Webster-Cyriaque, et al 2002. Autologous Epstein-Barr virus (EBV)-specific cytotoxic T cells for the treatment of persistent active EBV infection. Blood 100: 4059-4066. [Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Koehn, B. H.
Right arrow Articles by Larsen, C. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Koehn, B. H.
Right arrow Articles by Larsen, C. P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS