HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Hager, E. Articles by Gapin, L. Search for Related Content PubMed PubMed Citation Articles by Hager, E. Articles by Gapin, L.

Multiple Constraints at the Level of TCR Rearrangement Impact V14i NKT Cell Development¹

Elizabeth Hager^2,*, Abbas Hawwari, Jennifer L. Matsuda^*, Michael S. Krangel and Laurent Gapin^3,*

^* Integrated Department of Immunology, National Jewish Medical and Research Center, University of Colorado Health Science Center, Denver, CO 80206; and Department of Immunology, Duke University Medical Center, Durham, NC 27710

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
CD1d-restricted NKT cells that express an invariant V14 TCR represent a subset of T cells implicated in the regulation of several immune responses, including autoimmunity, infectious disease, and cancer. Proper rearrangement of V14 with the J18 gene segment in immature thymocytes is a prerequisite to the production of a TCR that can be subsequently positively selected by CD1d/self-ligand complexes in the thymus and gives rise to the NKT cell population. We show here that V14 to J rearrangements are temporally regulated during ontogeny providing a molecular explanation to their late appearance in the thymus. Using mice deficient for the transcription factor ROR and the germline promoters T early- and J49, we show that developmental constraints on both V and J usage impact NKT cell development. Finally, we demonstrate that rearrangements using V14 and J18 occur normally in the absence of FynT, arguing that the effect of FynT on NKT cell development occurs subsequent to -chain rearrangement. Altogether, this study provides evidence that there is no directed rearrangement of V14 to J18 segments and supports the instructive selection model for NKT cell selection.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
During thymocyte development, TCR - and -chain gene rearrangements occur in two phases driven by RAG-1 and RAG-2 recombinases. In the first phase, recombination of TCR V, D, and J region gene segments is initiated in CD4^–CD8^– double-negative thymocytes. If the rearrangement is productive, the in-frame -chain combines with pre-T -chain and CD3 components thus forming a pre-TCR complex at the cell surface, which initiates differentiation and proliferation of CD4⁺CD8⁺ double-positive (DP)⁴ thymocytes. In the second phase of recombination, primary rearrangements of TCR VJ gene segments are essentially initiated in DP thymocytes. Successful rearrangement and expression of TCR genes is marked by an increase in cell surface TCR/CD3 levels. However, TCR recombination and RAG expression persist until a productive interaction between TCR and self MHC occurs during positive selection. If positive selection does not occur, secondary V-J rearrangement proceeds to replace failed primary rearrangements (1). TCR recombination begins at the 5' end of the J cluster and progresses to the 3' Js during thymocyte maturation. Analysis of V-J usage has revealed that a majority of peripheral T cells have undergone secondary V-J rearrangement thus highlighting the importance of secondary rearrangement in the generation of the T cell repertoire (1).

NKT cells are a unique lymphocyte lineage that coexpress a rearranged TCR in association with the CD3 complex as well as several receptors first identified on bona fide NK cells, such as NK1.1, the IL-2/15R -chain (CD122), and various Ly49 molecules. NKT cells recognize glycolipid Ags bound to the MHC-related molecule CD1d (2). Following TCR stimulation, NKT cells rapidly secrete an array of cytokines, including IL-4, IFN-, and TNF-, resulting in the activation of NK cells, macrophages, dendritic cells, and cells of the adaptive immune system including B lymphocytes and memory T cells (3). The early and potent response of NKT cells may provide an important link between the innate and adaptive immune systems (3, 4). Consistent with this, NKT cells appear to be important for responses to tumors, infectious agents, the maintenance of self tolerance, and the prevention of autoimmunity (3, 5).

In the mouse, the vast majority of NKT cells express a semi-invariant TCR composed of a specific canonical V14-J18 rearrangement. The corresponding designation of this rearrangement from the international ImmMunoGeneTics Information System (IMGT) (6) is ADV11-TRAJ18. However, in the interest of maintaining backward compatibility with a large amount of literature regarding NKT cells, we have chosen to retain the nomenclature of Arden et al. (7).

This V14-J18 rearrangement is found preferentially associated with either V8.2 (TRBV13-2), V7 (TRBV29), or V2 (TRBV1) (8, 9, 10). We refer to this CD1d-reactive subgroup as V14 invariant (V14i) NKT cells to distinguish them from other populations of NKT cells that have been defined (3, 11). These cells are almost uniformly reactive to the pharmacological ligand, -galactosylceramide (GalCer) (12, 13) and can be readily detected using GalCer/CD1d tetramers (14, 15). The rearrangement of the V14 to J18 gene segment takes places in uncommitted DP CD4⁺CD8⁺ thymocytes (16, 17). Following TCR expression at the cell surface, the cells are positively selected by other DP cortical thymocytes expressing CD1d (18, 19). Following positive selection, V14i⁺ T cells expand and undergo several maturation events leading to the late fate commitment to the NKT cell lineage and the acquisition of their unique attributes (20).

Several mutations in genes of various cytokines and their receptors, transcription factors, and cell-signaling molecules have been shown to specifically affect V14i NKT cell development (20). Of interest, mice deficient in the Src tyrosine kinase, FynT, are severely impaired in V14i NKT cell development while numbers of NK cells and other T cell subsets are relatively normal (17, 21, 22). Intriguingly, introduction of a prerearranged V14-J18 chain transgene into FynT^–/– mice could rescue this defect (23). These results suggested that in absence of FynT, V14i NKT cell development was arrested very early perhaps before TCR -chain rearrangement. However, it is not clear how a deficiency in a downstream signaling molecule such as FynT, can be substituted by a prerearranged TCR.

Recently, mice deficient for the retinoic acid receptor-related orphan receptor (ROR) and its thymus-specific isoform RORt were also reported to lack V14i NKT cells (24, 25). By regulating the survival window of DP thymocytes, RORt was shown to control TCR rearrangements and limit the usage of 3' J gene segments, including J18 (26). Reminiscent of the results obtained with FynT^–/– mice, introduction of the prerearranged V14-J18 TCR into the ROR^–/– background also restored V14i NKT cell development (24).

In addition, a role for FynT in the generation of DP thymocytes and in the apoptosis of thymocytes has been proposed (27, 28, 29, 30), suggesting a possible relationship between FynT and RORt in the control of TCR repertoire diversity, and by extension, in the development of V14i NKT cells.

In this study, we have examined TCR rearrangements involving the V14 gene segment in the course of ontogeny and tested the hypothesis that FynT might play a role in the TCR rearrangement process. We show that V14-J rearrangements are temporally regulated during thymic ontogeny and that constraints at the level of both J and V usage impact V14i NKT cell development. Our results demonstrate that TCR rearrangements involving the V14 gene segment occur similarly to other V gene segments previously examined, arguing against a precommitment model of V14i NKT cell development. Finally, we show that rearrangements using the V14 gene segment occur normally in absence of FynT.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Mice

C57BL/6 and B6;129S7-Fyn^tm1Sor/J congenic mice were purchased from The Jackson Laboratory. J18^–/– B6 congenic mice were a gift of M. Taniguchi (Chiba University, Chiba, Japan). CD1d^–/– B6 congenic mice were originally generated by L. Van Kaer and colleagues (Vanderbilt University, Nashville, TN). ROR^–/– and TEA^–/–J49^–/– mice have been described previously (26, 31). Mouse strains were bred and maintained in the Center for Laboratory Animal Care facility at the University of Colorado Health Sciences Center (Denver, CO) and the Duke University Medical Center (Durham, NC). Unless specified otherwise, mice were used for experiments between 4 and 12 wk of age. Handling of mice and experimental procedures were in accordance with institutional requirements for animal care and use.

Genomic V-to-J rearrangement analysis

Multiplex PCR strategy has been previously described (32). Briefly, genomic DNA was isolated from thymocytes using DNAzol (Molecular Research Center) and was amplified using an upstream primer specific for the V14 gene segment paired with various downstream primers specific for J(x) gene segments (where x is 56, 48, 40, 33, 27, 23, 18, 16, 9, or 2). Each primer pair amplified the specific V14-J(x) rearrangement, and additionally, a limited set (between 2 and 4) of rearrangements resulting from V14 joining to J gene segments 5' to the targeted J(x). Primers and probes used in this study have been described previously (32, 33) with the exception of the following: AJ18, TCCCTGGAGTAGAAAGAAACCTACTCAC; AJ18 probe, CAGGTATGACAATCAGCTGAGTCCC; V14, GTCCTCAGTCCCTGGTTGTC; V14 probe, TGGGAGATACTCAGCAACTCTGG; C forward, CCTCTGCCTGTTCACCGACTT; C reverse, CAGTCAACGTGGCATCACA. Amplifications were performed with Expand High-Fidelity Polymerase (Roche Applied Science) (1.75 U/reaction) using the following PCR conditions: 5 min at 94°C, 26 cycles of 1 min at 94°C, 1 min at 58°C, 6 min at 72°C, and 10 min at 72°C. Maximum PCR product sizes ranged between 5 and 6 kb. Controls for each PCR run included a positive control for the C gene segment. PCR products were resolved on 1.5% agarose gels and blotted onto nylon membranes for Southern analysis. Oligo probes for Southern blot analysis of PCR products were labeled using the Digoxigenin Oligonucleotide 3'-End Labeling kit (Roche Applied Science). Digoxigenin-labeled probes were hybridized to PCR products and were detected by chemiluminescent technique per manufacturer’s recommendations or ³²P-labeled oligonucleotide probes as previously described (31).

RT-PCR analysis of V14 usage

RNA was isolated from total thymocytes using TRIzol (Invitrogen Life Technologies) according to the manufacturer’s instructions. cDNA was synthesized using Moloney’s murine leukemia virus reverse transcriptase and oligo(dT) primers. V14-C PCR products were amplified, fractionated by 1.0% agarose gel electrophoresis, transferred to nylon membranes, and hybridized with a ³²P-labeled C probe.

Flow cytometry

Thymocytes were stained for the presence of the V14i NKT cell population based on staining for TCR (clone H57-597; eBioscience) and reactivity with GalCer-CD1d tetramer, as previously described (15). Biotinylated mouse CD1d monomers were provided by the National Institutes of Health Tetramer Facility.

	Results

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Analysis of V14-J rearrangements in the adult thymus

We qualitatively measured the occurrence of genomic TCR rearrangements using the V14 segment with J(x) segments in thymocytes of C57BL/6 and J18^–/– mice. Multiplex PCR assay for amplification of rearranged genomic sequences was performed using a specific V14 primer paired with specific J(x) primers that span the entire J locus (Fig. 1A). This technique allows for one-tube amplification of DNA rearrangements of a given V with three to four juxtaposed J gene segments contained within a targeted region. Amplification of the C locus served as a positive control for each PCR run (data not shown). The hybridization patterns and band intensities shown in Fig. 1B are typical of the V-J(x) rearrangements that we consistently observed with the thymus of adult C57BL/6 mice. Detailed analysis of the V14 rearrangement pattern revealed 30 different V14-J rearrangements involving 5', central, and 3' J segments (Fig. 1B). Similar patterns were obtained with a V14 probe or a mixture of J probes. Detection of V14-J18 rearrangements was obtained by two independent PCRs using primers specific for the genomic sequence 3' of J18 and J16, respectively. We confirmed the specificity of V14-J18 rearrangements in this assay by comparing thymocytes of adult C57BL/6 mice to J18^–/– mice (Fig. 1C) in which similar rearrangements were detected with the notable absence of V14-J18 rearrangements in the J18^–/– thymocytes.

View larger version (58K): [in this window] [in a new window]   FIGURE 1. V14-J(x) rearrangements analyzed using multiplex PCR assay and Southern blot. A, Diagram of the TCR -chain locus. The V14 gene segment is shown upstream of the J locus; the C locus and the -chain enhancer elements are shown just downstream of the J locus. Dots indicate where each J(x) primer anneals and the corresponding targeted gene segment that is amplified between V14-J(x) primers; horizontal solid lines stemming from the dots indicate additional 5' J(x) gene segments amplified from those primers; vertical dotted lines indicate J pseudogenes. B, Southern blot of multiplex PCR products of adult C57BL/6 thymocyte DNA amplified between V14-J(x) primers. PCR are resolved on a 1.5% agarose gel, blotted to a nylon membrane, and hybridized with either a V14 probe (left) or a mixtures of specific J probes (right). Similar results were obtained regardless of the probes used with the exception of a nonspecific band denoted by * for J4 when the V14 probe was used. Numbers along the top identify J(x) primers and their corresponding probes. Numbers appearing in the lanes indicate specific V14-J(x) gene rearrangements that were detected. C, Southern blot of adult J18–/– thymocyte DNA multiplex PCR product.

V14-J rearrangement during ontogeny

We next examined when during ontogeny these rearrangement patterns are established. Fig. 2 shows results of multiplex PCR assay performed on genomic DNA of C57BL/6 thymocytes harvested at various pre- and postnatal time points. By fetal day 19, V14 rearrangements to J gene segments more 3' to J27 (including J18) occurred at a very low frequency, at best, relative to that of adult thymocytes (Fig. 2). Longer film exposure times did not increase the intensities of hybridization signals in lanes appearing to have little or no PCR products reflective of V14-J(x) rearrangements (data not shown). By F20, however, rearrangements of V14 with J18 and the more 3' J gene segments started to be detectable (Fig. 2). Comparison of V14-J(x) hybridization signals of 2-day-old, 2-wk old, and adult samples revealed increasing levels of rearrangements involving the 3' J gene segments closer to the C gene as a function of age. These results are in agreement with previous data in which different Vs were analyzed (32). The first V14 to J18 gene rearrangements were detectable within a 24–48 h window before birth and by day 2, levels of rearrangements were close to that of an adult.

View larger version (37K): [in this window] [in a new window]   FIGURE 2. Developmental appearance of V14-J18 TCR rearrangements. Multiplex PCR and Southern blot analysis of V14-J(x) rearrangements in thymocytes of C57BL/6 mice ranging in age from fetal day 19 to adulthood. Results obtained with the V14 probe are shown. Results from the 8-wk-old mice correspond to the same experiment shown in Fig. 1B. Similar results were obtained with the J probe mix (data not shown).

V14i NKT cells are absent in ROR^–/– and TEA^–/–J49^–/– x ROR^–/– mice

Our previous results suggest that during ontogeny, rearrangements involving the V14 gene segment proceed at a controlled rate with rearrangement position determined by the age of the DP thymocytes (Fig. 2). In adult mice, DP thymocyte lifespan also determines to what extent TCR rearrangements progress along the length of the J array (26). The transcription factor ROR controls DP thymocyte lifespan through its regulation of Bcl-x_L expression (26). DP thymocyte lifespan in ROR-deficient mice is largely decreased and TCR rearrangements are limited almost exclusively to J gene segments located at the 5' end of the J array (J61 to J45) (26, 31). These rearrangements depend on the Tcr enhancer (E) (34) which activates the T early- (TEA) and J49 promoters (31, 35). Germline transcripts initiated from these promoters are important contributors to the accessibility of the TCR locus in vivo (36). It was recently shown that the presence of these transcripts increases the recombination of the J segments located within several kilobases of the promoters and prevents the activation of downstream promoters through transcriptional interference (36). Deletion of the TEA and J49 promoters leads to the derepression of central promoters and retargeting of primary rearrangements to central J gene segments (31). We wondered whether redirecting primary rearrangement to the central region of the J array would be sufficient to restore J18 usage and the V14i NKT cell population, even in the absence of ROR. To this end, ROR^–/– mice were crossed with double-deficient TEA^–/– J49^–/– mice. In agreement with previous results (24, 25), no GalCer/CD1d tetramer⁺ cells were detected in the thymus of ROR^–/– mice. However, deletion of the TEA and J49 promoters was not sufficient to restore the V14i NKT cell population in absence of ROR^–/– (Fig. 3).

View larger version (26K): [in this window] [in a new window]   FIGURE 3. V14i NKT cells are absent from the thymus of ROR–/– and ROR–/– x TEA–/–J49–/– mice. (A) Thymocytes from WT (129 and C57BL/6), ROR–/–, and ROR–/– x TEA–/–J49–/– or (B) TEA–/–J49–/– or ROR–/– x TEA–/–J49–/– mice were stained using PE-labeled GalCer/CD1d tetramer and PE-Cy5-labeled anti-TCR mAbs. Percentage of cells that are TCR+tetramer+ positive is indicated.

Analysis of V8-J and V14-J rearrangements and transcripts in the thymus of ROR^–/– and TEA^–/–J49^–/– x ROR^–/– mice

The absence of V14i NKT cell in the thymus of TEA^–/–J49^–/– x ROR^–/– was surprising, and suggested that proper V14-J18 rearrangements might not happen in these mice. To further investigate this possibility, rearrangements involving V14 or another control V gene segment, V8, were analyzed by PCR of genomic DNA from the thymus of wild-type (WT), ROR^–/–, TEA^–/–J49^–/–, and TEA^–/–J49^–/– x ROR^–/– mice. In WT mice, V8 rearranged with the whole array of Js, as illustrated by the presence of PCR products corresponding to V8-J50 and V8-J18 rearrangements. TEA^–/–J49^–/– mice displayed decreased J50 and increased J18 rearrangement relative to WT, as expected due to the refocusing of rearrangement events by deletion of the TEA and J49 promoters (Fig. 4A). In ROR^–/– mice, V8-J50 rearrangements were still detected, but V8-J18 rearrangements were not, consistent with a strong 5' bias to J usage in these mice. Notably, rearrangements involving the V14 gene segment, either with J50 or J18, were also dramatically reduced in ROR-deficient mice (Fig. 4A). This may reflect the fact that V14 segments are located further 5' in the V array than several of the V8 family members, and that 5' V segments are not used efficiently in short-lived DP thymocytes.

View larger version (81K): [in this window] [in a new window]   FIGURE 4. TCR rearrangement constraints in absence of ROR. A, Assessment of V-J rearrangements in WT (+/+), ROR–/–, TEA–/–J49–/–, and ROR–/– x TEA–/–J49–/– thymocytes. Three-fold serial dilutions of genomic DNA were amplified using the indicated primer combinations and PCR products were detected by Southern blot using 32P-labeled oligonucleotide probes. The C-C PCR served as a loading control. –, No input genomic DNA. The results are representative of two different experiments. B, V8 and V14 gene segment usage in WT, ROR–/–, TEA–/–J49–/–, and ROR–/– x TEA–/–J49–/– mice. cDNA samples from four mice of each genotype were amplified using the indicated primers pairs to detect all TCR transcripts that use V8 (V8-C), all transcripts that use V14 (V14-C), or total TCR transcripts (C-C). PCR products were detected by Southern blot using 32P-labeled oligonucleotide probes. Sample loading was adjusted to normalize total TCR transcripts between the different genotypes. –, No input cDNA. The results are representative of two different experiments.

V14-J rearrangements in absence of FynT

V14i NKT cell development is particularly sensitive to certain gene mutations that have relatively minor effects on conventional T cell development. For example, the Src tyrosine kinase, FynT, has been shown to be dispensable for T cell development. T cell subsets are present in normal numbers in the thymus and periphery of FynT^–/– mice, whereas V14i NKT cell numbers are greatly reduced in the thymus and periphery (21, 22). Fig. 5A shows results of flow cytometry analysis of GalCer-CD1d tetramer staining of thymocytes from normal B6 and FynT^–/– adult mice. As expected, tetramer-reactive thymocytes are virtually absent in FynT^–/– mice as compared with WT. Because there is evidence that FynT is implicated in the generation of DP thymocytes and their apoptosis (28, 30, 37), and that the influence of FynT in V14i NKT cells might occur before -chain rearrangement as suggested by others (23), we reasoned that FynT might have a previously unappreciated role in TCR rearrangement. We addressed this possibility using multiplex PCR and Southern blot. Results presented in Fig. 5B show a comparison of adult CD1d^–/– and FynT^–/– thymocyte V14-J(x) gene rearrangement profiles. Both FynT- and CD1d-deficient mice have V14-J(x) rearrangement profiles similar to that of WT (compare with Fig 1). Therefore, from this analysis, it appears that FynT^–/– thymocytes are not blocked in NKT cell development before -chain rearrangement. From the intensity of the hybridization signal, V14-J18 rearrangements appear to occur at a relatively normal frequency in Fyn-deficient thymocytes even though these cells cannot be detected by cell surface reactivity with GalCer-CD1d tetramers.

View larger version (76K): [in this window] [in a new window]   FIGURE 5. Absence of V14 rearrangement deficiency in FynT–/– mice. A, Thymocytes from C57BL/6 and FynT–/– mice were stained using PE-labeled-GalCer/CD1d tetramer and PE-Cy5-labeled anti-TCR. Percentage of TCR+tetramer+ cells is indicated. B, Multiplex PCR and Southern blot analysis of V14-J(x) rearrangement in thymocytes of adult CD1d–/– and FynT–/– mice are shown. Results obtained with the V14 probe are shown. Similar results were obtained with the J probe mix (data not shown).

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

V14

J18

V8.2

V7

V2

J18

Analysis of V14 TCR rearrangements in fetal thymocytes and early DP thymocytes demonstrated a strong 5' bias to J usage, as previously reported for other Vs (26, 32, 38). These results suggest that the same mechanism of stochastic rearrangement within the TCR locus occurs in the generation of V14i NKT cells and "conventional" TCR ⁺ cells. In addition, because V segments are flanked by 23-bp spacer recombination signal sequences (RSS), and J segments are flanked by 12-bp spacer RSSs, multiple rounds of V-J rearrangements can occur on the same allele, with each new rearrangement excising the previous rearrangement onto an extrachromosomal circle. This mechanism ensures that thymocytes have multiple opportunities to create a useful TCR repertoire. Because J18 is located relatively 3' in the J locus, it is likely that V14-J18 rearrangements are the results of secondary V14 rearrangements. In fact, up to 65% of all ⁺ T cells carry receptors that are normally assembled by secondary rearrangements (1). This regulation of TCR rearrangements results in differences between fetal and adult TCR repertoires, with the latter showing increased diversity. Analysis of V14 rearrangements during ontogeny demonstrated that V14 starts rearranging with J segments located 3' in the locus (including J18) only within a 24–48 h window before birth. Consequently, this delayed rearrangement between V14 and J18 leads to the absence of V14i NKT cells in the fetal thymus and a late appearance of this population after birth. In agreement with these results, V14i NKT cells are only detected as early as 3 days after birth by GalCer/CD1d tetramer staining (16, 39, 40, 41). Interestingly, neonatal thymectomy on day 3 after birth leads to multiple independent T cell-mediated organ-specific autoimmune diseases (42). Depletion of several immune regulatory cells, including CD4⁺CD25⁺ regulatory T cells (43), intraepithelial T cells (44), and V14i NKT cells (45) has been demonstrated after neonatal thymectomy. These cell populations may represent several of the contributing factors that are required for the induction and maintenance of self-tolerance. In support of this hypothesis, a recent report demonstrated that aged J18-deficient mice on a nonautoimmune genetic background develop a lupus-like nephritis characterized by proteinuria and Abs against dsDNA and cardiolipin (46).

Two models of thymic development have been proposed for NKT cells (47). The precommitment model suggests that these cells originate from a committed precursor cell before TCR expression. By contrast, the instructive model postulates that V14i NKT cells derive from a T cell progenitor common to conventional thymocytes and V14i NKT cells and that expression by chance of the proper V14i-V8.2/7/2 TCR at the surface of developing thymocytes permits interaction with CD1d and positive selection into the NKT cell lineage. Our results are most consistent with the instructive selection model for V14i NKT cell development. First, in agreement with previous studies (24, 25), we showed that V14i NKT cells are absent in ROR-deficient mice. ROR is a transcription factor expressed exclusively in DP thymocytes during T cell development (48) where it controls DP lifespan through regulation of Bcl-x_L expression level (26). In absence of ROR, TCR rearrangements demonstrate a strong 5' bias to J usage with no participation of the J18 segment. Because J18 cannot be used during these rearrangements, no V14i NKT cells arise in these deficient mice. In addition to regulation of J usage in the DP thymocytes, our analysis revealed a further constraint on the generation of the V14-J18 rearrangement that is related to the V segment usage.

Primary V-to-J rearrangements are essentially driven by the E enhancer (34) and the TEA and J49 promoters (31). Germline transcripts initiated from these promoters contribute to the accessibility of the TCR locus in vivo (36). Transcription from these promoters also prevents the activation of downstream promoters through transcriptional interference and permits the proper progression of the TCR locus recombination events (36). Deletion of these two promoters in vivo derepresses downstream promoters and stimulates primary rearrangement to centrally located J segments (31). We tested whether we could recover some V-J18 rearrangements in absence of ROR by crossing the ROR^–/– mice with TEA^–/–J49^–/– mice. The triple-deficient mice showed a weak recovery of V8-J18 rearrangement, suggesting that promoter deletion was able to induce some early J18 usage, as predicted. However, no V14-J18 rearrangements were detected in these animals. In fact, detection of V14 transcripts (irrespective of J usage) in the thymus of ROR^–/– or ROR^–/– x TEA^–/–J49^–/– mice was largely impaired. These results are in contrast with a previous study where V14-C transcripts were readily amplified from the thymus of ROR^–/– mice (24). The difference between the two studies likely relates to the PCR conditions used to detect V14 transcripts. In our study, the amount of input cDNA and the extent of amplification was limited to keep PCR in the linear range, whereas this was clearly not the case in the previous work (24). Moreover, we analyzed four independently generated cDNA samples derived from each mouse strain with similar results. These results suggest that, like J18, the V14 segment is not used in early TCR rearrangements. This occurs presumably because the two members of the V14 gene family are located further 5' in the V array than three of the six V8 family members. Indeed, as for the J segments, V usage is also regulated. Rearrangements are initiated by using 3' V segments and 5' J segments (32, 49), and then proceed by using upstream V and downstream J segments until they are terminated by successful positive selection. Altogether, our results demonstrate that there are at least two constraints on V14i NKT cell development in DP thymocytes, one at the level of J usage and the other at the level of the V usage.

Finally, because ROR is exclusively expressed in DP thymocytes (48), these data strongly suggest that thymocyte commitment to the NKT cell lineage occurs at this stage of differentiation. Associated with previous results showing that rearrangements of the silent TCR allele in TCR⁺NK1.1⁺ hybridoma are not canonical (50), these data argue against a directed rearrangement of V14 to J18 segments and do not support the precommitment model of V14i NKT cell development.

The difference in V14-J rearrangements in mice deficient for ROR and FynT suggests that these transcription factors function at different stages of V14i NKT cell development. Introduction of a prerearranged V14-J18 TCR transgene onto the FynT^–/– background restored normal development of V14i NKT cells in these deficient mice (23). These results led to the hypothesis that FynT may play a role before and/or during -chain rearrangement rather than during the positive selection of V14i NKT cells (23). In support of this, FynT has been reported to be involved in the generation of DP thymocytes and their apoptosis (28, 30, 37). Therefore, it remained possible that FynT might modulate TCR rearrangements through its modulation of DP lifespan. However, analysis of V14-Js rearrangements in FynT^–/– thymocytes did not reveal any deficiency. These results suggest that while FynT is clearly indispensable to V14i NKT cell development, it does not act at the level of TCR rearrangement. A more complete and thoughtful analysis of the V14-J18 TCR-transgenic mice used in the FynT study was recently conducted (51). By crossing the V14-J18 TCR-transgenic mice with CD1d^–/– mice, the authors revealed the presence of a sizeable population of GalCer/CD1d tetramer⁺ cells in these mice (51). These peculiar cells appeared to mature in the absence of thymic ligand and are believed to be induced by the early expression of the TCR -chain, a common artifact of TCR-transgenic mice (52). It remains to be determined whether these cells might have been responsible for the restoration of the V14i NKT cell population in the FynT^–/– mice (23).

In conclusion, our study provides data in support of an instructive model of NKT cell development where DP thymocytes randomly rearrange their TCR and may acquire the specificity to recognize CD1d/Ag if they rearrange V14 to J18. The late appearance of V14i NKT cells in ontogeny can be explained by our observation that the particular rearrangement of V14 to J18 is constrained by late accessibility of both of these gene segments. In addition, we found that rearrangements of the TCR locus, including V14 to J18, occur independently of FynT.

	Disclosures

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
The authors have no financial conflict of interest.

	Footnotes

 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ J.L.M. is a recipient of an American Cancer Society Award. This work was supported by grants from the Cancer League of Colorado (to L.G.) and the National Institutes of Health (AI057485 (to L.G.) and GM41052 (to M.S.K.)).

² Current address: Children’s Hospital of Pittsburgh, Pittsburgh, PA 15213.

³ Address correspondence and reprint requests to Dr. Laurent Gapin, National Jewish Medical and Research Center, 1400 Jackson Street, Denver, CO 80206. E-mail address: gapinl{at}njc.org

⁴ Abbreviations used in this paper: DP, double positive; GalCer, -galactosylceramide; ROR, retinoic acid receptor-related orphan receptor; TEA, T early ; WT, wild type; CDR, complementary determining region.

Received for publication March 22, 2007. Accepted for publication June 4, 2007.

	References

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 

1. Yannoutsos, N., P. Wilson, W. Yu, H. T. Chen, A. Nussenzweig, H. Petrie, M. C. Nussenzweig. 2001. The role of recombination activating gene (RAG) reinduction in thymocyte development in vivo. J. Exp. Med. 194: 471-480. [Abstract/Free Full Text]
2. Tsuji, M.. 2006. Glycolipids and phospholipids as natural CD1d-binding NKT cell ligands. Cell Mol. Life Sci. 63: 1889-1898. [Medline]
3. Kronenberg, M., L. Gapin. 2002. The unconventional lifestyle of NKT cells. Nat. Rev. Immunol. 2: 557-568. [Medline]
4. Brigl, M., M. B. Brenner. 2004. CD1: antigen presentation and T cell function. Annu. Rev. Immunol. 22: 817-890. [Medline]
5. Kronenberg, M.. 2005. Toward an understanding of NKT cell biology: progress and paradoxes. Annu. Rev. Immunol. 23: 877-900. [Medline]
6. Bosc, N., M. P. Lefranc. 2003. The mouse (Mus musculus) T cell receptor (TRA) and (TRD) variable genes. Dev. Comp. Immunol. 27: 465-497. [Medline]
7. Arden, B., S. P. Clark, D. Kabelitz, T. W. Mak. 1995. Mouse T-cell receptor variable gene segment families. Immunogenetics 42: 501-530. [Medline]
8. Lantz, O., A. Bendelac. 1994. An invariant T cell receptor chain is used by a unique subset of major histocompatibility complex class I-specific CD4⁺ and CD4^–8^– T cells in mice and humans. J. Exp. Med. 180: 1097-1106. [Abstract/Free Full Text]
9. Matsuda, J. L., L. Gapin, N. Fazilleau, K. Warren, O. V. Naidenko, M. Kronenberg. 2001. Natural killer T cells reactive to a single glycolipid exhibit a highly diverse T cell receptor repertoire and small clone size. Proc. Natl. Acad. Sci. USA 98: 12636-12641. [Abstract/Free Full Text]
10. Ohteki, T., H. R. MacDonald. 1996. Stringent V requirement for the development of NK1.1⁺ T cell receptor-/⁺ cells in mouse liver. J. Exp. Med. 183: 1277-1282. [Abstract/Free Full Text]
11. Godfrey, D. I., H. R. MacDonald, M. Kronenberg, M. J. Smyth, L. Van Kaer. 2004. NKT cells: what’s in a name?. Nat. Rev. Immunol. 4: 231-237. [Medline]
12. Kawano, T., J. Cui, Y. Koezuka, I. Toura, Y. Kaneko, K. Motoki, H. Ueno, R. Nakagawa, H. Sato, E. Kondo, et al 1997. CD1d-restricted and TCR-mediated activation of V14 NKT cells by glycosylceramides. Science 278: 1626-1629. [Abstract/Free Full Text]
13. Burdin, N., L. Brossay, Y. Koezuka, S. T. Smiley, M. J. Grusby, M. Gui, M. Taniguchi, K. Hayakawa, M. Kronenberg. 1998. Selective ability of mouse CD1 to present glycolipids: -galactosylceramide specifically stimulates V14⁺ NK T lymphocytes. J. Immunol. 161: 3271-3281. [Abstract/Free Full Text]
14. Benlagha, K., A. Weiss, A. Beavis, L. Teyton, A. Bendelac. 2000. In vivo identification of glycolipid antigen-specific T cells using fluorescent CD1d tetramers. J. Exp. Med. 191: 1895-1903. [Medline]
15. Matsuda, J. L., O. V. Naidenko, L. Gapin, T. Nakayama, M. Taniguchi, C. R. Wang, Y. Koezuka, M. Kronenberg. 2000. Tracking the response of natural killer T cells to a glycolipid antigen using CD1d tetramers. J. Exp. Med. 192: 741-754. [Abstract/Free Full Text]
16. Gapin, L., J. L. Matsuda, C. D. Surh, M. Kronenberg. 2001. NKT cells derive from double-positive thymocytes that are positively selected by CD1d. Nat. Immunol. 2: 971-978. [Medline]
17. Dao, T., D. Guo, A. Ploss, A. Stolzer, C. Saylor, T. E. Boursalian, J. S. Im, D. B. Sant’Angelo. 2004. Development of CD1d-restricted NKT cells in the mouse thymus. Eur. J. Immunol. 34: 3542-3552. [Medline]
18. Bendelac, A.. 1995. Positive selection of mouse NK1⁺ T cells by CD1-expressing cortical thymocytes. J. Exp. Med. 182: 2091-2096. [Abstract/Free Full Text]
19. Wei, D. G., H. Lee, S. H. Park, L. Beaudoin, L. Teyton, A. Lehuen, A. Bendelac. 2005. Expansion and long-range differentiation of the NKT cell lineage in mice expressing CD1d exclusively on cortical thymocytes. J. Exp. Med. 202: 239-248. [Abstract/Free Full Text]
20. Matsuda, J. L., L. Gapin. 2005. Developmental program of mouse V14i NKT cells. Curr. Opin. Immunol. 17: 122-130. [Medline]
21. Gadue, P., N. Morton, P. L. Stein. 1999. The Src family tyrosine kinase Fyn regulates natural killer T cell development. J. Exp. Med. 190: 1189-1196. [Abstract/Free Full Text]
22. Eberl, G., B. Lowin-Kropf, H. R. MacDonald. 1999. Cutting edge: NKT cell development is selectively impaired in Fyn- deficient mice. J. Immunol. 163: 4091-4094. [Abstract/Free Full Text]
23. Gadue, P., L. Yin, S. Jain, P. L. Stein. 2004. Restoration of NK T cell development in fyn-mutant mice by a TCR reveals a requirement for Fyn during early NK T cell ontogeny. J. Immunol. 172: 6093-6100. [Abstract/Free Full Text]
24. Bezbradica, J. S., T. Hill, A. K. Stanic, L. Van Kaer, S. Joyce. 2005. Commitment toward the natural T (iNKT) cell lineage occurs at the CD4⁺8⁺ stage of thymic ontogeny. Proc. Natl. Acad. Sci. USA 102: 5114-5119. [Abstract/Free Full Text]
25. Egawa, T., G. Eberl, I. Taniuchi, K. Benlagha, F. Geissmann, L. Hennighausen, A. Bendelac, D. R. Littman. 2005. Genetic evidence supporting selection of the V14i NKT cell lineage from double-positive thymocyte precursors. Immunity 22: 705-716. [Medline]
26. Guo, J., A. Hawwari, H. Li, Z. Sun, S. K. Mahanta, D. R. Littman, M. S. Krangel, Y. W. He. 2002. Regulation of the TCR repertoire by the survival window of CD4⁺CD8⁺ thymocytes. Nat. Immunol. 3: 469-476. [Medline]
27. Molina, T. J., K. Kishihara, D. P. Siderovski, W. van Ewijk, A. Narendran, E. Timms, A. Wakeham, C. J. Paige, K. U. Hartmann, A. Veillette, et al 1992. Profound block in thymocyte development in mice lacking p56lck. Nature 357: 161-164. [Medline]
28. Groves, T., P. Smiley, M. P. Cooke, K. Forbush, R. M. Perlmutter, C. J. Guidos. 1996. Fyn can partially substitute for Lck in T lymphocyte development. Immunity 5: 417-428. [Medline]
29. Cooke, M. P., K. M. Abraham, K. A. Forbush, R. M. Perlmutter. 1991. Regulation of T cell receptor signaling by a src family protein-tyrosine kinase (p59^fyn). Cell 65: 281-291. [Medline]
30. Donlin, L. T., C. A. Roman, M. Adlam, A. G. Regelmann, K. Alexandropoulos. 2002. Defective thymocyte maturation by transgenic expression of a truncated form of the T lymphocyte adapter molecule and Fyn substrate, Sin. J. Immunol. 169: 6900-6909. [Abstract/Free Full Text]
31. Hawwari, A., C. Bock, M. S. Krangel. 2005. Regulation of T cell receptor gene assembly by a complex hierarchy of germline J promoters. Nat. Immunol. 6: 481-489. [Medline]
32. Pasqual, N., M. Gallagher, C. Aude-Garcia, M. Loiodice, F. Thuderoz, J. Demongeot, R. Ceredig, P. N. Marche, E. Jouvin-Marche. 2002. Quantitative and qualitative changes in V-J rearrangements during mouse thymocytes differentiation: implication for a limited T cell receptor chain repertoire. J. Exp. Med. 196: 1163-1173. [Abstract/Free Full Text]
33. Mancini, S. J., S. M. Candeias, J. P. Di Santo, P. Ferrier, P. N. Marche, E. Jouvin-Marche. 2001. TCRA gene rearrangement in immature thymocytes in absence of CD3, pre-TCR, and TCR signaling. J. Immunol. 157: 4485-4493.
34. Sleckman, B. P., C. G. Bardon, R. Ferrini, L. Davidson, F. W. Alt. 1997. Function of the TCR enhancer in and T cells. Immunity 7: 505-515. [Medline]
35. Villey, I., D. Caillol, F. Selz, P. Ferrier, J. P. de Villartay. 1996. Defect in rearrangement of the most 5' TCR-J following targeted deletion of T early (TEA): implications for TCR locus accessibility. Immunity 5: 331-342. [Medline]
36. Abarrategui, I., M. S. Krangel. 2006. Regulation of T cell receptor- gene recombination by transcription. Nat. Immunol. 10: 1109-1115.
37. van Oers, N. S., B. Lowin-Kropf, D. Finlay, K. Connolly, A. Weiss. 1996. T cell development is abolished in mice lacking both Lck and Fyn protein tyrosine kinases. Immunity 5: 429-436. [Medline]
38. Thompson, S. D., J. Pelkonen, J. L. Hurwitz. 1990. First T cell receptor gene rearrangements during T cell ontogeny skew to the 5' region of the J locus. J. Immunol. 145: 2347-2352. [Abstract]
39. Benlagha, K., D. G. Wei, J. Veiga, L. Teyton, A. Bendelac. 2005. Characterization of the early stages of thymic NKT cell development. J. Exp. Med. 202: 485-492. [Abstract/Free Full Text]
40. Benlagha, K., T. Kyin, A. Beavis, L. Teyton, A. Bendelac. 2002. A thymic precursor to the NKT cell lineage. Science 296: 553-555. [Abstract/Free Full Text]
41. Pellicci, D. G., K. J. L. Hammond, A. P. Uldrich, A. Baxter, M. J. Smyth, D. I. Godfrey. 2002. NKT cells develop through a thymus-dependent NK1.1^–CD4⁺ CD1d-dependent precursor stage. J. Exp. Med. 195: 835-844. [Abstract/Free Full Text]
42. Bonomo, A., P. J. Kehn, E. M. Shevach. 1995. Post-thymectomy autoimmunity: abnormal T-cell homeostasis. Immunol. Today 16: 61-67. [Medline]
43. Asano, M., M. Toda, N. Sakaguchi, S. Sakaguchi. 1996. Autoimmune disease as a consequence of developmental abnormality of a T cell subpopulation. J. Exp. Med. 184: 387-396. [Abstract/Free Full Text]
44. Locke, N. R., S. Stankovic, D. P. Funda, L. C. Harrison. 2006. TCR intraepithelial lymphocytes are required for self-tolerance. J. Immunol. 176: 6553-6559. [Abstract/Free Full Text]
45. Hammond, K., W. Cain, I. van Driel, D. Godfrey. 1998. Three day neonatal thymectomy selectively depletes NK1.1⁺ T cells. Int. Immunol. 10: 1491-1499. [Abstract/Free Full Text]
46. Sireci, G., D. Russo, F. Dieli, S. A. Porcelli, M. Taniguchi, M. P. La Manna, D. Di Liberto, F. Scarpa, A. Salerno. 2007. Immunoregulatory role of J281 T cells in aged mice developing lupus-like nephritis. Eur. J. Immunol. 37: 425-433. [Medline]
47. Bendelac, A., M. N. Rivera, S. H. Park, J. H. Roark. 1997. Mouse CD1-specific NK1 T cells: development, specificity, and function. Annu. Rev. Immunol. 15: 535-562. [Medline]
48. Eberl, G., D. R. Littman. 2004. Thymic origin of intestinal T cells revealed by fate mapping of RORt⁺ cells. Science 305: 248-251. [Abstract/Free Full Text]
49. Huang, C., O. Kanagawa. 2001. Ordered and coordinated rearrangement of the TCR locus: role of secondary rearrangement in thymic selection. J. Immunol. 166: 2597-2601. [Abstract/Free Full Text]
50. Shimamura, M., T. Ohteki, U. Beutner, H. R. MacDonald. 1997. Lack of directed V14-J281 rearrangements in NK1⁺ T cells. Eur. J. Immunol. 27: 1576-1579. [Medline]
51. Wei, D. G., S. A. Curran, P. B. Savage, L. Teyton, A. Bendelac. 2006. Mechanisms imposing the V bias of V 14 natural killer T cells and consequences for microbial glycolipid recognition. J. Exp. Med. 203: 1197-1207. [Abstract/Free Full Text]
52. Baldwin, T. A., M. M. Sandau, S. C. Jameson, K. A. Hogquist. 2005. The timing of TCR expression critically influences T cell development and selection. J. Exp. Med. 202: 111-121. [Abstract/Free Full Text]

This Article <